The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	0	6136	3637729	integrase	Bacillus_phage(33.33%)	5	286:299	1789:1802
WP_071167591.1|213_441_-	hypothetical protein	NA	NA	NA	NA	NA
286:299	attL	ATTGAGCCTTTGCA	NA	NA	NA	NA
WP_071167592.1|491_854_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_071167593.1|1315_1627_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1C8E994	Bacillus_phage	55.1	2.6e-13
WP_008358010.1|1634_3536_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.6	1.3e-67
1789:1802	attR	ATTGAGCCTTTGCA	NA	NA	NA	NA
WP_071167594.1|3559_6136_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.6	1.1e-37
>prophage 2
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	9379	11622	3637729		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_145939380.1|9379_10561_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	5.0e-49
WP_071167595.1|10557_11622_-	L-threonine 3-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.3	1.6e-17
>prophage 3
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	15047	15308	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_003211281.1|15047_15308_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	3.2e-09
>prophage 4
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	18454	19498	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_008358025.1|18454_19498_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	75.2	9.6e-137
>prophage 5
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	29561	30842	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_071167601.1|29561_30842_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.8	8.9e-44
>prophage 6
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	36643	39013	3637729		Mycobacterium_phage(100.0%)	1	NA	NA
WP_071167603.1|36643_39013_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.4e-87
>prophage 7
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	48548	49778	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_008354432.1|48548_49778_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	32.3	2.3e-49
>prophage 8
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	53600	58346	3637729	tRNA	Indivirus(50.0%)	5	NA	NA
WP_071167608.1|53600_54566_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	28.4	2.5e-06
WP_071167609.1|54584_55514_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_007499525.1|55582_55933_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_008354445.1|55950_56229_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_008354447.1|56225_58346_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	2.5e-22
>prophage 9
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	62254	70985	3637729		Erwinia_phage(50.0%)	3	NA	NA
WP_071167612.1|62254_64360_-	glycoside hydrolase	NA	G0YQI6	Erwinia_phage	35.8	6.1e-106
WP_008354456.1|64395_66246_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_008354457.1|66671_70985_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	33.9	1.4e-24
>prophage 10
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	76107	76890	3637729		Flavobacterium_phage(100.0%)	1	NA	NA
WP_008354462.1|76107_76890_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	5.3e-23
>prophage 11
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	80859	81627	3637729		Salisaeta_icosahedral_phage(100.0%)	1	NA	NA
WP_008354468.1|80859_81627_-	FliA/WhiG family RNA polymerase sigma factor	NA	I1ZBD5	Salisaeta_icosahedral_phage	25.9	2.0e-06
>prophage 12
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	107899	114307	3637729	protease,tRNA	Erwinia_phage(33.33%)	5	NA	NA
WP_008354498.1|107899_109300_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	27.8	2.9e-40
WP_008354499.1|109316_109862_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_071167623.1|109876_110794_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	28.4	2.2e-28
WP_008354501.1|110856_112161_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_008354502.1|112231_114307_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	39.4	4.6e-106
>prophage 13
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	119763	120528	3637729		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_071167625.1|119763_120528_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.4	3.8e-26
>prophage 14
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	130908	132897	3637729		Moumouvirus(33.33%)	3	NA	NA
WP_008354529.1|130908_131652_-	ribonuclease III	NA	M1PMQ4	Moumouvirus	32.9	4.9e-26
WP_003212028.1|131838_132072_-	acyl carrier protein	NA	M4M9G2	Vibrio_phage	43.5	3.5e-07
WP_071167630.1|132153_132897_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.8	1.4e-20
>prophage 15
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	144310	146266	3637729		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_071167636.1|144310_146266_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	32.1	1.5e-21
>prophage 16
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	149455	159464	3637729	tRNA	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_071167639.1|149455_150409_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	5.7e-11
WP_008354566.1|150414_150897_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.2	2.3e-16
WP_008354568.1|150912_153321_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_071167640.1|153317_154535_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	4.5e-45
WP_008354574.1|154652_154856_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_071167641.1|154859_155474_-	guanylate kinase	NA	S4W1R9	Pandoravirus	32.0	1.3e-08
WP_008344898.1|155483_155753_-	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_008354579.1|155829_156705_-	YicC family protein	NA	NA	NA	NA	NA
WP_071167642.1|156788_159464_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.7	5.4e-83
>prophage 17
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	163499	168225	3637729		Freshwater_phage(33.33%)	6	NA	NA
