The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	430932	487806	8304518	integrase,transposase	Planktothrix_phage(18.18%)	59	448548:448566	477435:477453
WP_036552925.1|430932_432261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091501.1|432389_433094_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033091500.1|433232_434573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091499.1|434644_435385_+	glycoside hydrolase family 25 protein	NA	A0A1P8D5Q3	Corynebacterium_phage	26.3	1.5e-06
WP_033091498.1|435381_436107_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	6.2e-26
WP_045440297.1|436103_437930_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_071344700.1|438002_438779_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033091497.1|438902_439331_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_033091496.1|439327_439561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343376.1|439753_440254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091494.1|440240_440465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343377.1|440529_440853_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343378.1|440852_441779_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036552750.1|442006_442426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036552749.1|443441_443825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161494.1|443857_444265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083414793.1|444412_445081_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_033088236.1|445068_445536_-	NUDIX domain-containing protein	NA	D9I6E8	Acinetobacter_virus	58.5	1.6e-06
WP_033088253.1|445546_446260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088252.1|446583_446943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161493.1|447185_447857_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_083414794.1|448062_448488_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|448501_449587_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
448548:448566	attL	TCGAGGATCTCGTCGGCGG	NA	NA	NA	NA
WP_081985960.1|449657_450125_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	65.6	1.1e-15
WP_033088234.1|450216_451287_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.5	1.1e-18
WP_033088250.1|451297_451798_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071343379.1|451921_453091_+	thiolase family protein	NA	NA	NA	NA	NA
WP_158544169.1|453202_453841_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_033088232.1|453841_454177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161492.1|454216_455266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045437790.1|455465_456392_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_158660713.1|456372_456846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343381.1|457359_457872_-	TIGR04338 family metallohydrolase	NA	NA	NA	NA	NA
WP_033088229.1|457883_458708_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_033088228.1|458874_460179_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081985958.1|460248_461259_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_081985957.1|461258_462152_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_033088227.1|462247_464467_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_071343382.1|464782_465238_+	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_033088225.1|465248_465674_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_033088224.1|465734_466832_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.9	8.4e-75
WP_033088223.1|466824_467382_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033088222.1|467557_467971_+	DUF5318 domain-containing protein	NA	NA	NA	NA	NA
WP_081985956.1|468274_470905_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_083414795.1|470914_472633_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_071343383.1|472629_474030_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.7	1.8e-13
WP_071343384.1|474140_474872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088219.1|474892_475894_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_071344703.1|475893_476535_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_033088218.1|476531_477338_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_045437775.1|477355_478210_-	haloacid dehalogenase	NA	NA	NA	NA	NA
477435:477453	attR	TCGAGGATCTCGTCGGCGG	NA	NA	NA	NA
WP_052086518.1|478225_480763_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0S8	Acinetobacter_phage	30.9	1.7e-30
WP_081985954.1|480810_482031_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_081985953.1|482062_483262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088216.1|483498_484074_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.2	1.7e-34
WP_033088215.1|484173_485292_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	43.4	2.4e-61
WP_071343385.1|485312_486275_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_083415081.1|486374_487082_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071812216.1|487017_487806_+|transposase	transposase	transposase	M4I0N8	Staphylococcus_phage	40.7	3.0e-26
>prophage 2
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	720632	775286	8304518	tRNA,transposase,protease	Mycobacterium_phage(33.33%)	53	NA	NA
WP_071343319.1|720632_721718_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091558.1|721767_723237_-	LCP family protein	NA	NA	NA	NA	NA
WP_096490769.1|723287_724109_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096490770.1|724379_725072_-	DUF2470 domain-containing protein	NA	NA	NA	NA	NA
WP_081986465.1|725237_725681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343420.1|725763_726681_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_033091551.1|726677_727340_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_045440376.1|727343_728162_-	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_052087080.1|728158_728599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155240167.1|728603_728756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071812172.1|728844_729978_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081986172.1|730131_730716_-	PPE domain-containing protein	NA	NA	NA	NA	NA
WP_033089872.1|730732_731044_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_033089873.1|731124_731478_-	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_045438212.1|731498_732575_-	septum formation family protein	NA	NA	NA	NA	NA
WP_033089875.1|734574_735834_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	32.7	3.9e-60
WP_071343422.1|735978_737778_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_045438227.1|737905_739186_+	MFS transporter	NA	NA	NA	NA	NA
WP_071343423.1|739353_739545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036546359.1|739575_740517_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033089878.1|740580_741600_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_033089879.1|741704_742058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344710.1|742128_743673_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_071343424.1|743718_744570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089880.1|744669_745419_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_158660716.1|746097_746997_+	helix-turn-helix domain-containing protein	NA	A0A1J0MCL6	Streptomyces_phage	33.4	8.8e-30
WP_045438214.1|747003_747228_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_045438230.1|747298_747847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089882.1|747951_749622_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_036546354.1|749642_751310_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_071343425.1|751358_753023_-	ABC transporter family substrate-binding protein	NA	NA	NA	NA	NA
WP_071343426.1|753034_754918_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-21
WP_036546351.1|754914_755841_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033089897.1|755840_756872_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071343427.1|757107_757947_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_052086812.1|757951_760282_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_052486699.1|760447_761809_+	SpoIID/LytB domain-containing protein	NA	NA	NA	NA	NA
WP_158543915.1|762380_762635_-	helix-turn-helix transcriptional regulator	NA	A0A076G7U2	Mycobacterium_phage	52.2	1.8e-09
WP_143161496.1|762775_763021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052486700.1|763020_763692_+	hypothetical protein	NA	G9FH77	Rhodococcus_phage	43.5	2.0e-34
WP_082062662.1|764048_764822_+	PE-PPE domain-containing protein	NA	NA	NA	NA	NA
WP_052087067.1|764969_765812_+	glycoside hydrolase family 25 protein	NA	S5VMY8	Mycobacterium_phage	52.3	1.1e-61
WP_036546349.1|765808_766051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091475.1|766055_766442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045438220.1|766434_766716_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033091476.1|766999_767578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091477.1|767789_768404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660717.1|768406_768940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343317.1|768951_770085_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343429.1|770699_772454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|772442_773528_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158660718.1|773868_774159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|774200_775286_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	792017	803384	8304518		Macacine_betaherpesvirus(100.0%)	8	NA	NA
WP_033087599.1|792017_793061_+	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	37.0	2.3e-50
WP_045437339.1|793360_794449_+	esterase family protein	NA	A0A2I6AZH7	Macacine_betaherpesvirus	33.6	3.1e-45
WP_033087619.1|794718_795711_+	esterase family protein	NA	A0A2I6AZH7	Macacine_betaherpesvirus	36.5	2.0e-43
WP_071812443.1|795938_796922_+	esterase family protein	NA	A0A2I6B0H1	Macacine_betaherpesvirus	40.5	1.4e-57
WP_033087602.1|797285_798326_+	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	38.1	4.6e-38
WP_081985873.1|798700_799855_+	hypothetical protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	40.2	9.5e-37
WP_083414805.1|799962_801003_+	esterase family protein	NA	A0A2I6AZH7	Macacine_betaherpesvirus	39.4	1.6e-46
WP_071812254.1|801269_803384_+	esterase	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	36.0	2.1e-37
>prophage 4
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	886049	958649	8304518	tRNA,integrase,transposase	Gordonia_phage(13.33%)	59	887171:887199	894196:894224
WP_033087766.1|886049_886589_+|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
WP_033087783.1|886615_887053_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	33.8	3.3e-06
887171:887199	attL	CGAGGGTTCAAATCCCTCCGCCACCGCCA	NA	NA	NA	NA
WP_081985890.1|887237_888473_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	39.6	2.6e-64
WP_033087767.1|888477_888957_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162483913.1|889042_889207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161505.1|889145_889325_+	helix-turn-helix domain-containing protein	NA	A0A0E3XA16	Gordonia_phage	60.0	1.7e-09
WP_033087768.1|889321_889651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414808.1|889647_890682_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_143161506.1|891019_891238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045439477.1|891246_892149_+	site-specific DNA-methyltransferase	NA	R4JEL7	Mycobacterium_phage	26.0	5.5e-16
WP_033087769.1|892145_892751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|892959_894045_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343450.1|894300_894528_-	hypothetical protein	NA	NA	NA	NA	NA
894196:894224	attR	CGAGGGTTCAAATCCCTCCGCCACCGCCA	NA	NA	NA	NA
WP_083414809.1|894674_895088_-	DUF1851 domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|895047_896181_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158543917.1|897903_898710_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_071343451.1|898869_901203_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_071343452.1|901444_902032_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083414810.1|902072_902612_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090959.1|902715_904449_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	2.1e-43
WP_081986322.1|904445_906413_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.4e-56
WP_071343453.1|906417_907677_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	34.4	3.5e-61
WP_033090957.1|907706_908480_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	29.9	8.7e-18
WP_033090956.1|908541_909156_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_033090955.1|909246_910014_-	RDD family protein	NA	NA	NA	NA	NA
WP_033090954.1|910066_911011_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071343319.1|912067_913153_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343454.1|913157_913367_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|913526_914660_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_052086596.1|916604_918050_+	DUF1298 domain-containing protein	NA	NA	NA	NA	NA
WP_071343455.1|918268_919339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088621.1|919669_920959_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_081986015.1|921037_921913_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_103557197.1|921986_922565_+	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
WP_033088622.1|922683_923400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088623.1|923553_924285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343456.1|924426_924975_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_045438129.1|925020_925899_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_081986012.1|925895_926984_+	ABC transporter permease subunit	NA	G9BWD6	Planktothrix_phage	36.5	3.6e-09
WP_143161507.1|926976_927180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036550592.1|927172_928084_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071343457.1|928107_929739_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	3.1e-17
WP_071343458.1|929738_930890_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033088628.1|931090_932362_-	ROK family protein	NA	NA	NA	NA	NA
WP_033088629.1|932613_933522_-	immunity 49 family protein	NA	NA	NA	NA	NA
WP_033088630.1|933639_935241_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_071343459.1|935705_936638_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	27.9	2.9e-12
WP_033088632.1|936699_937998_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	30.1	3.0e-39
WP_033088633.1|938103_938937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088635.1|942444_943656_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_036548973.1|943767_945921_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_071344714.1|946167_949791_+	protein kinase	NA	A0A1E1EXG0	Acanthamoeba_castellanii_mimivirus	30.3	6.7e-20
WP_036548969.1|949881_951381_+	membrane protein	NA	NA	NA	NA	NA
WP_071343460.1|951396_952713_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.1	8.6e-34
WP_045438126.1|952709_954140_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_036548963.1|954329_955268_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_158543921.1|955222_955777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343461.1|956322_957567_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	23.7	3.3e-11
WP_071343319.1|957563_958649_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	1474893	1583618	8304518	bacteriocin,tRNA,transposase	Pike_perch_iridovirus(16.67%)	59	NA	NA
WP_071811572.1|1474893_1476051_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_033087924.1|1476155_1477139_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_071343543.1|1477348_1477939_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|1479309_1480395_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036552935.1|1480620_1481076_-	ester cyclase	NA	NA	NA	NA	NA
WP_033091766.1|1481178_1481841_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_158660712.1|1481950_1483405_+	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_071343544.1|1483639_1484725_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091649.1|1485839_1486688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343546.1|1487041_1488277_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091651.1|1488339_1488783_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_033091652.1|1488804_1489566_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_071343317.1|1489747_1490881_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091201.1|1490926_1491520_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343547.1|1491608_1493168_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	61.1	3.5e-18
WP_071344732.1|1493176_1495180_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_033091203.1|1495176_1496337_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033091204.1|1496333_1496813_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_033091205.1|1496809_1497643_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_033091206.1|1497654_1499589_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_033091207.1|1499582_1500008_-	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_033091208.1|1500147_1500909_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_033091209.1|1500989_1501571_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343548.1|1502819_1503785_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_071344733.1|1504061_1505303_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071343549.1|1505796_1507263_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_071344734.1|1507355_1508585_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_033090533.1|1508850_1509891_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_071343550.1|1509976_1510702_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	3.9e-28
WP_033090531.1|1510740_1511790_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081986264.1|1511977_1513093_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_033090529.1|1513089_1513725_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033090528.1|1513773_1514199_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090534.1|1514235_1514994_+	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_071343551.1|1515294_1559673_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	23.8	8.8e-130
WP_033085691.1|1559834_1560404_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_033085692.1|1560423_1561227_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_033085693.1|1561406_1562174_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	7.0e-20
WP_071343552.1|1562158_1563727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052085983.1|1563959_1565378_+	vanadium-dependent haloperoxidase	NA	A0A1V0SKZ4	Klosneuvirus	33.6	1.2e-52
WP_033085695.1|1565409_1566555_-	lipase	NA	NA	NA	NA	NA
WP_081985634.1|1566599_1567127_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045435825.1|1567221_1568064_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_071343553.1|1568070_1569678_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_071811579.1|1569716_1571729_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_033085698.1|1571725_1572361_-	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_071343554.1|1572357_1573104_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_155239121.1|1573100_1573250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045435802.1|1573266_1574850_-	amino acid permease	NA	NA	NA	NA	NA
