The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017561	Paraburkholderia sprentiae WSM5005 chromosome 1, complete sequence	3645501	24310	36649	3645501	protease	Streptococcus_phage(12.5%)	11	NA	NA
WP_027198632.1|24310_26416_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	3.5e-61
WP_027198631.1|26575_27094_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	38.2	5.6e-13
WP_082194658.1|27239_27431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027198630.1|27928_28498_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_027198629.1|28863_30120_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.7e-11
WP_007180614.1|30303_30510_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	2.4e-23
WP_008919570.1|31066_31381_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	5.8e-13
WP_018421594.1|31377_33675_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.6	1.2e-168
WP_027198628.1|33819_34266_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.6	8.7e-47
WP_027198627.1|34332_35349_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027198626.1|35431_36649_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	1.1e-43
>prophage 2
NZ_CP017561	Paraburkholderia sprentiae WSM5005 chromosome 1, complete sequence	3645501	2213716	2221699	3645501		Escherichia_phage(42.86%)	8	NA	NA
WP_027196860.1|2213716_2214493_-	ABC transporter ATP-binding protein	NA	Q66093	Chlorella_virus	24.7	2.9e-05
WP_027196859.1|2214497_2215316_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_027196858.1|2215317_2216733_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	1.7e-56
WP_027196857.1|2216942_2217869_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	1.1e-30
WP_027196856.1|2217878_2218430_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.1	9.4e-51
WP_027196855.1|2218414_2219308_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	57.4	2.9e-94
WP_027196854.1|2219318_2220380_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.6	2.7e-86
WP_027196853.1|2220787_2221699_-	GDP-mannose 4,6-dehydratase	NA	E5ES47	Bathycoccus_sp._RCC1105_virus	23.9	1.1e-06
>prophage 3
NZ_CP017561	Paraburkholderia sprentiae WSM5005 chromosome 1, complete sequence	3645501	2329516	2338560	3645501		unidentified_phage(16.67%)	7	NA	NA
WP_027196763.1|2329516_2331130_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.2	2.0e-24
WP_027196762.1|2331181_2331724_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_027196761.1|2331720_2332401_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	28.9	3.3e-05
WP_027196760.1|2332437_2333253_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	29.6	2.8e-35
WP_027196759.1|2333301_2335188_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	36.9	1.4e-53
WP_027196758.1|2335206_2336343_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	40.5	3.7e-25
WP_027196757.1|2336610_2338560_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	4.5e-148
>prophage 1
NZ_CP017562	Paraburkholderia sprentiae WSM5005 chromosome 2, complete sequence	2657711	422910	477652	2657711	plate,transposase,integrase	Streptococcus_phage(20.0%)	35	465691:465708	485736:485753
WP_027194100.1|422910_423645_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.7	3.8e-23
WP_071336681.1|426778_426943_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_027194102.1|427421_427625_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.1	4.9e-21
WP_034477058.1|429568_430492_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027194104.1|431097_432555_-	serine/threonine protein kinase	NA	A0A2P1EMR8	Moumouvirus	35.0	1.5e-18
WP_027194105.1|432595_433474_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_027194106.1|433530_434553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027194107.1|434718_435270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027194108.1|435314_436241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027194109.1|436262_436868_-	OmpA family protein	NA	NA	NA	NA	NA
WP_051374155.1|437028_437745_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_027194110.1|437741_441287_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_027194111.1|441333_442623_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_027194112.1|442646_443981_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027194113.1|444001_445747_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_027194114.1|445778_447770_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.7e-37
WP_018422989.1|447771_448161_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_027194115.1|448184_450971_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.3	1.3e-79
WP_027194116.1|450975_452055_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027194117.1|452039_453935_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_018422993.1|453939_454452_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027194118.1|454444_455281_-	virulence protein SciE type	NA	NA	NA	NA	NA
WP_027194119.1|455376_455865_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027194120.1|455910_457407_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_026226255.1|457432_457933_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027194121.1|458026_459058_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_051374156.1|459838_460615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027194123.1|460649_461447_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_027194124.1|461478_462282_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027194125.1|462278_466838_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
465691:465708	attL	TTCGCGGTCAACGTGCCG	NA	NA	NA	NA
WP_027194126.1|466909_468583_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_027194127.1|468603_470790_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_034477070.1|471095_473081_+	DUF4384 domain-containing protein	NA	NA	NA	NA	NA
WP_027194130.1|475417_476275_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_027194131.1|477088_477652_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