WP_071167646.1|163499_164093_-	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	47.7	2.3e-10
WP_071167647.1|164106_165243_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	30.1	7.4e-42
WP_008354597.1|165300_166365_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_008354599.1|166378_167080_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_008354601.1|167125_167272_-	YezD family protein	NA	NA	NA	NA	NA
WP_008354603.1|167586_168225_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	36.8	1.8e-32
>prophage 18
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	173807	184193	3637729	tRNA	Halovirus(25.0%)	9	NA	NA
WP_071167651.1|173807_174902_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.9	2.6e-60
WP_008354616.1|174898_176185_-	dihydroorotase	NA	NA	NA	NA	NA
WP_008354618.1|176168_177092_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	38.1	4.9e-36
WP_008354620.1|177222_178551_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	33.7	1.5e-54
WP_008354622.1|178706_179249_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_008354624.1|179419_180334_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_008354626.1|180330_180798_-	signal peptidase II	NA	NA	NA	NA	NA
WP_008354628.1|180892_181267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008354630.1|181427_184193_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	28.5	5.9e-93
>prophage 19
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	188736	189513	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071167652.1|188736_189513_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.8	3.3e-09
>prophage 20
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	194622	201820	3637729		Bacillus_phage(100.0%)	4	NA	NA
WP_008354657.1|194622_195402_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	44.1	9.9e-46
WP_008354658.1|195545_196265_-	RNA polymerase sporulation sigma factor SigE	NA	A0A0A0RV91	Bacillus_phage	28.7	2.1e-18
WP_008354660.1|196323_197253_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_071167653.1|197503_201820_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	30.4	7.7e-23
>prophage 21
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	224508	225048	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_071167661.1|224508_225048_-	sporulation-specific transcriptional regulator GerR	NA	A0A1D6X8E5	Bacillus_phage	28.4	2.0e-05
>prophage 22
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	230628	235722	3637729		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_008354711.1|230628_231111_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	4.0e-29
WP_008354714.1|231115_231673_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003212137.1|231984_232257_-	YlbG family protein	NA	NA	NA	NA	NA
WP_008354717.1|232322_232772_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_008354719.1|232829_233237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008354720.1|233309_233558_-	YlbE-like family protein	NA	NA	NA	NA	NA
WP_008354722.1|233577_233997_-	YlbD family protein	NA	NA	NA	NA	NA
WP_008354724.1|234107_235151_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	36.7	6.4e-16
WP_008354725.1|235272_235722_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	36.2	4.1e-12
>prophage 23
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	244005	245439	3637729		Catovirus(100.0%)	1	NA	NA
WP_071167668.1|244005_245439_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	32.9	2.9e-59
>prophage 24
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	252434	257097	3637729		Bacillus_phage(50.0%)	5	NA	NA
WP_034738124.1|252434_253757_-	PhoH family protein	NA	A0A223LDL5	Bacillus_phage	35.5	2.2e-69
WP_008354755.1|253897_254515_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_008354758.1|254618_254849_+	YlaI family protein	NA	NA	NA	NA	NA
WP_008354760.1|254879_255203_-	YlaH-like family protein	NA	NA	NA	NA	NA
WP_008354762.1|255258_257097_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	23.7	1.4e-21
>prophage 25
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	264284	265697	3637729		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_008361871.1|264284_265697_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.0	3.3e-47
>prophage 26
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	270838	271396	3637729		Synechococcus_phage(100.0%)	1	NA	NA
WP_008356994.1|270838_271396_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.3	2.1e-13
>prophage 27
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	279587	284352	3637729		Paenibacillus_phage(50.0%)	5	NA	NA
WP_008356980.1|279587_279866_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	47.3	9.7e-12
WP_008356978.1|280142_281150_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_008356975.1|281224_281356_+	protein YkpC	NA	NA	NA	NA	NA
WP_071167676.1|281462_282695_+	aminopeptidase	NA	NA	NA	NA	NA
WP_008356968.1|282732_284352_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.1	7.6e-48
>prophage 28
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	290714	291416	3637729		Planktothrix_phage(100.0%)	1	NA	NA
WP_008356956.1|290714_291416_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	4.6e-34
>prophage 29
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	300361	300820	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_008356933.1|300361_300820_-	TlpA family protein disulfide reductase	NA	A0A127AW88	Bacillus_phage	50.0	1.2e-35
>prophage 30
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	305072	306907	3637729		Bacillus_phage(100.0%)	3	NA	NA
WP_008356919.1|305072_305531_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	37.6	2.2e-13
WP_071167687.1|305547_306441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008356912.1|306430_306907_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	32.0	7.4e-12
>prophage 31
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	313051	313816	3637729		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_008356896.1|313051_313816_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	38.0	9.7e-38
