The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017770	Paenibacillus crassostreae strain LPB0068 chromosome, complete genome	4627176	779490	788533	4627176		Staphylococcus_phage(50.0%)	10	NA	NA
WP_099458687.1|779490_780666_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	29.5	3.6e-07
WP_068657744.1|780801_781311_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_068657739.1|781283_781964_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_068657734.1|782199_782805_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.1	1.0e-13
WP_068657733.1|782773_783565_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	31.0	8.3e-08
WP_068657732.1|783649_784117_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.9	1.5e-44
WP_068657731.1|784152_785385_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.5	7.6e-117
WP_068657730.1|785548_786214_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.2e-39
WP_068657729.1|786294_787395_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	8.4e-59
WP_068657728.1|788101_788533_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	41.3	5.7e-19
>prophage 2
NZ_CP017770	Paenibacillus crassostreae strain LPB0068 chromosome, complete genome	4627176	962266	1009786	4627176	tail,plate,integrase,capsid,protease,holin,portal,terminase	Bacteriophage(24.24%)	67	961904:961950	1009885:1009931
961904:961950	attL	TATCTTGACAGGGTAGGGGTCAATGGTTCGAATCCATTACAGATCAT	NA	NA	NA	NA
WP_068659721.1|962266_962728_-	transcriptional regulator	NA	A0A0S2SXN1	Bacillus_phage	66.0	1.8e-47
WP_068659719.1|962804_963305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659717.1|963384_963609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659712.1|963682_963886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659710.1|963882_964428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659708.1|964448_965390_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	43.4	2.1e-21
WP_068659706.1|965386_966931_-	hypothetical protein	NA	A0A2H4J8D4	uncultured_Caudovirales_phage	31.9	8.8e-54
WP_068659704.1|966932_967319_-	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	48.8	6.2e-25
WP_068659846.1|967332_967665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659701.1|968081_968534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659699.1|968620_969172_-	hypothetical protein	NA	A0A2H4J564	uncultured_Caudovirales_phage	42.2	9.8e-32
WP_068659697.1|969168_969504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659696.1|969521_969899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659694.1|969876_971211_-	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	39.0	6.4e-69
WP_068659692.1|971200_971539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659690.1|971498_972446_-	hypothetical protein	NA	A0A0M4S6Y4	Bacillus_phage	56.0	7.4e-11
WP_068659688.1|972460_973153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659686.1|973153_973906_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	66.4	9.7e-91
WP_068659684.1|973902_974397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099458702.1|974393_974606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659679.1|974745_975672_-	recombinase RecT	NA	A0A0K2CYQ1	Paenibacillus_phage	50.5	3.3e-80
WP_068659678.1|975836_976196_-	hypothetical protein	NA	K4JWE2	Caulobacter_phage	32.6	9.3e-07
WP_068659676.1|976198_976450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659672.1|976637_978215_-	AAA family ATPase	NA	A0A0C5AN00	Paenibacillus_phage	44.5	4.1e-107
WP_068659670.1|978273_978654_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_068659668.1|978667_978943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659666.1|979013_979298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659664.1|979460_980177_-	hypothetical protein	NA	A0A1P8CWY0	Bacillus_phage	51.1	1.2e-34
WP_068659661.1|980392_980626_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	52.9	5.6e-13
WP_082865763.1|980846_981749_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	64.7	1.0e-14
WP_068659659.1|981966_982206_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082865770.1|982787_983318_+	hypothetical protein	NA	A0A097BY93	Leuconostoc_phage	63.0	1.8e-11
WP_068659656.1|983455_983788_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_068659654.1|983925_984129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068659652.1|984222_985281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659651.1|985280_985811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659649.1|985987_986593_-	lysozyme	NA	A0A192YD15	Lactococcus_phage	55.1	2.4e-31
WP_068659647.1|986589_986997_-|holin	phage holin family protein	holin	D0R7H7	Paenibacillus_phage	59.8	1.2e-34
WP_068659645.1|987409_987811_-	hypothetical protein	NA	S6C455	Thermus_phage	56.9	3.3e-29
WP_068659643.1|987832_989374_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	58.6	5.5e-40
WP_068659641.1|989382_989934_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.7	7.7e-37
WP_068659639.1|989933_991052_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	46.0	2.2e-78
WP_068659637.1|991048_991354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659636.1|991356_991953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659634.1|991953_992157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659632.1|992156_993086_-	hypothetical protein	NA	H7BVZ1	unidentified_phage	33.9	6.3e-47
WP_068659844.1|993086_993275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659630.1|993303_995211_-	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	41.1	1.2e-33
WP_068659628.1|995331_995676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659626.1|995712_996240_-	hypothetical protein	NA	A0A067ZJA9	Vibrio_phage	37.2	3.0e-22
WP_068659624.1|996236_997679_-	hypothetical protein	NA	A0A2K9V2R6	Faecalibacterium_phage	39.4	2.4e-93