WP_033085700.1|1575026_1575710_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033085701.1|1575735_1577049_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	27.3	3.4e-06
WP_033085702.1|1577185_1578817_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_143161174.1|1578804_1579311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033085704.1|1579427_1579823_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_033085757.1|1579856_1580312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343555.1|1580472_1581003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033085706.1|1581105_1581696_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_033085707.1|1581833_1582820_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_033085708.1|1582820_1583618_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	1638799	1693075	8304518	transposase	Acinetobacter_phage(40.0%)	52	NA	NA
WP_071343319.1|1638799_1639885_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033085746.1|1639950_1640622_+	MspA family porin	NA	NA	NA	NA	NA
WP_033085747.1|1640920_1641601_+	MspA family porin	NA	NA	NA	NA	NA
WP_033085748.1|1641664_1642345_+	MspA family porin	NA	NA	NA	NA	NA
WP_033085749.1|1642428_1642830_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_071343564.1|1642909_1643575_-	flagellar biosynthesis protein FlgA	NA	NA	NA	NA	NA
WP_033085751.1|1643662_1643968_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_033085752.1|1644038_1644641_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_081985637.1|1644665_1646321_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_071343317.1|1646498_1647632_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343565.1|1647883_1648822_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	8.0e-50
WP_033091306.1|1648913_1650173_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_033091307.1|1650255_1650906_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071343319.1|1650998_1652084_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091308.1|1652234_1653350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087030.1|1653437_1654424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082062781.1|1654423_1655170_-	ParA family protein	NA	NA	NA	NA	NA
WP_081986387.1|1655781_1656393_+	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	43.4	7.6e-17
WP_071811590.1|1656310_1657231_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_103557201.1|1657422_1658373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161175.1|1658321_1658978_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343566.1|1659279_1659990_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083414824.1|1660062_1661196_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660722.1|1661377_1661659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089952.1|1661807_1662755_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_033089953.1|1662932_1664588_-	cutinase family protein	NA	NA	NA	NA	NA
WP_045438902.1|1664704_1666150_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_033089954.1|1666323_1667142_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_158660723.1|1667460_1667628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089955.1|1667645_1668173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660724.1|1668189_1668351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161465.1|1668367_1668913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089957.1|1669561_1669798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086822.1|1669837_1670665_+	glycoside hydrolase family 25 protein	NA	A0A076YQC8	Mycobacterium_phage	49.8	1.4e-61
WP_143161464.1|1670618_1671278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089958.1|1671830_1673333_+	FAD binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.2	4.5e-63
WP_071343569.1|1673329_1675774_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	44.6	3.8e-176
WP_045438906.1|1675775_1676630_+	xanthine dehydrogenase accessory protein XdhC	NA	NA	NA	NA	NA
WP_158544157.1|1677972_1678437_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_161789511.1|1679116_1679614_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_045438909.1|1679624_1680059_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_033089962.1|1680211_1681057_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_033089963.1|1681440_1682253_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071343570.1|1682451_1682679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161463.1|1683797_1684415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089973.1|1684684_1685116_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_033089966.1|1685124_1685355_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167659824.1|1685553_1686861_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_033089967.1|1686873_1687332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161462.1|1687352_1689899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|1690121_1691207_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343317.1|1691941_1693075_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	1809992	1937442	8304518	transposase	uncultured_Mediterranean_phage(16.67%)	117	NA	NA
WP_071343591.1|1809992_1811063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033089620.1|1811210_1811534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089619.1|1811682_1812198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343592.1|1812197_1812737_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_071343593.1|1812733_1813399_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_036546927.1|1813411_1814371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089628.1|1814484_1815324_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033089627.1|1815429_1816155_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071343594.1|1816411_1817257_-	universal stress protein	NA	NA	NA	NA	NA
WP_033089617.1|1817480_1818356_-	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_033089616.1|1818352_1818949_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033089615.1|1819015_1819504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089626.1|1819500_1820676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089614.1|1820927_1821269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089613.1|1821288_1822647_-	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_033089612.1|1822643_1823600_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033089611.1|1823770_1824682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343596.1|1827236_1828370_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_071343597.1|1828509_1831101_+	DUF756 domain-containing protein	NA	NA	NA	NA	NA
WP_033089609.1|1831179_1832415_+	cytochrome P450	NA	NA	NA	NA	NA
WP_033089608.1|1832483_1833053_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033089607.1|1833106_1833409_+	chorismate mutase	NA	NA	NA	NA	NA
WP_071343598.1|1833390_1834851_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071343599.1|1834991_1836032_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_052086760.1|1836032_1836968_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033089604.1|1837029_1837902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045438738.1|1838193_1839711_+	amino acid permease	NA	NA	NA	NA	NA
WP_036546915.1|1839848_1840145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089621.1|1840196_1840631_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_143161459.1|1840975_1841395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986134.1|1842619_1844245_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_143161458.1|1844284_1844512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|1844508_1845594_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033090436.1|1845663_1847091_+	MFS transporter	NA	NA	NA	NA	NA
WP_071343319.1|1847194_1848280_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033090437.1|1848345_1849494_+	methyltransferase	NA	NA	NA	NA	NA
WP_033090452.1|1849508_1850435_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071343600.1|1850594_1851467_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_033090439.1|1851552_1851891_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_045439232.1|1851957_1852752_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_071343601.1|1852748_1854683_-	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	28.5	7.0e-16
WP_033090441.1|1854633_1855419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083415115.1|1855415_1857272_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_052086908.1|1857441_1858758_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_033090442.1|1858828_1859596_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_033090443.1|1859592_1860543_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_071343602.1|1860554_1862558_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_033090445.1|1862586_1862844_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_033090446.1|1862953_1864171_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_033090447.1|1864278_1864743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343603.1|1864824_1866213_+	cystathionine beta-synthase	NA	A0A1X9I5K7	Streptococcus_phage	41.4	1.4e-55
WP_071343317.1|1866258_1867392_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_052086909.1|1867677_1868811_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090449.1|1868740_1869301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090450.1|1869307_1869748_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_033090451.1|1869837_1871370_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|1872022_1873108_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071344744.1|1873147_1873744_+	transglycosylase SLT domain-containing protein	NA	A0A0K0NKU9	Gordonia_phage	52.5	6.4e-21
WP_071343319.1|1873903_1874989_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343544.1|1875038_1876124_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071812162.1|1876243_1877257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091278.1|1877323_1877668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036551113.1|1877742_1878918_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033091276.1|1879028_1880174_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	32.3	6.8e-27
WP_033091275.1|1880257_1880749_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_033091274.1|1880993_1881410_-	DUF4307 domain-containing protein	NA	NA	NA	NA	NA
WP_045440057.1|1881566_1882448_+	mycothiol conjugate amidase Mca	NA	NA	NA	NA	NA
WP_033091272.1|1882444_1882726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087026.1|1882856_1883312_-	VOC family protein	NA	NA	NA	NA	NA
WP_071343605.1|1883420_1884116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161457.1|1885889_1886744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343606.1|1886767_1887691_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_071343607.1|1887773_1888859_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490717.1|1888955_1889165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036552418.1|1889194_1890655_+	flotillin family protein	NA	NA	NA	NA	NA
WP_081986471.1|1890783_1892061_-	MFS transporter	NA	NA	NA	NA	NA
WP_167659836.1|1892425_1893553_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|1895768_1896902_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090789.1|1897049_1897940_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_145961857.1|1899236_1899698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090787.1|1900701_1901274_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_033090786.1|1901398_1902046_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090785.1|1902112_1902667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986299.1|1903701_1903929_+	hypothetical protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	41.1	1.4e-05
WP_071344745.1|1903925_1904585_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_145961856.1|1904661_1905732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343609.1|1905856_1906669_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033090784.1|1906777_1907263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090783.1|1907278_1908016_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.8	1.6e-24
WP_033090782.1|1908012_1908852_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_158660727.1|1908837_1910157_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	23.3	2.0e-22
WP_081986302.1|1910424_1911249_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_143161454.1|1911276_1911675_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033090791.1|1911759_1912863_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_083415118.1|1912980_1913151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071812156.1|1913122_1913272_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_052086965.1|1913691_1914195_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_096490404.1|1914792_1915125_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036553034.1|1915124_1916060_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158544147.1|1916266_1916875_+	MspA family porin	NA	NA	NA	NA	NA
WP_052087123.1|1917160_1917373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343489.1|1918523_1919852_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091095.1|1923124_1923601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986345.1|1923926_1925438_-	HAMP domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.4	3.1e-11
WP_081986343.1|1925567_1926275_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_033091093.1|1926416_1927196_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.6	1.3e-16
WP_045438056.1|1927276_1927882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091092.1|1928051_1928984_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.2	1.5e-27
WP_033091091.1|1929367_1930549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414837.1|1931028_1932405_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	49.5	7.5e-89
WP_033091090.1|1932529_1932835_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033091089.1|1932911_1933238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036547006.1|1933241_1933514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088984.1|1933536_1933923_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_071812413.1|1934151_1935552_+	PhoH family protein	NA	A0A2L0UZX2	Agrobacterium_phage	31.4	7.3e-23
WP_033088959.1|1935697_1936204_+	esterase	NA	NA	NA	NA	NA
WP_071343319.1|1936356_1937442_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	2033629	2145374	8304518	transposase	Staphylococcus_phage(14.29%)	101	NA	NA
WP_071343317.1|2033629_2034763_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343632.1|2034819_2035257_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_103557285.1|2035327_2036836_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	31.0	8.4e-09
WP_033090429.1|2036909_2037248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344752.1|2037302_2037935_-	RNA polymerase sigma factor SigE	NA	A0A0F6TH34	Sinorhizobium_phage	31.4	1.1e-07
WP_045439218.1|2038223_2038871_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_033090428.1|2039021_2039657_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343634.1|2039690_2040647_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	3.1e-17
WP_103557210.1|2040643_2042302_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033090426.1|2042721_2042940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143837602.1|2043021_2043516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090424.1|2043559_2044771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090423.1|2044837_2046052_-	glucose-1-phosphate adenylyltransferase	NA	A0A291LA53	Escherichia_phage	25.6	4.1e-06
WP_033090432.1|2046316_2047486_+	glycogen synthase	NA	NA	NA	NA	NA
WP_033090422.1|2047482_2047932_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036548486.1|2048058_2048955_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	32.8	6.7e-06
WP_071344754.1|2048939_2049992_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_071343635.1|2050133_2050301_-	DUF3117 domain-containing protein	NA	NA	NA	NA	NA
WP_071343636.1|2050466_2051039_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_033090419.1|2051035_2051491_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_071343637.1|2051649_2052786_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_081986248.1|2052818_2053700_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_103557286.1|2053858_2055301_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_033090415.1|2055433_2056021_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_033090414.1|2056017_2057343_-	magnesium transporter	NA	NA	NA	NA	NA
WP_071343638.1|2057479_2058436_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_033090412.1|2058448_2058940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986494.1|2058944_2059514_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_103557287.1|2059552_2061181_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033091666.1|2061261_2062323_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_033091664.1|2062402_2063257_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_036552925.1|2063616_2064945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091316.1|2065094_2066651_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_033091321.1|2067223_2068408_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_033091317.1|2068471_2069353_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_033091318.1|2069493_2070645_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_033091319.1|2070659_2071316_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033091320.1|2071328_2072486_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_158544140.1|2072922_2073720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071812139.1|2074578_2075004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036553000.1|2075984_2076281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343639.1|2076277_2077198_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_036553034.1|2077288_2078224_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096490404.1|2078223_2078556_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071812099.1|2078652_2079798_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_162836621.1|2079794_2079959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|2080163_2081249_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_083414846.1|2081680_2082769_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158660730.1|2083043_2084312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343641.1|2084509_2085913_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_071343642.1|2086058_2087276_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081986516.1|2088744_2089329_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	40.4	1.2e-16
WP_071343643.1|2090005_2090401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036546114.1|2090479_2090659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036546111.1|2090828_2091707_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033087538.1|2091703_2091910_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_158660731.1|2092065_2092203_-	hemophore-related protein	NA	NA	NA	NA	NA