>prophage 32
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	318462	322598	3637729		Bacillus_phage(50.0%)	3	NA	NA
WP_071167692.1|318462_319596_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	56.0	2.8e-113
WP_008356877.1|321192_321654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008356874.1|321689_322598_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	35.3	1.6e-50
>prophage 33
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	327542	336733	3637729		Ectocarpus_siliculosus_virus(33.33%)	6	NA	NA
WP_071167697.1|327542_329372_-	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.0	3.5e-09
WP_071167698.1|329528_331652_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_008356857.1|331989_332790_+	hypothetical protein	NA	A0A0E3T7R5	Bacillus_phage	64.6	1.9e-39
WP_071167699.1|333026_333899_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071167700.1|333912_334698_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071167701.1|334771_336733_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.5	6.2e-12
>prophage 34
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	340378	342478	3637729		Vibrio_phage(100.0%)	1	NA	NA
WP_008361175.1|340378_342478_-	PTS transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	43.7	2.6e-08
>prophage 35
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	346071	358564	3637729	protease	Streptococcus_phage(16.67%)	13	NA	NA
WP_071167704.1|346071_347991_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.8	4.5e-108
WP_008361164.1|348287_348776_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_008361162.1|348830_350147_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_071167705.1|350447_351110_-	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	53.2	1.6e-25
WP_008361762.1|351417_351612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003211747.1|351768_351957_+	DUF2187 family protein	NA	NA	NA	NA	NA
WP_071167706.1|352081_352300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003211403.1|352561_353059_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.8	1.1e-55
WP_008361757.1|353074_353806_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	48.8	4.3e-59
WP_071167708.1|353802_354240_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_071167709.1|354240_354897_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.0	2.5e-66
WP_008361751.1|355172_356216_-	membrane protein	NA	NA	NA	NA	NA
WP_008361749.1|356461_358564_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.1	9.3e-131
>prophage 36
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	370923	371415	3637729		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_008361472.1|370923_371415_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	40.4	1.9e-18
>prophage 37
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	379608	382794	3637729		Bacillus_phage(100.0%)	4	NA	NA
WP_008361366.1|379608_379803_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.2	7.2e-14
WP_071167720.1|379841_381035_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_071167721.1|381031_381787_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_008361360.1|382002_382794_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	44.6	1.2e-30
>prophage 38
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	393629	408437	3637729		Bacillus_phage(42.86%)	16	NA	NA
WP_008359448.1|393629_394316_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.4e-32
WP_008359446.1|394830_395790_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	47.9	3.8e-71
WP_071167730.1|396247_398536_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_071167731.1|398676_399147_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	41.4	1.1e-20
WP_008359439.1|399230_399650_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_008359437.1|399810_400257_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008359435.1|400289_400718_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_071167732.1|400903_401038_-	phosphatase	NA	NA	NA	NA	NA
WP_008359430.1|401027_402164_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.3	2.6e-87
WP_008359427.1|402289_403537_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.5	3.6e-98
WP_071169173.1|403549_404647_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.2e-73
WP_008359423.1|404964_405867_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_071167733.1|406029_406215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174549246.1|406248_406566_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_008359416.1|406559_406889_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_071167734.1|407393_408437_+	bifunctional transcriptional activator/DNA repair protein Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	50.0	2.5e-20
>prophage 39
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	412435	413401	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_071167738.1|412435_413401_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.0	9.8e-19
>prophage 40
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	418048	419062	3637729		Planktothrix_phage(100.0%)	1	NA	NA
WP_008359387.1|418048_419062_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	5.1e-18
>prophage 41
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	422991	424317	3637729		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_008359374.1|422991_424317_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	1.8e-18
>prophage 42
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	430047	431430	3637729		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_071167746.1|430047_431430_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.8	2.0e-41
>prophage 43
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	438912	439644	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_008358881.1|438912_439644_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	3.1e-25
>prophage 44