WP_068659621.1|997696_998245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659619.1|998241_998814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659617.1|998815_999139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157756215.1|999128_999293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157756214.1|999276_999609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659613.1|999624_1000659_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	46.9	1.0e-82
WP_068659611.1|1000673_1001057_-	hypothetical protein	NA	A0A0C5AN05	Bacteriophage	38.2	7.3e-10
WP_068659609.1|1001056_1002151_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	46.0	1.9e-42
WP_068659607.1|1002167_1003772_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	63.2	3.5e-186
WP_068659605.1|1003771_1004005_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	53.2	1.1e-11
WP_068659603.1|1004029_1005898_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	65.6	5.5e-244
WP_068659601.1|1005869_1006403_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	40.9	3.0e-30
WP_157756213.1|1006705_1006882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659599.1|1006874_1007156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659597.1|1007896_1008130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068659595.1|1008637_1009786_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	38.7	1.6e-52
1009885:1009931	attR	TATCTTGACAGGGTAGGGGTCAATGGTTCGAATCCATTACAGATCAT	NA	NA	NA	NA
>prophage 3
NZ_CP017770	Paenibacillus crassostreae strain LPB0068 chromosome, complete genome	4627176	1367655	1438574	4627176	tail,protease,transposase,tRNA,coat	Bacillus_virus(16.67%)	58	NA	NA
WP_068657236.1|1367655_1370322_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	44.3	6.0e-175
WP_099458668.1|1370804_1371578_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_068657232.1|1372241_1373150_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_068657297.1|1373146_1374439_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_068657230.1|1374517_1375519_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_068657228.1|1375697_1377248_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_082865675.1|1377252_1378860_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_068657226.1|1378868_1379696_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_068657224.1|1379712_1381107_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_068657222.1|1381266_1381788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068657220.1|1381914_1382580_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_068657218.1|1382595_1384932_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.3	1.2e-176
WP_068657215.1|1385016_1386753_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	32.8	4.6e-19
WP_068657214.1|1386951_1388067_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_068657211.1|1388189_1389464_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.6	1.5e-147
WP_068657209.1|1389475_1390066_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.0e-55
WP_068657207.1|1390312_1391644_-	trigger factor	NA	NA	NA	NA	NA
WP_068657205.1|1391888_1392803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068657203.1|1393486_1393675_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_068657201.1|1393741_1394191_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_068657199.1|1394453_1396067_+	GMC family oxidoreductase	NA	A0A2K9L353	Tupanvirus	25.9	2.5e-11
WP_068657197.1|1396847_1398692_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	26.6	1.4e-34
WP_068657195.1|1398796_1399420_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_099458667.1|1399421_1400180_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_068657191.1|1400273_1401341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068657189.1|1401479_1402058_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	52.7	2.3e-39
WP_068657187.1|1402149_1403139_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_068657185.1|1403569_1404379_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.0	1.9e-28
WP_068657183.1|1404432_1405185_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_068657181.1|1405178_1405952_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.5	4.1e-28
WP_082865674.1|1405935_1406901_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068657179.1|1407131_1407356_-	helix-turn-helix transcriptional regulator	NA	A0A290GJH9	Caldibacillus_phage	68.9	9.2e-13
WP_068657177.1|1407540_1408392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068657175.1|1408804_1409878_+	glucose-1-phosphate thymidylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	33.3	9.8e-36
WP_068657173.1|1409989_1411069_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_068657172.1|1411100_1412909_-	glycosyltransferase	NA	A0A2P1ELT8	Moumouvirus	23.2	2.7e-06
WP_068657170.1|1413084_1414110_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_068657167.1|1414102_1415176_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_082865671.1|1415181_1416027_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_068657165.1|1416047_1416833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068657163.1|1416835_1418167_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.8	4.7e-72
WP_068657161.1|1418163_1419129_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	34.5	3.8e-39
WP_068657159.1|1419207_1420383_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_068659106.1|1420500_1420842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068654598.1|1421757_1422063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068654596.1|1422059_1422404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068654595.1|1422431_1422728_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_068654593.1|1423051_1427875_-|tail	WIAG-tail domain	tail	NA	NA	NA	NA