WP_158660732.1|2092220_2092397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033087540.1|2092477_2093857_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_081985854.1|2093853_2094627_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081985855.1|2094625_2094832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087543.1|2094872_2095130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087544.1|2095103_2095817_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033087545.1|2095813_2096455_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036546107.1|2096451_2097597_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	3.4e-18
WP_083415129.1|2097612_2098509_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071343644.1|2098809_2099739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087548.1|2099789_2101205_-	AAA family ATPase	NA	S4TST9	Salmonella_phage	26.2	1.2e-12
WP_083415131.1|2101354_2101894_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033087549.1|2102070_2103603_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071343646.1|2103639_2104470_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033087551.1|2104483_2105398_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071343647.1|2105512_2107309_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.2	7.8e-54
WP_033087553.1|2107445_2108597_+	epoxide hydrolase	NA	NA	NA	NA	NA
WP_033087554.1|2108640_2109516_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033087555.1|2109604_2110189_+	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_033087577.1|2110315_2111821_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052086314.1|2111969_2112590_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_033087556.1|2112664_2114158_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_045437175.1|2114175_2114811_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081985857.1|2115269_2119040_-	multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit	NA	NA	NA	NA	NA
WP_071344759.1|2119152_2122992_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.6	1.5e-41
WP_033087558.1|2123149_2123683_+	VOC family protein	NA	NA	NA	NA	NA
WP_033087559.1|2123729_2124518_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033087560.1|2124744_2125683_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	5.4e-14
WP_071344760.1|2125679_2126396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036546123.1|2126520_2127360_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_081985858.1|2127365_2127839_+	VOC family protein	NA	NA	NA	NA	NA
WP_071343649.1|2127823_2128858_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033087562.1|2129057_2129852_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_071343650.1|2130185_2131421_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_033087563.1|2131447_2132182_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_045437183.1|2132607_2133045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081985862.1|2133178_2134282_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
WP_158660868.1|2134290_2137296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033087566.1|2138547_2139270_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_052086317.1|2139339_2140011_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_071344761.1|2140194_2140998_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_033087567.1|2141270_2143082_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	35.6	6.7e-53
WP_052486619.1|2143164_2143980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343652.1|2144198_2145374_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	73.6	6.5e-150
>prophage 9
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	2329421	2418345	8304518	integrase,transposase,protease	Planktothrix_phage(28.57%)	67	2341703:2341719	2392372:2393744
WP_071343319.1|2329421_2330507_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091010.1|2330582_2330951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414853.1|2331084_2331405_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091007.1|2332953_2333808_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_033091006.1|2333891_2335301_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_033091005.1|2335356_2336412_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_033091011.1|2336416_2337025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490697.1|2337282_2340279_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_036552925.1|2341552_2342881_+|transposase	transposase	transposase	NA	NA	NA	NA
2341703:2341719	attL	ACCGGCGCCGGCCTGGC	NA	NA	NA	NA
WP_071343682.1|2342989_2343538_-	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	63.5	6.8e-25
2341703:2341719	attL	ACCGGCGCCGGCCTGGC	NA	NA	NA	NA
WP_052086883.1|2344220_2344820_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_083415144.1|2346533_2348036_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033090260.1|2348056_2349010_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_045439131.1|2349002_2349827_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071343685.1|2349823_2350651_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	3.5e-09
WP_045439129.1|2350647_2351322_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-14
WP_081986230.1|2351968_2353609_+	alanine racemase	NA	NA	NA	NA	NA
WP_071343687.1|2353605_2354682_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	34.9	7.8e-33
2353849:2353865	attR	ACCGGCGCCGGCCTGGC	NA	NA	NA	NA
WP_052086885.1|2354689_2356114_+	MATE family efflux transporter	NA	NA	NA	NA	NA
2353849:2353865	attR	ACCGGCGCCGGCCTGGC	NA	NA	NA	NA
WP_081986231.1|2356249_2356702_-	DoxX family protein	NA	NA	NA	NA	NA
WP_143161440.1|2356848_2357520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343317.1|2359077_2360211_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660734.1|2362571_2362991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343689.1|2362987_2363698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343690.1|2364374_2365274_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_082062725.1|2365286_2365874_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071343691.1|2366002_2366383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090274.1|2367779_2369468_+	maturase	NA	NA	NA	NA	NA
WP_071343317.1|2369772_2370906_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071812099.1|2372617_2373763_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_162836621.1|2373759_2373924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343317.1|2374305_2375439_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_052087000.1|2375497_2376196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106852485.1|2377602_2377980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161438.1|2378383_2378599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158660735.1|2379856_2381017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103557214.1|2382046_2383246_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	3.6e-31
WP_143161436.1|2385246_2386014_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_083414856.1|2386065_2386461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086998.1|2388213_2388741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|2388874_2389960_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_121556186.1|2390554_2390971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162836621.1|2391079_2391244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071812099.1|2391240_2392386_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_052486831.1|2392734_2392971_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|2394241_2395327_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343317.1|2395615_2396749_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090641.1|2396876_2397887_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033090640.1|2398059_2398344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343693.1|2398345_2399371_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071343694.1|2401538_2403071_+	YfcC family protein	NA	NA	NA	NA	NA
WP_052086936.1|2403080_2403662_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343695.1|2403729_2405046_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_155239238.1|2405227_2405389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344767.1|2405557_2406100_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_071343696.1|2406160_2407153_-	TIGR03560 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_083414857.1|2407152_2407707_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090635.1|2407705_2408029_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_052486786.1|2408080_2409310_-	MFS transporter	NA	NA	NA	NA	NA
WP_071343697.1|2409309_2409960_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081986279.1|2410128_2410590_+	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033090633.1|2410713_2411115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343698.1|2411217_2412438_-	cytochrome P450	NA	NA	NA	NA	NA
WP_158660736.1|2412621_2414214_+	carboxylesterase family protein	NA	H2EFI1	Moumouvirus	31.5	1.7e-39
WP_033090631.1|2414221_2415028_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090630.1|2415197_2417183_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	32.7	2.1e-71
WP_071343319.1|2417259_2418345_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	2670015	2791443	8304518	integrase,transposase	Mycobacterium_phage(23.53%)	107	2731473:2731532	2737282:2738644
WP_071343319.1|2670015_2671101_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343742.1|2671089_2672100_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_033090544.1|2672155_2672779_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086923.1|2672839_2673721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090543.1|2673871_2674747_+	DMT family transporter	NA	NA	NA	NA	NA
WP_081986267.1|2674748_2675828_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_052086924.1|2676125_2676785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343743.1|2676906_2679315_+	MFS transporter	NA	NA	NA	NA	NA
WP_045439340.1|2679426_2680323_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_033090541.1|2680430_2682401_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	26.4	2.1e-36
WP_033090540.1|2682583_2682994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090539.1|2683234_2684011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103557291.1|2684070_2685423_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.5	1.6e-19
WP_045439342.1|2685879_2686989_+	galactokinase	NA	NA	NA	NA	NA
WP_033090537.1|2687030_2687336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036549088.1|2687332_2687635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036549091.1|2687669_2688413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071811677.1|2688554_2690033_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_103557292.1|2690275_2690845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343317.1|2690948_2692082_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091332.1|2692291_2693953_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	23.8	6.8e-28
WP_071344776.1|2694168_2695824_-	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	27.5	4.1e-33
WP_036551765.1|2696189_2697020_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033091339.1|2697219_2697912_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071343746.1|2697937_2698744_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033091335.1|2698771_2699719_-	serine hydrolase	NA	NA	NA	NA	NA
WP_071343747.1|2700016_2700460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343748.1|2701395_2702064_-	YdcF family protein	NA	NA	NA	NA	NA
WP_033091337.1|2702075_2702840_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083414840.1|2703812_2705243_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.1	4.8e-54
WP_033090950.1|2705702_2706941_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033090949.1|2706967_2708350_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071343319.1|2708545_2709631_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033090948.1|2709724_2709991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090947.1|2710210_2711611_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_033090946.1|2711633_2712419_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_033090944.1|2712982_2714104_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_033090943.1|2714107_2714968_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_158543969.1|2714957_2715134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090942.1|2715191_2715881_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.9	1.4e-27
WP_033090941.1|2715880_2716786_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_083414867.1|2716856_2719082_+	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	36.4	1.1e-78
WP_033090940.1|2719094_2719415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090951.1|2719976_2720642_+	slipin family protein	NA	NA	NA	NA	NA
WP_033090939.1|2720772_2721249_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.7	3.8e-32
WP_071343749.1|2722250_2723177_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343377.1|2723176_2723500_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033091801.1|2723642_2723876_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071343319.1|2724048_2725134_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_083414868.1|2725122_2726091_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|2726214_2727300_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343591.1|2727543_2728614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083414869.1|2728564_2729971_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_071343319.1|2730114_2731200_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
2731473:2731532	attL	TAGTACTGCAACGACACCTATGTGAGTCGGTGCTGGTAGATCTGTTGTGTGGTGTTGGAT	NA	NA	NA	NA
WP_071812172.1|2731520_2732654_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_045440530.1|2732953_2733928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986501.1|2734280_2734829_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	38.0	5.4e-22
WP_052087111.1|2735668_2735899_+	hypothetical protein	NA	W8EKE7	Mycobacterium_phage	45.9	1.8e-08
WP_158660746.1|2735938_2736148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071812172.1|2736159_2737293_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660747.1|2737468_2738122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660748.1|2738186_2738774_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
2737282:2738644	attR	ATCCAACACCACACAACAGATCTACCAGCACCGACTCACATAGGTGTCGTTGCAGTACTAGGGCAAAACCAAAGGGAGAAGACCGGAAGTATCTCCTTGCGGGTGGGTTCGGCATGACAAGTGTCATGGCGGGGAGGTGATGGTTGGCAGATTTGGTGGGGGTCGGGGGGTCGTAGCGTTTTTTGTTATGGAGAAACGACCGAATCTGCTTCGGATGCTTGCGCCGACCGTTCGCGATATCGCGGTGCCGCTGGCCGCGTACTACGCCCTGTATGGTGCGGGGTATTCGGATTTCGCTGCGCTGCTGGGCGGTGCGGTGTTCTCGGGGGTCATGGTGATCATCGAGGTGGTTCGGGCTCGGCGGGTGGATGCCATGTCGGCGCTCATTCTGGCCGGGTTCGTTTTCGGGATCGTCAGTTCGATGATCAGTGGGGATGCTCGGCTGATGATTGTGCGGGATTCGTTGACTACGGCGGGGATCGGGGTGGCGTTCGGGGTCAGTGCGTTGATCGGGAAGCCGTTGACGTATGTGGCTGCGCGTAAGGCGTTTTCGGGGTCGCCGCAGAAGGTGGCGGAGATGGAGTACAAGTTCGAGAATGTTCCGATGGTTCGGCGGCTGCACAATCGGATCGCGGGGATGTGGGGTGTGGGGCTGATCGGGGAGTCGGTGGTGCGGGTGGTGCTGGCTTACCGGTTGCCGATTCACACCATGGCTTGGCTGTCGAGTGTGCTCATGGTGGGGGTCACCGTGGTGTTGATGGCTGTCACGGTGCGAACCATCAAGCGGGTCAGGGCATCTGAGGTTGCCAGTGGGGCGGGTTACGCTTCGGTGCATGAGTGAGGGTTCGGTTCCGAAGAGCACGTTGTCGGGAACGGCTCGTGTCGAAGCGTTCAGTGACGGGGTGATGGCGATTGCCATCACCCTGTTGATTTTGGATATCCGGGCGCCGGAACATGAGCCGGGGCAGCTGTTGCGGGCGCTGGGGCACATCTGGCCGGCGTATCTGGCTTATCTGGCGTCGTTCATCACCATCGGGGTGGTGTGGATGAATCACCACACCTTCTTCGGGCGGCTGCGGCGTATCGACCACGTGTTGCGGTGGTGGAATCTCATGCTGCTGCTGGGGGTTTCGCTGATTCCGTTTCCGACGATCGTGGTCGCGGACAATCTGGTGCACGGGACGCGGGGGGATGCGGTGGTGGCGGTGGCGCTGTACGGGATCGTGGGGGTGATCATGACCATCCCGTGGGCGCCCATGTGGCGGCAGTTGGAGAAGCGGCCGGAGATGTTGAAGCCGGGGCTGGGGGCGGATTATGCGCGGCGGGAGCGGTGGCGGGCGTGGCCGGGGCTGCTCGTGTATGC	NA	NA	NA	NA
WP_071344777.1|2738820_2739312_+	VOC family protein	NA	NA	NA	NA	NA
WP_071343755.1|2739308_2740382_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071343756.1|2740357_2741509_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_071343757.1|2741505_2742147_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343758.1|2742188_2742809_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343759.1|2742885_2744190_+	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
WP_071343760.1|2744288_2744975_+	GAF and ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_158660749.1|2745085_2745796_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_071812172.1|2746148_2747282_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081986278.1|2747389_2747986_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033090620.1|2749587_2749983_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_081986277.1|2750033_2751575_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.6	4.0e-30
WP_033090619.1|2751637_2752003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161222.1|2752017_2752212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090618.1|2752321_2753620_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_033090617.1|2753653_2754328_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090616.1|2754444_2755959_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	33.5	2.7e-55
WP_052086931.1|2756023_2756668_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033090626.1|2756734_2757334_+	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_158660750.1|2757354_2758275_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_096490434.1|2758332_2759505_-	lipase	NA	NA	NA	NA	NA
WP_033090615.1|2759659_2760004_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_033090614.1|2760200_2761850_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_083414870.1|2761961_2763182_+	MFS transporter	NA	NA	NA	NA	NA
WP_045439520.1|2763229_2763967_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_033090613.1|2763985_2764303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343762.1|2764460_2766149_-	DUF222 domain-containing protein	NA	NA	NA	NA	NA
WP_158660751.1|2766508_2766898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|2768220_2769306_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343489.1|2769586_2770915_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343764.1|2771508_2772639_+	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_158660752.1|2772707_2774093_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_143161224.1|2774628_2775384_+	methyltransferase	NA	NA	NA	NA	NA
WP_036550785.1|2775428_2776010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091195.1|2776063_2777299_+	hypothetical protein	NA	A0A140G6E9	Arthrobacter_phage	40.5	1.9e-75
WP_033091194.1|2777345_2777558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414871.1|2777694_2779464_+	ParB N-terminal domain-containing protein	NA	A0A2P1N496	Mycobacterium_phage	34.3	7.5e-57
WP_033091193.1|2779558_2780410_+	bifunctional DNA primase/polymerase	NA	A0A221SAP5	Ralstonia_phage	33.2	1.8e-16
WP_052087015.1|2780998_2781508_+	single-stranded DNA-binding protein	NA	A0A1U9WS23	Gordonia_phage	51.7	1.8e-27
WP_033091192.1|2781711_2781915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091191.1|2782020_2782341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414872.1|2782834_2784151_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_158660753.1|2784185_2788697_+|transposase	IS630 family transposase	transposase	V5UQN3	Mycobacterium_phage	28.2	7.0e-27
WP_045440474.1|2788788_2789988_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|2790309_2791443_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	2810592	2860126	8304518	tRNA,integrase,transposase	Synechococcus_phage(20.0%)	45	2822493:2822552	2858988:2860127