485736:485753	attR	TTCGCGGTCAACGTGCCG	NA	NA	NA	NA
>prophage 2
NZ_CP017562	Paraburkholderia sprentiae WSM5005 chromosome 2, complete sequence	2657711	2558657	2594238	2657711	transposase	Stx2-converting_phage(28.57%)	25	NA	NA
WP_162162785.1|2558657_2559044_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027196540.1|2559040_2559388_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	4.3e-33
WP_027196541.1|2559439_2561038_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	3.7e-156
WP_034478420.1|2562356_2563286_-	HTH-type transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_051374323.1|2563296_2564634_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_051374324.1|2565491_2568509_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_027196544.1|2568510_2569539_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_027196545.1|2569765_2571199_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_027196546.1|2571593_2571962_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_027196547.1|2572162_2572765_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_027196548.1|2572924_2573842_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034478424.1|2574140_2574641_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_027196549.1|2574669_2575995_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027196550.1|2576926_2578219_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	37.4	9.3e-65
WP_034478427.1|2578236_2579526_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_034478794.1|2580429_2581689_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	1.7e-23
WP_154671775.1|2582386_2583142_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.4	1.1e-20
WP_179950646.1|2583150_2583948_-	DUF2968 domain-containing protein	NA	NA	NA	NA	NA
WP_027196555.1|2584237_2585389_-	porin	NA	NA	NA	NA	NA
WP_027196556.1|2585918_2587340_-	amidohydrolase	NA	NA	NA	NA	NA
WP_027196557.1|2587400_2588729_-	MFS transporter	NA	NA	NA	NA	NA
WP_154671776.1|2590027_2590507_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_154671777.1|2591482_2592604_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.9e-38
WP_027196560.1|2592721_2592901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027196561.1|2593212_2594238_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	36.7	2.2e-61
>prophage 1
NZ_CP017565	Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence	438974	12638	72403	438974	transposase,integrase	Staphylococcus_phage(25.0%)	49	69311:69349	72468:72506
WP_027196582.1|12638_14138_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_082194590.1|15091_16195_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_027196583.1|16191_17223_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_154671786.1|17437_17929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027196584.1|18551_18821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051374351.1|19217_20252_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	41.1	6.6e-05
WP_027196585.1|20281_21169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027196586.1|21565_23011_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_154671787.1|23322_24066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034478907.1|24413_25394_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_051374353.1|25642_25984_-	DUF4087 domain-containing protein	NA	NA	NA	NA	NA
WP_071336742.1|26327_28055_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	6.7e-10
WP_027196590.1|28292_28556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174566143.1|28790_29057_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027196591.1|30686_31874_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_082194592.1|31961_33440_-	MFS transporter	NA	NA	NA	NA	NA
WP_027196592.1|33816_34587_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.2	1.6e-08
WP_027193605.1|34697_35381_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	34.7	6.9e-27
WP_071336743.1|35410_37105_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.6	6.7e-63
WP_071336744.1|37348_37996_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083421027.1|38389_40276_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027196594.1|40653_40929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051374354.1|41056_41914_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034478912.1|43060_44248_+	CoA transferase	NA	NA	NA	NA	NA
WP_154671795.1|44428_45307_+	EamA family transporter	NA	NA	NA	NA	NA
WP_027196596.1|45508_46120_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027196597.1|46160_46811_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_051374355.1|46880_47972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027196598.1|47993_49079_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	42.2	5.0e-80
WP_027196599.1|49094_50078_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_027196600.1|50089_50503_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027196601.1|50604_51498_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154671789.1|51831_52053_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162162786.1|54563_54875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027196604.1|54785_54980_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_027196605.1|55017_55212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034478923.1|55221_55548_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027196606.1|55709_56108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154671796.1|58099_58480_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_027196608.1|58526_58859_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_027196609.1|59069_60095_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.8	1.7e-05
WP_027196610.1|60214_60514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027196611.1|61219_62188_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083421030.1|62751_64374_+	PQQ-dependent dehydrogenase, methanol/ethanol family	NA	NA	NA	NA	NA