WP_068654591.1|1428099_1428906_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_068654589.1|1428952_1429801_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_068654588.1|1429839_1430631_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068654586.1|1430683_1432144_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	4.4e-23
WP_068654584.1|1432289_1432904_+	flavin-nucleotide-binding protein	NA	NA	NA	NA	NA
WP_068654600.1|1433002_1434298_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_068654582.1|1434612_1435830_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_068654580.1|1435832_1436579_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	5.1e-23
WP_068654578.1|1436635_1438015_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	27.5	1.9e-44
WP_068659106.1|1438232_1438574_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017770	Paenibacillus crassostreae strain LPB0068 chromosome, complete genome	4627176	2277560	2284885	4627176		Bacillus_virus(33.33%)	8	NA	NA
WP_068654614.1|2277560_2279645_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	65.8	4.0e-275
WP_068654616.1|2279631_2279991_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.7	1.8e-34
WP_068654618.1|2280501_2281125_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	8.2e-35
WP_068654620.1|2281273_2281678_-	DoxX family protein	NA	NA	NA	NA	NA
WP_068654622.1|2281828_2282380_+	helix-turn-helix transcriptional regulator	NA	B0ZSI5	Halomonas_phage	43.8	3.2e-06
WP_068654624.1|2282547_2283093_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_068654626.1|2283341_2283704_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.8	6.7e-05
WP_082865542.1|2283721_2284885_-	response regulator	NA	A0A127AWB9	Bacillus_phage	37.5	5.8e-26
>prophage 5
NZ_CP017770	Paenibacillus crassostreae strain LPB0068 chromosome, complete genome	4627176	3503501	3518946	4627176		Synechococcus_phage(30.0%)	14	NA	NA
WP_068661027.1|3503501_3505637_+	DNA topoisomerase III	NA	A0A0G2Y4W4	Acanthamoeba_polyphaga_mimivirus	24.7	5.7e-27
WP_068661003.1|3505749_3506013_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_068661004.1|3506055_3506490_+	universal stress protein	NA	NA	NA	NA	NA
WP_068661005.1|3506942_3507428_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	39.2	2.0e-20
WP_082865827.1|3507424_3508618_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_068661006.1|3508624_3509920_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	1.2e-19
WP_068661007.1|3509963_3510848_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	30.7	2.8e-36
WP_068661008.1|3510887_3511133_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	39.0	1.3e-07
WP_068661009.1|3511137_3511827_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_068661010.1|3511804_3514048_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	2.3e-164
WP_068661011.1|3514032_3515541_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.5	2.0e-50
WP_068661012.1|3515576_3516617_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	44.9	1.6e-70
WP_068661013.1|3516616_3517237_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.7	2.0e-20
WP_068661014.1|3517398_3518946_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.3	4.5e-74
>prophage 6
NZ_CP017770	Paenibacillus crassostreae strain LPB0068 chromosome, complete genome	4627176	3882919	3893104	4627176		Bacillus_phage(71.43%)	10	NA	NA
WP_068656410.1|3882919_3884716_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.9	7.4e-36
WP_068656409.1|3884810_3885545_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	4.6e-37
WP_068656407.1|3885755_3886511_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	35.3	1.1e-17
WP_068656405.1|3886544_3887204_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_068656403.1|3887307_3889968_+	DNA polymerase I	NA	A0A060AM05	Listeria_phage	26.0	1.2e-47
WP_068656401.1|3890018_3890846_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	28.5	1.5e-20
WP_068656712.1|3890937_3891651_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_068656399.1|3891659_3892256_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_068656397.1|3892252_3892816_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	40.3	3.5e-16
WP_068656395.1|3892888_3893104_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	52.9	4.8e-11
>prophage 1
NZ_CP017771	Paenibacillus crassostreae strain LPB0068 plasmid pPC01, complete sequence	21419	0	6583	21419	integrase,transposase	uncultured_Caudovirales_phage(25.0%)	7	NA	NA
WP_068658762.1|573_2022_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	25.7	8.9e-16
WP_068658764.1|2014_2827_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	29.3	6.8e-05
WP_068658766.1|2913_3876_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	28.8	3.8e-31
WP_157756203.1|4172_4382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068658771.1|4406_4970_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157756204.1|5278_5503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068658774.1|5764_6583_-	helix-turn-helix domain-containing protein	NA	A0A1V0E018	Clostridioides_phage	33.3	2.3e-05
>prophage 2
NZ_CP017771	Paenibacillus crassostreae strain LPB0068 plasmid pPC01, complete sequence	21419	11781	16682	21419	bacteriocin	Pseudomonas_phage(50.0%)	5	NA	NA
WP_068658753.1|11781_13218_-	hypothetical protein	NA	A0A2H4P817	Pseudomonas_phage	50.1	8.0e-126
WP_068658755.1|13461_13836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050804737.1|14208_14556_-|bacteriocin	bacteriocin transporter	bacteriocin	NA	NA	NA	NA
WP_040758723.1|14956_15538_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_009766654.1|15563_16682_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	3.1e-32