WP_071343319.1|2810592_2811678_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343770.1|2811680_2812286_+	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_158660757.1|2812363_2813680_+	radical SAM protein	NA	NA	NA	NA	NA
WP_158660758.1|2813619_2814669_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_071343319.1|2814723_2815809_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343771.1|2815823_2816540_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_052087085.1|2816652_2818434_+	hypothetical protein	NA	E3SL39	Synechococcus_phage	28.7	2.3e-50
WP_143161231.1|2818430_2819225_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_052087084.1|2819295_2820564_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	29.2	1.3e-39
WP_158660759.1|2820688_2820835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155239282.1|2820831_2820981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161232.1|2821597_2821987_-	hypothetical protein	NA	NA	NA	NA	NA
2822493:2822552	attL	CTAGTGTCCTGAATCGTAAGTTCACTGGCGGTATCTGGTTGTAGGGTGGCCGGGTGCCGC	NA	NA	NA	NA
WP_071343319.1|2822545_2823631_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343317.1|2824044_2825178_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343772.1|2825359_2825968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343773.1|2825964_2826507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343774.1|2826529_2832283_-	AHH domain-containing protein	NA	NA	NA	NA	NA
WP_071343775.1|2832283_2832949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343776.1|2832945_2833341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343777.1|2833741_2833954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343779.1|2834629_2835499_+	helix-turn-helix transcriptional regulator	NA	A0A1J0MCL6	Streptomyces_phage	31.6	7.7e-15
WP_071343780.1|2835485_2835881_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_071343781.1|2835907_2836669_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_071343782.1|2836640_2837996_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071343783.1|2838357_2838957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343784.1|2839101_2839446_+	HIT family protein	NA	NA	NA	NA	NA
WP_071343785.1|2839568_2840876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343786.1|2840894_2842484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343787.1|2842655_2843345_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_083415151.1|2843855_2845280_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071343788.1|2845276_2845870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343789.1|2845835_2846603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343377.1|2846667_2846991_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343790.1|2846990_2847917_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158660760.1|2847944_2848358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343792.1|2848405_2849548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660761.1|2850671_2852174_-	DEAD/DEAH box helicase family protein	NA	A0A0P0CJA9	Ostreococcus_lucimarinus_virus	35.0	9.2e-16
WP_071812172.1|2852267_2853401_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660762.1|2853412_2854069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343796.1|2854155_2855193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036553000.1|2855255_2855552_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343639.1|2855548_2856469_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_158660763.1|2856395_2857055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343797.1|2857610_2858072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|2859040_2860126_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
2858988:2860127	attR	CTAGTGTCCTGAATCGTAAGTTCACTGGCGGTATCTGGTTGTAGGGTGGCCGGGTGCCGCCGAAGGTTGAGCCTTTGAAGCTGTCGGATACCGAACGTCAGGTGCTGGTCGGGTGGTCTCGCCGCCGGAAGACCGCCCAAGCGTTGGCACTTCGTTCACGGATCGTGCTGGCCTGCGCGGAGAGCGGATCGAACTCCGAGGTGGCGCGGCAGCTGGGTGTTTCGCGAGAAACGGTGCGCAAGTGGCGAACTCGGTTCGAACGCGACCGGCTCGAAGGCTTGTCCGACGAACCGCGACCGGGTGCACCACGCAAGATCACCGACGAGCAGGTGGAACACGTCATCACCACGACATTGGAAACCTCTCCGCCGCAACGGGATACACACTGGTCGACACGCTCAATGGCGCAGGCCACAGGCATGTCGCAGTCAGCGGTTTCCCGGATCTGGCGGGCGTTCGGACTCAAACCGCACCTGGTCGAAACCTGGAAACTGTCGACCGATCCGCTGTTCGTGGACAAGGTCCGCGACGTGGTCGGGCTCTACATGAACCCGCCCCAGAACGCGCTGGTGCTGTGCGTGGACGAGAAATCCCAGATGCAGGCCCTCGACCGGACCGCGCCGACGCTGCCGATCATGCCCACCACCCCGGCGCGCATGACCCATGACTACGTGCGCAACGGCACCACCAACCTGTTCGCGGCACTGGATGTGGCCAGCGGTTCGGTCATCGCCGAACACTATGCGCGCCACCGTCATCAGGAGTTTCTCCGCTTCTTGAAGACCATCGACACCGCCGTGCCCGCCGAGTTCGATCTGCATCTGGTCTGCGACAACTACGGCACCCACAAGACGCCGGCGGTGAAGAAGTGGCTGCTGCGCCACCCGCGGTTCCATGTGCACTTCACCCCGACCTCGGCCAGCTGGCTCAACCTGGTCGAACGCTGGTTCGCCGAGCTGACCAACCGCAAACTGCGCCGCTCGGCCCACCGCAGCGTCACCGAACTCAAGGCCGACGTCCAAGCCTGGATCAACGCCTGGAACGCCGACCCGAAACCGTTCGTCTGGACCAAGACCGCCGACGAGATCCTCGAAACCCTCGCCGCCTACTGCCAACGAATCAACGACTCACGACACTAGC	NA	NA	NA	NA
>prophage 12
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	2869835	2912508	8304518	transposase	Bacillus_phage(66.67%)	37	NA	NA
WP_071344734.1|2869835_2871065_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071343807.1|2871239_2871530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343808.1|2871725_2872862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|2873211_2874297_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052087037.1|2874330_2875314_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036551252.1|2875893_2876688_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033091341.1|2876829_2877405_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091342.1|2877605_2878856_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_033091343.1|2879112_2880072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091344.1|2880187_2881150_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_033091345.1|2881153_2882455_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.7e-32
WP_071343809.1|2882486_2884241_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143161233.1|2884271_2885000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343317.1|2885204_2886338_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660767.1|2886886_2887390_+	DUF3558 family protein	NA	NA	NA	NA	NA
WP_071343812.1|2887389_2887902_+	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
WP_036552869.1|2887928_2888120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343317.1|2888185_2889319_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|2889751_2890837_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052486823.1|2890886_2891879_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033091466.1|2891878_2892769_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033091467.1|2892857_2893049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343814.1|2893091_2894795_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_033091469.1|2896477_2897338_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158660768.1|2897354_2897711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045440275.1|2897793_2899002_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_036552925.1|2899259_2900588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071344734.1|2901071_2902301_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071811695.1|2902508_2903345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045440230.1|2903341_2903782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091415.1|2903798_2904611_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_033091416.1|2904717_2905896_+	cytochrome P450	NA	NA	NA	NA	NA
WP_052087049.1|2905882_2906590_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_045440227.1|2906672_2907395_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	1.6e-29
WP_071344781.1|2907308_2908736_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.7	4.8e-14
WP_082062794.1|2908638_2909400_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|2911374_2912508_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	2983882	3049687	8304518	transposase	Prochlorococcus_phage(100.0%)	54	NA	NA
WP_071343319.1|2983882_2984968_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036548814.1|2985017_2985842_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_052486769.1|2986015_2986459_+	DUF1851 domain-containing protein	NA	NA	NA	NA	NA
WP_036548811.1|2986455_2987871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161409.1|2987937_2989095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036548805.1|2989102_2989762_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_143161408.1|2989872_2990187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343830.1|2990482_2991271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036548799.1|2991379_2991952_-	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_071343832.1|2993875_2994946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343833.1|2994947_2996465_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045439285.1|2996577_2997864_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_036548789.1|2997926_2998259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083415160.1|2998417_2999728_+	serine hydrolase	NA	NA	NA	NA	NA
WP_071343835.1|2999742_3000393_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_036548774.1|3000632_3000944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343836.1|3001036_3001507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161407.1|3001598_3001940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082062733.1|3002675_3003791_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_083414882.1|3008218_3008803_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343317.1|3008997_3010131_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_083414883.1|3010154_3011201_-	patatin family protein	NA	NA	NA	NA	NA
WP_071343838.1|3012421_3013546_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071343839.1|3013545_3014619_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	27.1	1.9e-23
WP_071343319.1|3014607_3015693_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343840.1|3015862_3017284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343841.1|3017280_3017517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343842.1|3017528_3018476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071812172.1|3018763_3019897_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660771.1|3019988_3020126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|3020178_3021264_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033086227.1|3022258_3022639_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_143161406.1|3022685_3023522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161405.1|3023605_3023950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033086175.1|3023937_3024780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033086176.1|3024776_3025133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343844.1|3025437_3026571_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033086178.1|3026579_3027233_+	FMN reductase	NA	NA	NA	NA	NA
WP_033086179.1|3027275_3028235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086180.1|3028346_3029720_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_033086181.1|3029749_3030502_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033086182.1|3030587_3031337_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033086183.1|3031383_3031764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086056.1|3031949_3032510_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_045436519.1|3032589_3033045_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_071343845.1|3035443_3036472_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_033086184.1|3036627_3037647_+	diiron oxygenase	NA	NA	NA	NA	NA
WP_033086185.1|3037662_3039246_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158660772.1|3039926_3042371_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_036546707.1|3043274_3043922_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036546721.1|3043970_3044453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158660773.1|3044726_3046631_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_071343846.1|3046602_3048201_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_071343319.1|3048601_3049687_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	3076707	3156570	8304518	tRNA,integrase,transposase	Klosneuvirus(28.57%)	57	3113436:3113495	3125975:3127115
WP_071343851.1|3076707_3078099_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.0	6.9e-50
WP_083415162.1|3078325_3079003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|3079052_3080138_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343853.1|3080287_3082114_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_145961844.1|3082597_3083068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343854.1|3083074_3099532_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.9	1.2e-103
WP_158544116.1|3099688_3101125_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_103557222.1|3101313_3102510_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_033086213.1|3102506_3103112_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033086246.1|3103284_3103938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414885.1|3104953_3105271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158660775.1|3105352_3105643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343855.1|3106047_3108051_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_033086215.1|3108112_3108808_+	MBL fold metallo-hydrolase	NA	A0A221J762	Mycobacterium_phage	72.1	1.3e-12
WP_033086248.1|3108852_3109512_+	YdcF family protein	NA	NA	NA	NA	NA
WP_033086216.1|3109515_3110784_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_036549188.1|3110813_3111518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086218.1|3111579_3112260_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.7	1.5e-10
WP_033086219.1|3112256_3112820_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_063876854.1|3112844_3113435_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
3113436:3113495	attL	CGCTAGTGTCCTGAATCGTAAGTTCACTGGCGGTATCTGGTTGTAGGGTGGCCGGGTGCC	NA	NA	NA	NA
WP_071343319.1|3113490_3114576_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033086221.1|3114782_3116699_+	DNA primase	NA	A0A1S5RFI1	Helicobacter_phage	33.2	4.0e-40
WP_033086249.1|3116829_3117075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033086222.1|3117460_3118270_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033086223.1|3118951_3120439_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_082062799.1|3120484_3123760_-	DEAD/DEAH box helicase	NA	A0A0P0YNJ0	Yellowstone_lake_phycodnavirus	29.8	7.1e-37
WP_143161402.1|3123837_3125082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036552659.1|3125250_3125775_+	helicase associated domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|3126029_3127115_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3125975:3127115	attR	CGCTAGTGTCCTGAATCGTAAGTTCACTGGCGGTATCTGGTTGTAGGGTGGCCGGGTGCCGCCGAAGGTTGAGCCTTTGAAGCTGTCGGATACCGAACGTCAGGTGCTGGTCGGGTGGTCTCGCCGCCGGAAGACCGCCCAAGCGTTGGCACTTCGTTCACGGATCGTGCTGGCCTGCGCGGAGAGCGGATCGAACTCCGAGGTGGCGCGGCAGCTGGGTGTTTCGCGAGAAACGGTGCGCAAGTGGCGAACTCGGTTCGAACGCGACCGGCTCGAAGGCTTGTCCGACGAACCGCGACCGGGTGCACCACGCAAGATCACCGACGAGCAGGTGGAACACGTCATCACCACGACATTGGAAACCTCTCCGCCGCAACGGGATACACACTGGTCGACACGCTCAATGGCGCAGGCCACAGGCATGTCGCAGTCAGCGGTTTCCCGGATCTGGCGGGCGTTCGGACTCAAACCGCACCTGGTCGAAACCTGGAAACTGTCGACCGATCCGCTGTTCGTGGACAAGGTCCGCGACGTGGTCGGGCTCTACATGAACCCGCCCCAGAACGCGCTGGTGCTGTGCGTGGACGAGAAATCCCAGATGCAGGCCCTCGACCGGACCGCGCCGACGCTGCCGATCATGCCCACCACCCCGGCGCGCATGACCCATGACTACGTGCGCAACGGCACCACCAACCTGTTCGCGGCACTGGATGTGGCCAGCGGTTCGGTCATCGCCGAACACTATGCGCGCCACCGTCATCAGGAGTTTCTCCGCTTCTTGAAGACCATCGACACCGCCGTGCCCGCCGAGTTCGATCTGCATCTGGTCTGCGACAACTACGGCACCCACAAGACGCCGGCGGTGAAGAAGTGGCTGCTGCGCCACCCGCGGTTCCATGTGCACTTCACCCCGACCTCGGCCAGCTGGCTCAACCTGGTCGAACGCTGGTTCGCCGAGCTGACCAACCGCAAACTGCGCCGCTCGGCCCACCGCAGCGTCACCGAACTCAAGGCCGACGTCCAAGCCTGGATCAACGCCTGGAACGCCGACCCGAAACCGTTCGTCTGGACCAAGACCGCCGACGAGATCCTCGAAACCCTCGCCGCCTACTGCCAACGAATCAACGACTCACGACACTAG	NA	NA	NA	NA
WP_052087082.1|3128590_3129184_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091561.1|3129271_3129778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091560.1|3129926_3130892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343856.1|3131007_3132000_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343857.1|3132099_3133950_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_071343319.1|3134138_3135224_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033090685.1|3135220_3136675_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_045439614.1|3136709_3138047_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_033090686.1|3138173_3139700_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090687.1|3139924_3140188_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071812032.1|3140449_3140938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986284.1|3140909_3141254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986285.1|3141437_3142445_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071343858.1|3142525_3144043_+	amino acid permease	NA	NA	NA	NA	NA
WP_033090690.1|3144039_3145569_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	46.7	1.1e-130
WP_071343859.1|3145576_3146350_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083415164.1|3146631_3147819_-	cytochrome P450	NA	NA	NA	NA	NA
WP_033090701.1|3147854_3149117_-	cytochrome P450	NA	NA	NA	NA	NA
WP_096490669.1|3149113_3149716_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_033090694.1|3149744_3150098_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_033090695.1|3150094_3150508_-	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_083414887.1|3150504_3152364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155239301.1|3152353_3152518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986287.1|3152780_3153542_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_033090697.1|3153435_3154116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161401.1|3154112_3154472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090698.1|3154675_3154888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071812172.1|3155436_3156570_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	3222954	3305009	8304518	integrase,transposase	Gordonia_phage(50.0%)	87	3222228:3222278	3240399:3240449
3222228:3222278	attL	ACTGGTTTTACACACCAGCGGTCGGGGGTTCGATCCCCTCTGCGCCCACTC	NA	NA	NA	NA
WP_158660777.1|3222954_3223605_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1U9WS15	Gordonia_phage	50.9	1.0e-59
WP_033086990.1|3223690_3224059_-	hypothetical protein	NA	A0A160DFH7	Gordonia_phage	42.9	3.8e-16
WP_071343879.1|3224228_3225527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161400.1|3225519_3226260_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_033086989.1|3226435_3226615_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033086988.1|3226775_3227012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146162536.1|3227008_3227764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086986.1|3227766_3228075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084978601.1|3228290_3230150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086984.1|3230146_3230335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086983.1|3230354_3231245_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033086982.1|3231241_3231697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036551374.1|3231727_3232114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086980.1|3232103_3233009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086979.1|3233282_3233753_+	single-stranded DNA-binding protein	NA	A0A160DD37	Gordonia_phage	57.9	8.1e-35
