The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009360	Mycobacterium avium subsp. hominissuis strain OCU464 chromosome, complete genome	5178461	646240	698779	5178461	protease,integrase,transposase,tRNA,bacteriocin	Burkholderia_virus(16.67%)	54	678904:678954	701093:701143
WP_003875791.1|646240_647038_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003875792.1|647034_648045_-	peroxidase	NA	NA	NA	NA	NA
WP_033719292.1|648088_649396_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003875793.1|649415_649763_+	VOC family protein	NA	NA	NA	NA	NA
WP_003875794.1|649763_649985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019685434.1|650113_652411_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	62.7	3.6e-269
WP_023869771.1|652430_653081_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023861906.1|653093_653483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085978605.1|653548_655147_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	29.7	1.2e-45
WP_003877203.1|655207_656302_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.9	1.0e-56
WP_003875800.1|656381_656567_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_023861905.1|656713_657808_-	folate-binding protein	NA	NA	NA	NA	NA
WP_023861904.1|657918_658788_+	4-amino-4-deoxychorismate lyase	NA	NA	NA	NA	NA
WP_009974934.1|659059_659722_-	FABP family protein	NA	NA	NA	NA	NA
WP_003875804.1|659718_659817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003877205.1|659867_660170_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003875806.1|660171_661005_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_023861903.1|661041_661512_-	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_023864130.1|661734_662154_-	thioredoxin	NA	NA	NA	NA	NA
WP_031349049.1|662150_662963_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003875810.1|663131_663914_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.5	9.1e-15
WP_033719081.1|663910_664861_+	mycothiol acetyltransferase	NA	NA	NA	NA	NA
WP_023861899.1|665023_666148_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A2R8FEI2	Cedratvirus	47.7	5.9e-07
WP_009974940.1|666199_667243_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_009974941.1|667239_668154_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
WP_003875815.1|668166_668943_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.8e-16
WP_003875816.1|669072_669741_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
WP_033711302.1|669799_671905_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023861898.1|672110_673244_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003875819.1|673250_674273_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_023861897.1|674457_675072_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023861896.1|675140_676214_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_033711307.1|676230_676434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024636831.1|676490_676892_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	31.9	4.6e-07
WP_023861893.1|676935_677469_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	37.9	4.7e-15
WP_023861892.1|677523_678420_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
678904:678954	attL	CGTCCGCCTGAAAAGCGGAAGGTCGGCGGTTCGATCCCGCCCCTGGCCACC	NA	NA	NA	NA
WP_033719078.1|678987_680145_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	30.1	9.3e-32
WP_080691802.1|680145_680379_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_033719077.1|680393_681737_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_033719076.1|681733_682156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071321360.1|682255_683050_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033719075.1|683127_683556_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_033719074.1|683624_684224_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095884802.1|684707_685873_-	hypothetical protein	NA	Q6H9S6	Enterobacteria_phage	35.9	6.7e-22
WP_071321527.1|685913_686477_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084021584.1|686551_686974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095764118.1|687618_688903_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.8	6.8e-60
WP_095764118.1|689602_690887_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.8	6.8e-60
WP_099156408.1|690924_691200_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_071321362.1|691279_694357_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_033719071.1|695144_695828_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080691801.1|695840_697052_-	cytochrome P450	NA	NA	NA	NA	NA
WP_033719070.1|697100_697682_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080691800.1|698125_698779_-|protease	CAAX protease	protease	NA	NA	NA	NA
701093:701143	attR	CGTCCGCCTGAAAAGCGGAAGGTCGGCGGTTCGATCCCGCCCCTGGCCACC	NA	NA	NA	NA
>prophage 2
NZ_CP009360	Mycobacterium avium subsp. hominissuis strain OCU464 chromosome, complete genome	5178461	1353716	1415816	5178461	protease,transposase,tRNA	Corynebacterium_phage(22.22%)	52	NA	NA
WP_033719824.1|1353716_1354952_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.0	1.6e-77
WP_076221396.1|1355265_1355511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019734102.1|1356355_1356955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042907271.1|1357063_1358299_-|transposase	IS256-like element IS1311 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.2	4.8e-111
WP_062886316.1|1358362_1358773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019734134.1|1359435_1359777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019734135.1|1360192_1361845_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062888076.1|1361841_1363260_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_019734137.1|1363263_1364589_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_044543606.1|1364585_1365668_+	threonine synthase	NA	NA	NA	NA	NA
WP_010949610.1|1365697_1366645_+	homoserine kinase	NA	NA	NA	NA	NA
WP_076221186.1|1366614_1366920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062888078.1|1366912_1368775_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_003873232.1|1368876_1369119_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003873231.1|1369215_1370289_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_019732347.1|1370302_1371250_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_071321395.1|1371249_1371909_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.4	1.3e-17