WP_154671790.1|65029_65557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154671791.1|65676_68934_+	hypothetical protein	NA	NA	NA	NA	NA
69311:69349	attL	AAGGCCGATTATGCCAAGTCGTTGATTATGGAAAGTAGC	NA	NA	NA	NA
WP_027196614.1|69466_70426_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K7N4	Mycobacterium_phage	32.4	3.1e-09
WP_027196615.1|70422_71397_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027196616.1|71389_72403_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
72468:72506	attR	GCTACTTTCCATAATCAACGACTTGGCATAATCGGCCTT	NA	NA	NA	NA
>prophage 2
NZ_CP017565	Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence	438974	191667	277474	438974	transposase,integrase	Stx2-converting_phage(25.0%)	59	191541:191600	196463:196560
191541:191600	attL	TCGGCCTTATGCGAAGCTTTCCATAAGGCCGATTATGCCAAGTCGTTGATTATGGAAAGT	NA	NA	NA	NA
WP_027196616.1|191667_192681_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_027196615.1|192673_193648_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027196614.1|193644_194604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K7N4	Mycobacterium_phage	32.4	3.1e-09
WP_034476854.1|194966_195521_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_027193595.1|195871_196222_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_051374096.1|197300_198890_-	response regulator	NA	W8CYF6	Bacillus_phage	25.1	1.7e-15
196463:196560	attR	TCGGCCTTATGCGAAGCTTTCCATAAGGCCGATTATGCCAAGTCGTTGATTATGGAAAGTAGCAGGTCGGAACTCGCGTCGAGAGCTGATGGAAAGCG	NA	NA	NA	NA
WP_027193598.1|198892_199696_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_051374161.1|200015_200270_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_154671642.1|200280_200535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154671643.1|200614_201317_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.5	2.8e-39
WP_174566145.1|202320_202491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027193601.1|202525_202795_-	DUF1488 family protein	NA	NA	NA	NA	NA
WP_071336757.1|204835_206725_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027193603.1|207118_207766_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071336758.1|208016_209711_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.1	1.7e-66
WP_027193605.1|209740_210424_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	34.7	6.9e-27
WP_034476863.1|210827_211034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154671644.1|213016_213175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027193607.1|215206_215989_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_027193608.1|216049_217072_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027193609.1|217443_217812_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_051374162.1|217969_218857_+	xylose isomerase	NA	NA	NA	NA	NA
WP_027193610.1|218853_219909_+	isopenicillin N synthase family oxygenase	NA	S4VNP9	Pandoravirus	31.8	6.9e-18
WP_027193612.1|220360_221122_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_027193613.1|221132_221783_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_027193614.1|221979_225603_+	urea carboxylase	NA	NA	NA	NA	NA
WP_027193615.1|225649_227482_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_027193616.1|227530_228502_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	3.1e-20
WP_027193617.1|228559_229471_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	5.8e-37
WP_027193619.1|230146_230818_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_082194419.1|232675_233218_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_027193620.1|233344_234112_-	malonate transporter subunit MadM	NA	NA	NA	NA	NA
WP_027193621.1|234696_236700_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.1	1.5e-37
WP_027193622.1|236860_238246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051374163.1|240171_240465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027193623.1|241650_242628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027193624.1|242656_245017_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_027193625.1|245080_246916_-	DUF1302 family protein	NA	NA	NA	NA	NA
WP_027193626.1|247001_248363_-	DUF1329 domain-containing protein	NA	NA	NA	NA	NA
WP_034476873.1|251831_252248_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_027193630.1|252244_252589_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	69.6	3.6e-40
WP_154671679.1|252667_254212_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.3	2.7e-135
WP_051374100.1|255172_256411_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_027193632.1|256471_257401_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_027193633.1|257496_258408_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154671645.1|258540_258972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051374102.1|260630_261857_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_027193637.1|261801_262077_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_027193638.1|262073_262826_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_027193639.1|262898_263810_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_082194460.1|263891_263963_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_027193640.1|264970_266017_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_051374103.1|266063_268139_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_027193641.1|268309_268957_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_051374104.1|269059_271372_-	5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH	NA	NA	NA	NA	NA
WP_027193642.1|271643_272381_+	coenzyme F420-0:L-glutamate ligase	NA	NA	NA	NA	NA
WP_027193643.1|272377_273316_+	2-phospho-L-lactate transferase	NA	NA	NA	NA	NA
WP_051374105.1|273312_273900_+	2-phospho-L-lactate guanylyltransferase	NA	NA	NA	NA	NA
WP_154671679.1|275929_277474_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.3	2.7e-135