WP_033091714.1|3233783_3234047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091713.1|3234046_3234415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091712.1|3234459_3234681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091711.1|3234680_3234983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161399.1|3234982_3235189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155239310.1|3235185_3235362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091709.1|3235526_3235733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091708.1|3236012_3236342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343881.1|3236715_3237156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|3237722_3238808_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343882.1|3239594_3240233_+	hypothetical protein	NA	Q6J7Y8	Actinoplanes_phage	36.5	1.6e-30
WP_071343883.1|3240732_3241056_+|transposase	transposase	transposase	NA	NA	NA	NA
3240399:3240449	attR	ACTGGTTTTACACACCAGCGGTCGGGGGTTCGATCCCCTCTGCGCCCACTC	NA	NA	NA	NA
WP_071343884.1|3241055_3241982_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|3242993_3244079_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_143161397.1|3244067_3244301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490664.1|3244423_3245567_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.0	4.1e-32
WP_143161396.1|3245587_3245914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083414892.1|3246181_3247315_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660778.1|3247501_3248362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090249.1|3248608_3250426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090247.1|3251827_3252670_-	alkylmercury lyase family protein	NA	NA	NA	NA	NA
WP_033090246.1|3252703_3253423_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090245.1|3253424_3253817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106852449.1|3253870_3254395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071812172.1|3254497_3255631_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_045439099.1|3255921_3256521_+	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_033090242.1|3256837_3257128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090241.1|3257346_3257718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090240.1|3257824_3258937_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_083415167.1|3258933_3260379_+	MFS transporter	NA	NA	NA	NA	NA
WP_045439109.1|3260689_3261820_+	lipase	NA	NA	NA	NA	NA
WP_033090238.1|3261922_3262183_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_033090237.1|3263096_3263858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090236.1|3264014_3264437_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_071343890.1|3264429_3265629_+	lipid-transfer protein	NA	NA	NA	NA	NA
WP_033090234.1|3265866_3266118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344790.1|3266270_3267737_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_052086881.1|3267848_3268445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090233.1|3268554_3268854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986225.1|3269852_3270872_-	cutinase family protein	NA	A0A166Y6Q9	Gordonia_phage	35.8	2.5e-12
WP_033090232.1|3271051_3271537_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090231.1|3271645_3272257_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158660779.1|3272513_3274025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090229.1|3274160_3274565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083414839.1|3274651_3275785_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343892.1|3276142_3277048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090402.1|3277238_3277694_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036550286.1|3278136_3279630_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_045439208.1|3279643_3280357_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071343893.1|3280356_3281709_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_033090400.1|3282115_3282847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090399.1|3283278_3284721_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	26.5	3.2e-34
WP_033090398.1|3284792_3285173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086903.1|3285373_3287017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090408.1|3287215_3289144_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_052086902.1|3289369_3290083_-	YdcF family protein	NA	NA	NA	NA	NA
WP_033090397.1|3290161_3290794_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155239315.1|3291027_3291201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090396.1|3291342_3291858_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_033090395.1|3291969_3292929_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045439203.1|3293000_3293807_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033090406.1|3293971_3295081_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_045439202.1|3295189_3296155_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_033090394.1|3296424_3297444_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_033090404.1|3297509_3298493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090393.1|3298510_3299005_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_062614374.1|3299628_3300171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036552925.1|3300419_3301748_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152649448.1|3301778_3302333_-	XRE family transcriptional regulator	NA	A0A1J0MBX1	Streptomyces_phage	28.2	3.5e-05
WP_071343319.1|3302404_3303490_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071812017.1|3303531_3303747_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|3303875_3305009_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	3353507	3433782	8304518	tRNA,transposase	Streptomyces_phage(40.0%)	58	NA	NA
WP_033088053.1|3353507_3353903_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_155239319.1|3354257_3354425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343905.1|3354575_3355043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088055.1|3355016_3355799_-	YwiC-like family protein	NA	NA	NA	NA	NA
WP_081985934.1|3355924_3356719_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_071343319.1|3356850_3357936_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091758.1|3358225_3359662_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_071343317.1|3359943_3361077_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090582.1|3361476_3362007_+	RDD family protein	NA	NA	NA	NA	NA
WP_033090581.1|3362263_3363178_+	esterase	NA	NA	NA	NA	NA
WP_033090580.1|3363265_3363865_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090579.1|3364736_3365030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090578.1|3365162_3365906_-	DUF4191 domain-containing protein	NA	NA	NA	NA	NA
WP_083414893.1|3366158_3366947_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_033090577.1|3367033_3367402_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036551849.1|3367414_3369610_-	elongation factor G-like protein EF-G2	NA	NA	NA	NA	NA
WP_045439932.1|3369907_3370900_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_071812009.1|3371027_3371858_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036551850.1|3371854_3372367_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033090576.1|3372557_3373457_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_071343906.1|3373461_3375174_-	2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
WP_033090574.1|3375797_3376133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090573.1|3376324_3377830_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	6.0e-39
WP_033090572.1|3378066_3379263_+	elongation factor Tu	NA	M4M9V7	Vibrio_phage	69.4	3.1e-06
WP_071343907.1|3379411_3380239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090570.1|3380380_3380653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096490813.1|3380723_3382058_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_081986354.1|3388171_3388846_+	SUKH-3 domain-containing protein	NA	NA	NA	NA	NA
WP_158660781.1|3388796_3389048_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_033091167.1|3389044_3389347_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_158660782.1|3389375_3390860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091169.1|3390871_3391189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091170.1|3391219_3391873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036550951.1|3392165_3392537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343909.1|3392576_3393800_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_071343910.1|3393863_3395399_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_081986358.1|3395395_3396703_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_071343911.1|3396699_3400776_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_033091174.1|3400795_3401209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|3401313_3402399_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343912.1|3402641_3405473_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_083415172.1|3405804_3409017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343914.1|3409013_3413951_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	23.9	6.7e-79
WP_158660783.1|3413978_3414464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344734.1|3414929_3416159_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071343915.1|3416436_3417279_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033090973.1|3417328_3417643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071812007.1|3417718_3418258_-	LpqN/LpqT family lipoprotein	NA	NA	NA	NA	NA
WP_033090971.1|3418254_3419145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161391.1|3419132_3420212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090970.1|3420218_3420542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090969.1|3420799_3421015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086985.1|3421159_3421504_-	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_143161390.1|3421659_3422571_+	XRE family transcriptional regulator	NA	A0A1J0MCL6	Streptomyces_phage	29.4	9.2e-19
WP_071812006.1|3422567_3422762_+	DUF397 domain-containing protein	NA	A0A1J0MC88	Streptomyces_phage	47.9	2.7e-05
WP_071343916.1|3422833_3425071_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158660784.1|3431678_3432434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343489.1|3432453_3433782_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	3721549	3802225	8304518	integrase,transposase	Bacillus_phage(33.33%)	86	3769097:3769156	3801087:3802227
WP_071343319.1|3721549_3722635_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033089975.1|3723208_3723523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089976.1|3723510_3723777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089977.1|3724193_3724637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161374.1|3724666_3725074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089979.1|3725752_3726400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089980.1|3726784_3727903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343961.1|3727899_3729411_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_081986181.1|3729407_3730295_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_143161373.1|3730287_3730569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089981.1|3730581_3731103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986183.1|3731058_3731262_+	DUF397 domain-containing protein	NA	I4AZQ0	Saccharomonospora_phage	69.7	4.0e-07
WP_045438924.1|3731708_3732716_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_033089984.1|3732770_3733058_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_033089985.1|3733181_3733478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089986.1|3733585_3734362_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_052086828.1|3734375_3734771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343962.1|3734870_3736208_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_071344801.1|3736237_3737359_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	29.6	1.6e-17
WP_071343963.1|3737355_3737988_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_033089989.1|3737984_3738623_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_143161372.1|3738679_3738994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161371.1|3738986_3739202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089991.1|3739305_3739761_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052486742.1|3739767_3740397_-	LppP/LprE family lipoprotein	NA	NA	NA	NA	NA
WP_033089992.1|3740561_3741293_+	bifunctional 1-(5-phosphoribosyl)-5-((5- phosphoribosylamino)methylideneamino)imidazole-4- carboxamide isomerase/phosphoribosylanthranilate isomerase PriA	NA	NA	NA	NA	NA
WP_033089993.1|3741298_3742114_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_033089994.1|3742110_3742884_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_033089995.1|3742880_3743240_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_045438919.1|3743236_3743734_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033089996.1|3744573_3745029_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_033089997.1|3745217_3745523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089998.1|3745721_3747287_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_045438927.1|3747643_3748405_+	TIGR02234 family membrane protein	NA	NA	NA	NA	NA
WP_033089999.1|3748554_3749373_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.2	4.2e-31
WP_033090000.1|3749381_3750668_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_033090001.1|3750664_3751465_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_036552925.1|3751735_3753064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083414901.1|3753270_3754431_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_033091516.1|3754454_3754970_+	TM2 domain-containing protein	NA	Q854V8	Mycobacterium_virus	44.8	2.9e-09
WP_033091515.1|3755159_3755915_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033091514.1|3755932_3756601_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_071811974.1|3756691_3758116_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_071344802.1|3758129_3759041_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_033091512.1|3759096_3759498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986449.1|3759654_3760344_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_045440313.1|3760487_3761060_-	DUF4188 domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|3761337_3762471_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|3762610_3763696_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_062614413.1|3763692_3764160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155239383.1|3765776_3765920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|3766825_3767911_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3769097:3769156	attL	CTAGTGTCCTGAATCGTAAGTTCACTGGCGGTATCTGGTTGTAGGGTGGCCGGGTGCCGC	NA	NA	NA	NA
WP_071343319.1|3769149_3770235_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343639.1|3770658_3771579_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_036553000.1|3771575_3771872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343319.1|3773535_3774621_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052087131.1|3774668_3775298_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_071343965.1|3775423_3776710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045439807.1|3776706_3777453_-	creatininase family protein	NA	NA	NA	NA	NA
WP_071812373.1|3777703_3777850_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155239384.1|3777846_3777999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090858.1|3777995_3778292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090857.1|3778288_3778552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343966.1|3779045_3780119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090855.1|3780115_3782134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090854.1|3782165_3782810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090853.1|3782846_3783461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090852.1|3783467_3783839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090851.1|3783875_3784850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161370.1|3784846_3785191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090849.1|3785228_3785627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090848.1|3785629_3786073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660790.1|3786080_3787079_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_033090847.1|3787120_3787537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343968.1|3787539_3787749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161368.1|3787748_3787991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343969.1|3787995_3788886_+	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_071811972.1|3789104_3790313_+|integrase	site-specific integrase	integrase	Q854H9	Mycobacterium_phage	40.2	1.6e-71
WP_033090843.1|3790665_3791289_+	ANTAR domain-containing response regulator	NA	W8CYM9	Bacillus_phage	31.3	2.2e-08
WP_045439813.1|3791516_3792752_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071343319.1|3792862_3793948_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091547.1|3793965_3795006_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_103557301.1|3795011_3796277_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_082062800.1|3796273_3798085_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	3.8e-16
WP_033091548.1|3798345_3801090_+	DNA polymerase I	NA	J9PVA4	Bacillus_phage	31.8	4.1e-38
WP_071343319.1|3801139_3802225_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3801087:3802227	attR	CTAGTGTCCTGAATCGTAAGTTCACTGGCGGTATCTGGTTGTAGGGTGGCCGGGTGCCGCCGAAGGTTGAGCCTTTGAAGCTGTCGGATACCGAACGTCAGGTGCTGGTCGGGTGGTCTCGCCGCCGGAAGACCGCCCAAGCGTTGGCACTTCGTTCACGGATCGTGCTGGCCTGCGCGGAGAGCGGATCGAACTCCGAGGTGGCGCGGCAGCTGGGTGTTTCGCGAGAAACGGTGCGCAAGTGGCGAACTCGGTTCGAACGCGACCGGCTCGAAGGCTTGTCCGACGAACCGCGACCGGGTGCACCACGCAAGATCACCGACGAGCAGGTGGAACACGTCATCACCACGACATTGGAAACCTCTCCGCCGCAACGGGATACACACTGGTCGACACGCTCAATGGCGCAGGCCACAGGCATGTCGCAGTCAGCGGTTTCCCGGATCTGGCGGGCGTTCGGACTCAAACCGCACCTGGTCGAAACCTGGAAACTGTCGACCGATCCGCTGTTCGTGGACAAGGTCCGCGACGTGGTCGGGCTCTACATGAACCCGCCCCAGAACGCGCTGGTGCTGTGCGTGGACGAGAAATCCCAGATGCAGGCCCTCGACCGGACCGCGCCGACGCTGCCGATCATGCCCACCACCCCGGCGCGCATGACCCATGACTACGTGCGCAACGGCACCACCAACCTGTTCGCGGCACTGGATGTGGCCAGCGGTTCGGTCATCGCCGAACACTATGCGCGCCACCGTCATCAGGAGTTTCTCCGCTTCTTGAAGACCATCGACACCGCCGTGCCCGCCGAGTTCGATCTGCATCTGGTCTGCGACAACTACGGCACCCACAAGACGCCGGCGGTGAAGAAGTGGCTGCTGCGCCACCCGCGGTTCCATGTGCACTTCACCCCGACCTCGGCCAGCTGGCTCAACCTGGTCGAACGCTGGTTCGCCGAGCTGACCAACCGCAAACTGCGCCGCTCGGCCCACCGCAGCGTCACCGAACTCAAGGCCGACGTCCAAGCCTGGATCAACGCCTGGAACGCCGACCCGAAACCGTTCGTCTGGACCAAGACCGCCGACGAGATCCTCGAAACCCTCGCCGCCTACTGCCAACGAATCAACGACTCACGACACTAGCG	NA	NA	NA	NA
>prophage 18
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	3918023	3968043	8304518	transposase,protease	Staphylococcus_phage(33.33%)	44	NA	NA
WP_083414839.1|3918023_3919157_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090172.1|3919358_3919577_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_033090171.1|3919717_3919996_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071343994.1|3920128_3921289_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033090169.1|3921291_3922131_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	2.7e-25