WP_003873228.1|1371935_1373159_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_003877292.1|1373374_1373857_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_003873226.1|1373849_1374608_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_024636915.1|1374692_1374941_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_033726727.1|1374950_1375484_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003873223.1|1375491_1376832_+	ATP synthase subunit b-delta	NA	NA	NA	NA	NA
WP_003877295.1|1376899_1378564_+	ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003873221.1|1378570_1379485_+	ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003873220.1|1379513_1380971_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003873219.1|1381010_1381376_+	ATP synthase epsilon chain	NA	NA	NA	NA	NA
WP_003873218.1|1381392_1381836_+	DUF2550 domain-containing protein	NA	NA	NA	NA	NA
WP_019732348.1|1381832_1382426_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_033726728.1|1382510_1383764_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_023861565.1|1389651_1390464_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	41.7	4.5e-49
WP_023870547.1|1390463_1391681_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.0	1.1e-14
WP_010949605.1|1392155_1392653_-	methylated-DNA--protein-cysteine methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.6	1.3e-19
WP_023861301.1|1392649_1394149_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_080691721.1|1394235_1395129_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033717889.1|1395201_1396449_+	MFS transporter	NA	NA	NA	NA	NA
WP_009975723.1|1396472_1396808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062887735.1|1396913_1398548_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.3	3.2e-14
WP_010949602.1|1398584_1399265_+	endonuclease NucS	NA	NA	NA	NA	NA
WP_023865474.1|1399288_1399585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033717892.1|1399595_1400060_-	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_011724213.1|1400140_1401322_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_033717893.1|1401512_1402424_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_023897719.1|1402449_1404645_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_033717895.1|1404679_1406770_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_071321396.1|1407069_1409682_+	DUF3417 domain-containing protein	NA	NA	NA	NA	NA
WP_033717897.1|1409665_1411678_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	26.7	1.1e-48
WP_033717898.1|1411711_1413046_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	34.9	3.9e-42
WP_010949598.1|1413113_1413431_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_019733669.1|1413455_1414043_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_023868653.1|1414053_1415094_+	S58 family peptidase	NA	NA	NA	NA	NA
WP_023868635.1|1415144_1415816_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP009360	Mycobacterium avium subsp. hominissuis strain OCU464 chromosome, complete genome	5178461	1533086	1546476	5178461	transposase	Burkholderia_virus(50.0%)	11	NA	NA
WP_095764118.1|1533086_1534371_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.8	6.8e-60
WP_071321398.1|1534448_1535042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009979999.1|1535977_1536772_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	1.6e-30
WP_011724852.1|1536768_1538349_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_062889334.1|1539207_1539474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095764118.1|1540325_1541610_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.8	6.8e-60
WP_023861565.1|1541820_1542633_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	41.7	4.5e-49
WP_023870547.1|1542632_1543850_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.0	1.1e-14
WP_076221353.1|1544290_1544485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062889416.1|1544481_1544946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085978347.1|1545206_1546476_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.4	1.2e-53
>prophage 4
NZ_CP009360	Mycobacterium avium subsp. hominissuis strain OCU464 chromosome, complete genome	5178461	3732102	3738674	5178461		Bacillus_phage(33.33%)	8	NA	NA
WP_071321464.1|3732102_3734268_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	1.6e-207
WP_003874934.1|3734237_3734690_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	37.7	1.7e-13
WP_003874933.1|3734732_3734972_-	NrdH-redoxin	NA	V5UN81	Mycobacterium_phage	64.5	2.0e-21
WP_080691690.1|3735047_3735314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003874932.1|3735501_3736056_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	5.4e-06
WP_033717674.1|3736149_3736764_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033717675.1|3736763_3737807_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	28.5	1.9e-20
WP_009978328.1|3737741_3738674_-	short chain dehydrogenase	NA	W8CYX9	Bacillus_phage	35.9	4.6e-05
>prophage 1
NZ_CP009405	Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p78K, complete sequence	78497	42860	55186	78497		Mycobacterium_phage(77.78%)	14	NA	NA
WP_071321585.1|42860_43538_-	hypothetical protein	NA	V5UN75	Mycobacterium_phage	50.8	1.1e-45
WP_071321586.1|43534_43906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071321587.1|43902_44208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071321588.1|44210_44741_-	hypothetical protein	NA	V5UQP3	Mycobacterium_phage	34.8	6.6e-17
WP_071321589.1|44794_45373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071321624.1|45407_45650_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	65.8	1.4e-22
WP_071321625.1|46079_46340_-	hypothetical protein	NA	V5UPD3	Mycobacterium_phage	44.7	2.9e-10
WP_071321590.1|46422_47403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071321591.1|47404_48262_-	hypothetical protein	NA	A0A1C9EHS9	Gordonia_phage	43.2	7.5e-55
WP_071321592.1|48350_49004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071321593.1|49219_50821_-	hypothetical protein	NA	A0A2H4PED4	Mycobacterium_phage	40.7	5.7e-72
WP_071321594.1|50882_51377_-	hypothetical protein	NA	V5UN98	Mycobacterium_phage	36.0	2.1e-17
WP_071321595.1|51466_51841_-	single-stranded DNA-binding protein	NA	A0A0U4B2E8	Arthrobacter_phage	55.9	6.2e-30
WP_084021731.1|53698_55186_+	DUF4226 domain-containing protein	NA	V5UPX1	Mycobacterium_phage	46.1	8.3e-17