WP_155239401.1|3922433_3922604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052486759.1|3923280_3924228_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343996.1|3924343_3924922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090167.1|3924951_3925323_-	VOC family protein	NA	NA	NA	NA	NA
WP_033090166.1|3925553_3926066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986219.1|3926121_3927471_-	polysaccharide deacetylase family protein	NA	F1B2S6	Tsukamurella_phage	36.8	2.0e-14
WP_143161284.1|3927613_3928123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086870.1|3928218_3929076_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071344808.1|3929151_3929430_-	DUF1918 domain-containing protein	NA	NA	NA	NA	NA
WP_052086868.1|3929536_3930040_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_081986221.1|3930179_3930620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343997.1|3930771_3931728_-	MCE family protein	NA	NA	NA	NA	NA
WP_045439069.1|3931724_3932795_-	MCE family protein	NA	NA	NA	NA	NA
WP_071343998.1|3932791_3933898_-	MCE family protein	NA	NA	NA	NA	NA
WP_045439067.1|3933897_3934911_-	MCE family protein	NA	NA	NA	NA	NA
WP_033090161.1|3934898_3935900_-	MCE family protein	NA	NA	NA	NA	NA
WP_052486756.1|3935896_3936946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090160.1|3936950_3937802_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033090159.1|3937798_3938656_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071343999.1|3938834_3939698_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_071344000.1|3939907_3940681_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_143161285.1|3941962_3942187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083415187.1|3942434_3944312_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_143161286.1|3944500_3944716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086865.1|3945257_3946733_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_071343319.1|3946921_3948007_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|3948056_3949142_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071344001.1|3949151_3949877_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	39.7	8.7e-20
WP_071343317.1|3950296_3951430_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660791.1|3952101_3952779_-	response regulator	NA	NA	NA	NA	NA
WP_071344003.1|3952986_3953226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344809.1|3953510_3953936_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_158660792.1|3954037_3954298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161288.1|3954307_3954976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344005.1|3955768_3956209_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_071344006.1|3956301_3956670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083608338.1|3956684_3957278_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071344008.1|3957924_3965967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|3966957_3968043_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	4012135	4064345	8304518	transposase	Bacillus_virus(33.33%)	49	NA	NA
WP_071343317.1|4012135_4013269_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090740.1|4014093_4014399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344812.1|4014534_4015371_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106852470.1|4015485_4015713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090742.1|4015729_4016947_-	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033090743.1|4016996_4017497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090750.1|4017545_4018544_+	ParB/Srx family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071344015.1|4018822_4020301_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_045439659.1|4020540_4021755_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_045439661.1|4021754_4022834_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.7	2.2e-27
WP_033090745.1|4022835_4023726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_103557228.1|4023712_4024534_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_045439663.1|4024496_4024925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071811782.1|4025045_4025639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162836618.1|4025834_4025990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344017.1|4026055_4027123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986293.1|4028105_4028756_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_096490866.1|4029143_4029638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090747.1|4029638_4029872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090748.1|4029997_4030843_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_081986295.1|4031142_4032390_+	DoxX family protein	NA	NA	NA	NA	NA
WP_071812099.1|4032435_4033581_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_162836621.1|4033577_4033742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490616.1|4034314_4034908_+	MspA family porin	NA	NA	NA	NA	NA
WP_158660793.1|4035727_4037221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091760.1|4037217_4037676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|4037933_4039019_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071343639.1|4039224_4040145_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_036553000.1|4040141_4040438_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071344019.1|4040450_4041218_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_052087109.1|4041336_4041966_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071344020.1|4041978_4042998_-	NPCBM/NEW2 domain-containing protein	NA	NA	NA	NA	NA
WP_158660794.1|4043120_4043687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036551471.1|4043741_4044791_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_158660795.1|4044829_4045513_+	NPCBM/NEW2 domain-containing protein	NA	NA	NA	NA	NA
WP_158660796.1|4045528_4046368_+	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_071812342.1|4046407_4047607_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033090727.1|4047796_4048375_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071811785.1|4048443_4048908_-	HD domain-containing protein	NA	A0A1L2BX36	Bacteriophage	40.8	9.8e-17
WP_033090728.1|4048910_4049915_+	esterase family protein	NA	NA	NA	NA	NA
WP_045439293.1|4049995_4050709_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071344023.1|4050712_4054321_+	urea carboxylase	NA	NA	NA	NA	NA
WP_036551493.1|4054321_4056049_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_033090731.1|4056061_4056628_-	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_033090732.1|4056728_4057592_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033090738.1|4057595_4058801_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_071344024.1|4058888_4060223_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_033090733.1|4060366_4062757_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|4063259_4064345_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	4196130	4251851	8304518	transposase	Cedratvirus(28.57%)	49	NA	NA
WP_071343319.1|4196130_4197216_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071344050.1|4197265_4197781_-	cytochrome P450	NA	NA	NA	NA	NA
WP_033091609.1|4197887_4198124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343883.1|4198460_4198784_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343884.1|4198783_4199710_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158544010.1|4199993_4200458_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_045440407.1|4200750_4201419_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091607.1|4201511_4201976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167659840.1|4202247_4202952_+	response regulator	NA	W8CYM9	Bacillus_phage	36.0	1.6e-34
WP_071344052.1|4202929_4204549_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.2	8.4e-15
WP_033089927.1|4204593_4204884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089928.1|4205077_4206106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089929.1|4206181_4207153_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033089930.1|4207253_4208654_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_033089931.1|4208650_4209421_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_071344821.1|4209417_4211388_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_036547564.1|4211411_4211807_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096490828.1|4211801_4212647_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_143161296.1|4212780_4214589_-	serine/threonine-protein kinase	NA	A0A1M7XUH0	Cedratvirus	27.9	2.6e-17
WP_052086818.1|4214680_4216681_-	serine/threonine-protein kinase	NA	A0A2R8FEI2	Cedratvirus	26.1	7.0e-19
WP_071344054.1|4216876_4217476_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086819.1|4217626_4218466_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045438889.1|4218462_4220838_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071344055.1|4221173_4222040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089948.1|4222056_4222809_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033089935.1|4222889_4223525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086821.1|4223648_4224647_-	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_033089936.1|4224706_4225447_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_081986177.1|4225446_4226622_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_033089938.1|4226732_4227839_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_082062705.1|4227835_4230184_-	serine/threonine protein kinase	NA	A0A2I2L4W4	Orpheovirus	32.2	1.0e-08
WP_033089939.1|4230450_4231632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089940.1|4231639_4232611_-	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071344056.1|4232607_4233846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|4234089_4235175_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_083414913.1|4235306_4236737_+	ammonium transporter	NA	NA	NA	NA	NA
WP_033091060.1|4236736_4237105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343317.1|4239774_4240908_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091058.1|4241474_4241909_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158660802.1|4242269_4243205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986333.1|4243379_4243964_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	48.5	1.6e-16
WP_081986335.1|4243963_4244590_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_033091057.1|4244598_4244856_+	metal-binding protein	NA	NA	NA	NA	NA
WP_033091056.1|4244890_4246015_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	37.1	6.2e-57
WP_033091064.1|4246047_4246704_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106852480.1|4246870_4247923_+	lipase	NA	NA	NA	NA	NA
WP_071344059.1|4247977_4249303_+	lipase	NA	NA	NA	NA	NA
WP_081986331.1|4249233_4250541_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|4250765_4251851_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	4691755	4735623	8304518	integrase,transposase	Tupanvirus(25.0%)	34	4692293:4692311	4738188:4738206
WP_083414917.1|4691755_4692889_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
4692293:4692311	attL	GGCTTCGTCGGCGGTGAAC	NA	NA	NA	NA
WP_158544043.1|4693280_4694369_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_071344126.1|4694376_4695654_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	29.1	2.6e-27
WP_033091380.1|4695650_4696856_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071811865.1|4696872_4698027_+	cytochrome P450	NA	NA	NA	NA	NA
WP_045440162.1|4698060_4699662_+	MFS transporter	NA	NA	NA	NA	NA
WP_083415197.1|4700763_4701228_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033091377.1|4701908_4702118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045440159.1|4702196_4702472_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_083414927.1|4702484_4705016_-	patatin-like protein	NA	NA	NA	NA	NA
WP_071343319.1|4705075_4706161_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_045439060.1|4706263_4707493_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033091820.1|4708120_4708315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344129.1|4709310_4710108_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_033091818.1|4710160_4711390_-	DNA polymerase IV	NA	A0A1W6JNT0	Morganella_phage	27.7	3.3e-19
WP_036552021.1|4711355_4711616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091817.1|4711808_4712198_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_071811868.1|4712194_4712494_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_033091825.1|4712729_4714241_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_033091815.1|4714255_4714996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986533.1|4714887_4716192_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_033091814.1|4716302_4717532_+	serine hydrolase	NA	NA	NA	NA	NA
WP_033091813.1|4717552_4718293_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052087137.1|4721583_4723671_+	hypothetical protein	NA	A0A159B6I5	Gordonia_phage	37.1	2.3e-17
WP_033091811.1|4723732_4724068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083415199.1|4724556_4725282_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071811870.1|4725820_4726036_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_033091810.1|4726196_4726616_+	transcription initiation protein	NA	NA	NA	NA	NA
WP_071344130.1|4726627_4727908_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_052087135.1|4730282_4730627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161320.1|4730863_4731715_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_036549632.1|4731928_4733239_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036553000.1|4734409_4734706_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071344131.1|4734702_4735623_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.9	4.5e-21
4738188:4738206	attR	GGCTTCGTCGGCGGTGAAC	NA	NA	NA	NA
>prophage 22
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	4770778	4779587	8304518	transposase	Pseudomonas_phage(100.0%)	10	NA	NA
WP_071343884.1|4770778_4771705_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343883.1|4771704_4772028_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158660811.1|4772092_4772422_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071343883.1|4773534_4773858_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071344140.1|4773857_4774784_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_103557307.1|4774776_4776066_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.1	1.3e-47
WP_036552925.1|4776155_4777484_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083414930.1|4777484_4777766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045440755.1|4777884_4778202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|4778501_4779587_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	5801066	5862670	8304518	tRNA,transposase	Bacillus_phage(25.0%)	54	NA	NA
WP_071343317.1|5801066_5802200_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_036552588.1|5802295_5802769_+	diadenosine tetraphosphate hydrolase	NA	NA	NA	NA	NA
WP_033091266.1|5802808_5803198_+	RidA family protein	NA	NA	NA	NA	NA
WP_071344309.1|5803317_5803974_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_033091261.1|5804172_5804448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811951.1|5804451_5805891_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_083415219.1|5807493_5807736_-	response regulator	NA	W8CYM9	Bacillus_phage	38.0	1.4e-06
WP_045440044.1|5807811_5809764_+	lipoprotein	NA	NA	NA	NA	NA
WP_033091269.1|5809760_5810681_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_045440041.1|5810752_5812480_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_071344885.1|5812483_5813473_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343319.1|5813502_5814588_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091265.1|5815124_5815940_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071343317.1|5816227_5817361_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071344310.1|5817556_5818636_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_103557315.1|5818635_5820543_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_033088672.1|5820712_5821726_-	Rv2578c family radical SAM protein	NA	NA	NA	NA	NA
WP_033088651.1|5821757_5822744_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0M3ZHF0	Turkeypox_virus	27.7	3.7e-05
WP_033088652.1|5822879_5823209_+	ESX-1 secretion-associated protein	NA	NA	NA	NA	NA
WP_071344312.1|5823205_5824738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088653.1|5824868_5825618_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_036546456.1|5825866_5826739_+	TIGR03619 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_033088655.1|5826739_5827741_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_033088656.1|5827874_5828522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986016.1|5828795_5830124_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_033088657.1|5830245_5831103_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	31.5	6.9e-08
WP_071344313.1|5831497_5832067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088675.1|5832164_5832527_-	DUF4913 domain-containing protein	NA	NA	NA	NA	NA
WP_071344314.1|5832577_5834515_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_045438329.1|5834552_5835134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088661.1|5835142_5835451_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490862.1|5835447_5837001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162836613.1|5838294_5839779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344886.1|5839781_5841260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088663.1|5841312_5842140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088678.1|5842208_5842469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088664.1|5842495_5842789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161360.1|5842832_5843117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162836614.1|5843171_5843741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088665.1|5843842_5844718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086601.1|5844735_5845395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088666.1|5845707_5846469_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_033088681.1|5846595_5847102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088667.1|5847101_5847878_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_033088668.1|5848110_5849145_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_033088682.1|5849213_5850020_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071811953.1|5851414_5853526_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086604.1|5853742_5854627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344316.1|5854709_5855756_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_045438333.1|5856185_5857847_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_045438336.1|5857958_5858993_+	NAD-dependent epimerase/dehydratase family protein	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	37.3	3.0e-05
WP_045438323.1|5859136_5859967_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071343317.1|5860219_5861353_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071343319.1|5861584_5862670_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	6021525	6060402	8304518	integrase,transposase	Thermobifida_phage(33.33%)	41	6036876:6036893	6055051:6055068
WP_071343317.1|6021525_6022659_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_045439673.1|6022840_6024088_-	hemin transporter	NA	NA	NA	NA	NA
WP_033090772.1|6024096_6024558_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090771.1|6024745_6026236_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_033090770.1|6026356_6026863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103557317.1|6027041_6028406_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_033090777.1|6028602_6028902_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033090768.1|6028907_6029252_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_033090767.1|6029343_6029775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811962.1|6030186_6030399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986297.1|6030413_6030803_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033090766.1|6030992_6031340_+	VOC family protein	NA	NA	NA	NA	NA
WP_033090765.1|6031384_6031840_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_045439676.1|6031896_6032472_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033090764.1|6032518_6032989_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_143161366.1|6033170_6033353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081986296.1|6033416_6034925_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033090763.1|6034995_6036417_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_033090762.1|6036554_6037697_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	64.6	6.6e-131
6036876:6036893	attL	GTCCTCGATGGTGATCAC	NA	NA	NA	NA
WP_033090761.1|6037741_6038944_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_033090760.1|6039185_6039953_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_033090759.1|6039956_6040202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045439679.1|6040257_6040680_+	VOC family protein	NA	NA	NA	NA	NA
WP_071343317.1|6040913_6042047_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033091737.1|6042372_6043512_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_036552808.1|6043611_6044235_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033091734.1|6044535_6045333_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.4	1.0e-34
WP_082062697.1|6045329_6046826_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033091182.1|6047288_6047543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087013.1|6048279_6049350_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_036551073.1|6049827_6050526_+	Pr6Pr family membrane protein	NA	NA	NA	NA	NA
WP_036551076.1|6050592_6051765_-	lipase	NA	NA	NA	NA	NA
WP_033091179.1|6051882_6052653_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_103557318.1|6052934_6053921_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	40.8	3.4e-43
WP_071344895.1|6054081_6055443_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
6055051:6055068	attR	GTGATCACCATCGAGGAC	NA	NA	NA	NA
WP_036551080.1|6055435_6056470_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_071344333.1|6056804_6057647_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_143161283.1|6057761_6058016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161282.1|6058033_6059128_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_096490868.1|6059231_6059804_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096490404.1|6060069_6060402_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	6851340	6903227	8304518	tRNA,transposase	Pandoravirus(25.0%)	49	NA	NA
WP_071343319.1|6851340_6852426_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091397.1|6852522_6852732_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_071344459.1|6852721_6853621_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033091396.1|6853807_6854188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161245.1|6854174_6854471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087045.1|6854676_6855084_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081986414.1|6855089_6855839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091394.1|6855845_6858116_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_082062687.1|6858141_6859818_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_011210730.1|6860101_6860293_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_103557261.1|6860364_6860868_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045438646.1|6860874_6861135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344461.1|6861170_6861848_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	38.9	5.4e-32
WP_033090368.1|6861895_6862852_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_036549286.1|6862982_6863651_+	DUF3515 domain-containing protein	NA	NA	NA	NA	NA
WP_071344462.1|6863745_6864843_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_033090351.1|6864976_6865972_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_033090352.1|6866076_6866778_+	2-phospho-L-lactate guanylyltransferase	NA	NA	NA	NA	NA
WP_036549283.1|6866840_6869051_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_033090354.1|6869047_6870016_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_036549280.1|6870205_6870841_-	HU family DNA-binding protein	NA	A0A2P1N0A2	Streptomyces_phage	44.8	6.9e-13
WP_033090356.1|6870997_6871606_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_033090357.1|6871663_6873088_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_036549277.1|6873230_6873932_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071344463.1|6874136_6874637_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071344464.1|6875061_6876528_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_036551329.1|6876541_6877315_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_071344465.1|6877705_6878866_+	MFS transporter	NA	NA	NA	NA	NA
WP_033090369.1|6879156_6880164_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_033090362.1|6880279_6880591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045438639.1|6880626_6880869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033090363.1|6880966_6882589_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	32.4	6.0e-29
WP_062614359.1|6882807_6883209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036551336.1|6883267_6883993_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_071344466.1|6883983_6885141_-	oxidoreductase	NA	NA	NA	NA	NA
WP_071343319.1|6886648_6887734_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033091543.1|6887783_6888002_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	53.2	2.0e-12
WP_083415236.1|6888644_6890696_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_155239853.1|6890955_6891129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091541.1|6891131_6891494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106852440.1|6891540_6892584_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033091542.1|6892604_6893102_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_083415015.1|6893106_6895215_-	neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033091772.1|6895321_6896284_+	NaeI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_071343319.1|6896280_6897366_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036553034.1|6897995_6898931_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096490404.1|6898930_6899263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091621.1|6900627_6902061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|6902141_6903227_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	7184899	7233388	8304518	tRNA,integrase,transposase,protease	Agrobacterium_phage(22.22%)	39	7228180:7228206	7231892:7231918
WP_033086536.1|7184899_7187599_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.1	7.2e-136
WP_033086537.1|7187926_7188565_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_033086538.1|7188789_7189158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086111.1|7189259_7190186_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_033086568.1|7190182_7191760_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_033086569.1|7191878_7192469_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033086539.1|7192574_7194107_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_052086112.1|7194118_7194529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344522.1|7194745_7196350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155239901.1|7196350_7196509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086541.1|7196569_7199650_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036548341.1|7199746_7202023_-	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	33.7	2.7e-19
WP_052486574.1|7202019_7203705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086117.1|7203701_7204916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033086543.1|7205198_7207517_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_033086544.1|7207513_7208326_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_071344523.1|7208426_7208798_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_063864944.1|7208916_7209396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086574.1|7209741_7211022_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	3.3e-139
WP_033086575.1|7211351_7211975_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2H4JEX1	uncultured_Caudovirales_phage	30.5	2.7e-06
WP_033086546.1|7212076_7212658_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.4	1.7e-42
WP_033086576.1|7212892_7214296_-	trigger factor	NA	NA	NA	NA	NA
WP_033086547.1|7214538_7215090_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_033086548.1|7215233_7215758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033086549.1|7218058_7220638_+	polynucleotide kinase-phosphatase	NA	A0A2L0UZN4	Agrobacterium_phage	26.9	5.8e-26
WP_033086550.1|7220704_7221151_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_103557322.1|7221438_7222149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344524.1|7222158_7223373_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_033086553.1|7223479_7225732_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.4	1.6e-173
WP_033086554.1|7225767_7226574_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_033086555.1|7226684_7227374_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_045440457.1|7227679_7228078_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
7228180:7228206	attL	TGGTCGGGGTGACAGGATTTGAACCTG	NA	NA	NA	NA
WP_143161417.1|7228187_7228457_+	hypothetical protein	NA	A0A1U9WS33	Gordonia_phage	57.8	2.0e-22
WP_158544128.1|7228818_7228911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087099.1|7228928_7229297_+	MspA family porin	NA	NA	NA	NA	NA
WP_155240408.1|7230115_7230382_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_081986489.1|7230418_7230694_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_033091646.1|7231385_7231637_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A2P1N2P2	Gordonia_phage	36.1	9.3e-06
WP_083415028.1|7232302_7233388_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
7231892:7231918	attR	TGGTCGGGGTGACAGGATTTGAACCTG	NA	NA	NA	NA
>prophage 27
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	7249542	7432283	8304518	transposase,protease	Vibrio_phage(11.54%)	166	NA	NA
WP_036552925.1|7249542_7250871_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_033091043.1|7251068_7251272_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.5	4.7e-16
WP_033091044.1|7252017_7252368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091045.1|7252534_7253347_-	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	28.9	1.6e-09
WP_033091046.1|7253371_7253842_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_071344529.1|7253953_7255075_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_081986330.1|7255169_7255868_-	DsbA family protein	NA	NA	NA	NA	NA
WP_033091048.1|7255976_7257173_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033091049.1|7257278_7257680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103557324.1|7257725_7259012_+	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_052086992.1|7259077_7260064_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071344531.1|7260622_7261459_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.2	6.2e-38
WP_033091051.1|7261815_7264404_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	33.5	6.6e-46
WP_033091052.1|7264586_7265189_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2I7SAC1	Vibrio_phage	31.8	3.8e-13
WP_071344532.1|7265241_7265829_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_052086836.1|7265841_7266756_-	DUF4333 domain-containing protein	NA	NA	NA	NA	NA
WP_052086835.1|7266752_7267316_-	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	39.0	1.1e-17
WP_071344533.1|7267479_7267914_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081986189.1|7268171_7268615_-	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_033090020.1|7268625_7268904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086834.1|7268982_7270596_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_033090019.1|7270748_7271153_-	globin	NA	NA	NA	NA	NA
WP_033090028.1|7271627_7272152_+	HNH endonuclease	NA	H6WG01	Cyanophage	34.7	2.5e-21
WP_081986191.1|7272217_7272835_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081986188.1|7272910_7273672_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_033090018.1|7273715_7274033_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_033090017.1|7274035_7274767_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_033090016.1|7275075_7275747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986190.1|7275760_7276135_-	thioesterase	NA	NA	NA	NA	NA
WP_071344534.1|7276248_7281156_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_033090014.1|7281757_7283434_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	30.0	8.1e-45
WP_045438938.1|7283444_7283894_-	single-stranded DNA-binding protein	NA	A0A2H4YHU9	Gordonia_phage	35.9	1.3e-13
WP_033090023.1|7284014_7284959_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_033090013.1|7284970_7287010_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_081986186.1|7287544_7288468_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	36.8	2.1e-34
WP_143161419.1|7288467_7288758_-	hypothetical protein	NA	Q9ETV7	Enterobacteria_phage	39.4	1.7e-11
WP_158660843.1|7288812_7289364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155240805.1|7289669_7289825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090010.1|7290396_7290810_-	VOC family protein	NA	NA	NA	NA	NA
WP_081986185.1|7291003_7291756_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_158660844.1|7291817_7292039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158660845.1|7292108_7293695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033091734.1|7294229_7295027_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.4	1.0e-34
WP_082062697.1|7295023_7296520_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_071343883.1|7296646_7296970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343884.1|7296969_7297896_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071343639.1|7297952_7298873_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_036553000.1|7298869_7299166_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036552925.1|7300337_7301666_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071344536.1|7301989_7303633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090480.1|7303750_7304026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090479.1|7304231_7305140_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033090489.1|7305224_7305743_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_033090478.1|7306332_7306671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344537.1|7306712_7308398_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045439432.1|7308456_7308696_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033090477.1|7308989_7309271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|7309317_7310403_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_045439426.1|7310671_7311877_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_071344538.1|7311981_7313127_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071344539.1|7313137_7314133_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081986258.1|7314129_7315014_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.5	9.6e-13
WP_083415029.1|7314986_7315799_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081986256.1|7315977_7316859_+|transposase	transposase	transposase	F9VHY8	Thermus_phage	36.8	4.0e-27
WP_033090474.1|7317298_7318561_-	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_083415245.1|7318790_7319519_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_033090472.1|7319511_7320327_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_036549355.1|7320335_7321331_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	4.0e-15
WP_052086910.1|7321880_7324541_+	nitrate- and nitrite sensing domain-containing protein	NA	NA	NA	NA	NA
WP_071344936.1|7324596_7324980_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_033090470.1|7324976_7325414_+	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_033090469.1|7325430_7325997_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_071343317.1|7326316_7327450_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033090823.1|7327711_7328032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344937.1|7328494_7329115_+	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_033090822.1|7329118_7329469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045439756.1|7329469_7330633_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_052086969.1|7330696_7331761_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_033090821.1|7331890_7332511_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143161421.1|7333940_7334459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081986305.1|7334818_7335355_-	DUF3558 family protein	NA	NA	NA	NA	NA
WP_143161422.1|7335757_7336324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090818.1|7336446_7336956_-	Ltp family lipoprotein	NA	A0A0K0MWU9	Gordonia_phage	47.5	8.8e-11
WP_083415030.1|7337264_7338704_+	MFS transporter	NA	NA	NA	NA	NA
WP_033090817.1|7338708_7339101_-	VOC family protein	NA	NA	NA	NA	NA
WP_158544132.1|7339362_7340670_+	cutinase family protein	NA	NA	NA	NA	NA
WP_033090815.1|7340662_7341610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090814.1|7341789_7342368_+	PadR family transcriptional regulator	NA	H9EB19	Vibrio_phage	41.5	2.1e-08
WP_036550091.1|7342364_7344392_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_052086967.1|7344392_7345010_+	VOC family protein	NA	NA	NA	NA	NA
WP_036553000.1|7345074_7345371_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343639.1|7345367_7346288_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.3	6.9e-22
WP_082062780.1|7346331_7346763_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_033091302.1|7346999_7347794_+	SDR family oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	29.1	6.6e-05
WP_071344543.1|7347936_7349283_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_033091300.1|7349286_7351041_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	37.8	1.1e-65
WP_033091299.1|7351233_7351860_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	41.2	4.5e-25
WP_143161423.1|7352112_7353411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091297.1|7353679_7353865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091296.1|7354213_7354486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155239916.1|7354597_7354849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143161424.1|7355186_7357241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344545.1|7357791_7359009_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158660846.1|7359188_7359494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|7359535_7360621_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096490687.1|7361002_7361323_+	2TM domain-containing protein	NA	NA	NA	NA	NA
WP_143161426.1|7361470_7361698_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081985963.1|7361710_7363108_+	DUF1298 domain-containing protein	NA	NA	NA	NA	NA
WP_071343317.1|7363153_7364287_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_033088256.1|7364576_7364954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033088257.1|7364943_7365432_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_081985964.1|7365932_7366700_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.3e-37
WP_158660847.1|7366696_7369042_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_045437913.1|7369222_7369801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083415031.1|7369840_7371271_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_071344550.1|7371439_7372378_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	8.6e-20
WP_158660848.1|7372374_7373019_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_033088261.1|7373885_7374110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088262.1|7374465_7375200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344552.1|7375479_7376484_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_052086532.1|7376508_7378065_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_071344553.1|7378099_7379098_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_045437920.1|7379118_7379676_-	LppP/LprE family lipoprotein	NA	NA	NA	NA	NA
WP_033088265.1|7379808_7380291_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033088266.1|7380459_7383939_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_103557267.1|7384293_7385364_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_045437925.1|7385412_7386909_+	amino acid permease	NA	NA	NA	NA	NA
WP_033088269.1|7386996_7387479_+	adenosine-specific kinase	NA	NA	NA	NA	NA
WP_071344555.1|7387549_7388380_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_033088270.1|7388491_7389256_+	phosphotransferase	NA	NA	NA	NA	NA
WP_052086533.1|7389557_7390388_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_052086534.1|7390572_7391430_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_036546542.1|7391463_7392432_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033088272.1|7392365_7393286_-	serine hydrolase	NA	NA	NA	NA	NA
WP_096490691.1|7393477_7395205_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_033088274.1|7396199_7396970_+	cyclase family protein	NA	NA	NA	NA	NA
WP_033088275.1|7396974_7398642_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.8	6.4e-18
WP_071344556.1|7398671_7399436_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071344557.1|7399596_7400052_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071344558.1|7400137_7400977_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096490693.1|7401027_7402185_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_033088279.1|7403132_7403621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081985969.1|7403981_7404710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033088281.1|7404790_7405438_+	cyclase family protein	NA	NA	NA	NA	NA
WP_143161430.1|7405574_7405949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071812092.1|7406029_7407301_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033088284.1|7407978_7408179_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071344560.1|7408175_7409366_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_071344561.1|7409497_7410805_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.5	2.1e-16
WP_071344939.1|7411418_7412564_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_071343319.1|7415077_7416163_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071344564.1|7416352_7417054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344565.1|7417053_7417656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161431.1|7417652_7418216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161432.1|7418339_7418663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036552925.1|7418647_7419976_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158660849.1|7420314_7421157_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_071343489.1|7421345_7422674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083415248.1|7423495_7424296_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_071343317.1|7424307_7425441_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_083415250.1|7425408_7425855_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_083415034.1|7425851_7426907_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_071344569.1|7426903_7427914_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_071344570.1|7427910_7429002_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_071344571.1|7428998_7430036_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_071343319.1|7431197_7432283_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	7650466	7687799	8304518	transposase	Streptomyces_phage(28.57%)	35	NA	NA
WP_071343319.1|7650466_7651552_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_143161193.1|7651633_7651840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091734.1|7652176_7652974_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.4	1.0e-34
WP_082062697.1|7652970_7654467_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033089920.1|7654848_7655745_+	helix-turn-helix domain-containing protein	NA	A0A1J0MCL6	Streptomyces_phage	29.1	1.7e-17
WP_036551763.1|7655734_7655941_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_033089918.1|7657321_7658863_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_033089917.1|7658882_7660073_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_033089916.1|7660306_7661653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089926.1|7661753_7662848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089915.1|7663157_7664561_-	NAD(P)H-quinone dehydrogenase	NA	NA	NA	NA	NA
WP_071344947.1|7664865_7665345_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_033089914.1|7665429_7665843_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167659850.1|7665922_7667095_-	amidohydrolase	NA	NA	NA	NA	NA
WP_071343319.1|7668202_7669288_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033089912.1|7669820_7670525_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_045438801.1|7670673_7671477_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_036549880.1|7671486_7673037_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	33.5	7.0e-59
WP_033089922.1|7673807_7674131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036549882.1|7674285_7675500_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	45.5	8.3e-15
WP_033089909.1|7675570_7675912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089908.1|7675962_7676292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089907.1|7676318_7677566_+	primosomal protein	NA	NA	NA	NA	NA
WP_071344603.1|7677626_7678718_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_158543949.1|7678859_7679177_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_103557326.1|7679210_7680497_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.9	5.9e-80
WP_033089904.1|7680593_7680995_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_071811631.1|7681295_7681688_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_033089902.1|7681776_7682208_+	succinate dehydrogenase hydrophobic membrane anchor subunit	NA	NA	NA	NA	NA
WP_033089901.1|7682224_7683994_+	succinate dehydrogenase flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	25.4	3.9e-05
WP_033089900.1|7683993_7684767_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_033089899.1|7685154_7685595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036553034.1|7685666_7686602_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096490404.1|7686601_7686934_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158660852.1|7686824_7687799_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.9	1.2e-19
>prophage 29
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	7824098	7863074	8304518	tRNA,transposase,protease	Mycobacterium_phage(100.0%)	34	NA	NA
WP_083415046.1|7824098_7825232_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_071344627.1|7825351_7826686_+|protease	type VII secretion-associated serine protease mycosin	protease	V5UPA7	Mycobacterium_phage	38.6	2.9e-61
WP_071344628.1|7826692_7828177_-	type VII secretion protein EccB	NA	NA	NA	NA	NA
WP_083415047.1|7828285_7829929_+	type VII secretion protein EccE	NA	NA	NA	NA	NA
WP_071344629.1|7829953_7830532_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096490790.1|7830556_7831381_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_033086045.1|7832205_7833039_-	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_051028944.1|7833208_7833478_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_081985669.1|7833474_7834461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033085986.1|7834540_7835503_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033085985.1|7835614_7836469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033085984.1|7836553_7837534_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033085983.1|7837803_7838100_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071344632.1|7838124_7838727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161190.1|7838831_7839557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033085980.1|7839970_7840267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081985666.1|7840610_7841525_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_033085979.1|7841544_7842051_-	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_033085978.1|7842103_7843162_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_071344633.1|7843268_7843874_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_029923717.1|7843895_7844309_-	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_033085976.1|7844318_7844690_-	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_033085975.1|7844871_7844985_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_040804562.1|7845105_7845327_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_045436502.1|7847812_7849309_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_083414824.1|7849507_7850641_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_036552529.1|7850829_7852011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052087101.1|7852007_7853825_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_081986490.1|7853921_7854392_-	DUF4254 domain-containing protein	NA	NA	NA	NA	NA
WP_045440478.1|7854606_7855446_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071343319.1|7855469_7856555_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071344634.1|7856626_7859452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344734.1|7859516_7860746_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036553000.1|7862777_7863074_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	7930826	7992880	8304518	tRNA,transposase,protease	Tupanvirus(20.0%)	48	NA	NA
WP_071343319.1|7930826_7931912_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158660860.1|7931892_7932768_-	helix-turn-helix domain-containing protein	NA	A0A1J0MCL6	Streptomyces_phage	30.4	1.1e-16
WP_036552925.1|7933029_7934358_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033090666.1|7934508_7934712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155239998.1|7934898_7935072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096490392.1|7935960_7936560_+	MspA family porin	NA	NA	NA	NA	NA
WP_045440135.1|7936627_7936915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071344652.1|7937502_7939344_+	hypothetical protein	NA	A6N222	Microbacterium_phage	47.4	6.6e-16
WP_071343489.1|7939482_7940811_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096490391.1|7941820_7942315_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071344653.1|7942367_7943213_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_084978582.1|7943218_7943749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052086945.1|7943773_7944235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090669.1|7944420_7944816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344654.1|7944812_7945112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344655.1|7945323_7945740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033090671.1|7945922_7946483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029923637.1|7946623_7946809_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_033090672.1|7946812_7947376_-	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_033090673.1|7947377_7947692_-	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_033090674.1|7947694_7948063_-	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_033090675.1|7948378_7950415_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.7	8.8e-86
WP_096490390.1|7950537_7952550_+	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	28.4	5.3e-83
WP_033090677.1|7952593_7952929_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_052086946.1|7952962_7953565_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_033090678.1|7953692_7954658_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_143161178.1|7954847_7955945_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_036552925.1|7956207_7957536_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083415054.1|7958017_7959391_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_033089497.1|7959380_7961504_+	amylo-alpha-1,6-glucosidase	NA	NA	NA	NA	NA
WP_033089496.1|7961530_7962295_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033089495.1|7962291_7963146_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033089494.1|7963352_7964327_-	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	6.2e-21
WP_071344657.1|7964345_7968980_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.2	1.1e-56
WP_081986120.1|7969000_7975063_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.8	6.9e-78
WP_052086747.1|7975093_7978345_-	nocobactin polyketide synthase NbtC	NA	NA	NA	NA	NA
WP_033089492.1|7978337_7979666_-	polyketide synthase	NA	NA	NA	NA	NA
WP_033089491.1|7979662_7980418_-	thioesterase	NA	NA	NA	NA	NA
WP_033089490.1|7980430_7981372_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.2	1.6e-10
WP_081986123.1|7981414_7982668_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_071344658.1|7982923_7983391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033089487.1|7983471_7985208_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	3.5e-35
WP_081986119.1|7985204_7987151_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	1.8e-27
WP_071344659.1|7987273_7988230_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_081986118.1|7988276_7989041_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_033089485.1|7989175_7989586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033089484.1|7989752_7990751_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_071343319.1|7991794_7992880_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP017839	Nocardia seriolae strain EM150506 chromosome, complete genome	8304518	8007534	8087958	8304518	transposase	Tupanvirus(22.22%)	52	NA	NA
WP_071344734.1|8007534_8008764_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_103557273.1|8008869_8009538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033087294.1|8009629_8010844_+	lycopene cyclase	NA	NA	NA	NA	NA
WP_033087295.1|8010809_8011838_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_052086261.1|8011941_8012796_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033087297.1|8012804_8013614_-	antibiotic transporter	NA	NA	NA	NA	NA
WP_045436990.1|8013610_8014639_-	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	3.8e-21
WP_071344663.1|8014972_8016454_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_045436987.1|8016473_8017724_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071344664.1|8017852_8018647_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_103557274.1|8018671_8019910_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_033087307.1|8020052_8021045_-	esterase family protein	NA	NA	NA	NA	NA
WP_158660861.1|8021305_8035309_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.8	2.7e-133
WP_103557328.1|8048227_8053129_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.0	8.7e-55
WP_033087311.1|8057849_8058830_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045436982.1|8058889_8059729_-	M23 family metallopeptidase	NA	A0A1I9S7S4	Rhodococcus_phage	46.0	4.4e-23
WP_033087300.1|8061027_8061420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811593.1|8061474_8062998_-	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	37.3	2.5e-21
WP_045436979.1|8063178_8063646_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_033087301.1|8063647_8065267_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	5.8e-24
WP_081985826.1|8065418_8065763_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052086269.1|8065801_8066158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052086270.1|8066217_8066598_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_071344668.1|8066671_8068309_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.3	2.8e-26
WP_033087303.1|8068849_8070319_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158543934.1|8070403_8070835_+	DUF5313 family protein	NA	NA	NA	NA	NA
WP_033091771.1|8071097_8071730_-	hypothetical protein	NA	Q6J7Y8	Actinoplanes_phage	36.4	4.9e-27
WP_036553034.1|8073368_8074304_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096490404.1|8074303_8074636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071344669.1|8074693_8075203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071343883.1|8075267_8075591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071343884.1|8075590_8076517_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_033091358.1|8076845_8077031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091359.1|8077063_8077396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091360.1|8077392_8077809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091361.1|8077778_8077988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091362.1|8077987_8078290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091363.1|8078286_8078553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143161467.1|8078549_8078822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091365.1|8078818_8079106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091366.1|8079102_8079525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071344671.1|8079583_8079859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091368.1|8079867_8080350_-	single-stranded DNA-binding protein	NA	A0A1U9WS23	Gordonia_phage	61.2	3.7e-35
WP_033091369.1|8080522_8081464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091370.1|8081496_8081946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036545799.1|8081942_8082839_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155240011.1|8082835_8083012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145961780.1|8083008_8084913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155240012.1|8085071_8085242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106852489.1|8085243_8085999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033091374.1|8085991_8086237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071343319.1|8086872_8087958_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