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	448428	450826	3637729		Bacillus_phage(66.67%)	3	NA	NA
WP_008358855.1|448428_449328_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	51.4	8.4e-73
WP_071167754.1|449627_450212_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	46.3	3.3e-38
WP_071167755.1|450202_450826_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.5	2.4e-42
>prophage 45
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	456198	461509	3637729		Bacillus_phage(75.0%)	6	NA	NA
WP_071167760.1|456198_457380_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.1	7.7e-26
WP_008358831.1|457999_458308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071167761.1|458614_458791_-	RapH phosphatase inhibitor	NA	NA	NA	NA	NA
WP_167358853.1|458780_459902_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	46.6	2.7e-84
WP_083381153.1|460079_461012_-	hypothetical protein	NA	Q9ZXD5	Bacillus_phage	42.3	2.1e-66
WP_071167762.1|461017_461509_-	hypothetical protein	NA	D6R409	Bacillus_phage	46.6	2.4e-21
>prophage 46
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	464768	475747	3637729	coat	Pandoravirus(50.0%)	16	NA	NA
WP_008355397.1|464768_465887_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.5	5.3e-16
WP_008355396.1|466307_467048_+	esterase family protein	NA	NA	NA	NA	NA
WP_008355393.1|467100_467616_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_008355391.1|467622_468057_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008355389.1|468138_468396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071167765.1|468522_470832_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	34.3	1.3e-80
WP_003212292.1|470848_471106_-	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_008348419.1|471244_471382_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_071167766.1|471466_471688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008355381.1|471974_472313_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_071167767.1|472503_472890_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_071167768.1|472933_473272_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_071167769.1|473359_473845_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_008355373.1|473991_474483_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_008355371.1|474697_475141_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_071167770.1|475177_475747_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 47
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	484371	485115	3637729		Salmonella_phage(100.0%)	1	NA	NA
WP_071167775.1|484371_485115_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	S4TNS0	Salmonella_phage	24.2	2.9e-10
>prophage 48
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	488780	493770	3637729		Bacillus_phage(50.0%)	5	NA	NA
WP_008355335.1|488780_489545_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	68.1	5.3e-36
WP_008355333.1|489822_490221_+	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_008355332.1|490217_491129_+	DsbA family protein	NA	NA	NA	NA	NA
WP_008355329.1|491425_491599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071167777.1|491709_493770_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	25.8	1.3e-60
>prophage 49
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	497621	502033	3637729		Pseudomonas_phage(33.33%)	5	NA	NA
WP_008355318.1|497621_498287_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	37.0	1.4e-27
WP_003211421.1|498327_498723_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_008355315.1|498916_499495_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071167781.1|500025_500943_-	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.1	2.8e-07
WP_089374143.1|500944_502033_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.8e-14
>prophage 50
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	507441	508194	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_008355296.1|507441_508194_-	YjbA family protein	NA	A0A109ZRE1	Bacillus_phage	42.0	1.2e-48
>prophage 51
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	514243	516243	3637729		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_071169177.1|514243_515239_-	dipeptide ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.1	5.7e-06
WP_071167785.1|515262_516243_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	3.3e-22
>prophage 52
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	525509	526460	3637729		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_071167792.1|525509_526460_-	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	30.2	7.6e-24
>prophage 53
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	529529	531812	3637729		Halovirus(50.0%)	2	NA	NA
WP_008355254.1|529529_530591_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.9	1.9e-60
WP_008355252.1|530660_531812_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.9	1.0e-30
>prophage 54
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	542163	546060	3637729	transposase	Staphylococcus_phage(33.33%)	3	NA	NA
WP_145939387.1|542163_543317_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	3.2e-40
WP_008355224.1|543436_545086_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.1	1.5e-14
WP_008355221.1|545082_546060_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	27.6	2.5e-30
>prophage 55
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	549890	553319	3637729		Dickeya_phage(100.0%)	1	NA	NA
WP_071167797.1|549890_553319_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	51.7	1.0e-09
>prophage 56
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	562338	563685	3637729		Klosneuvirus(100.0%)	1	NA	NA
WP_071167802.1|562338_563685_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.2	2.3e-21
>prophage 57
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	571941	573783	3637729		Mimivirus(100.0%)	1	NA	NA
WP_071169178.1|571941_573783_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1X9VNR2	Mimivirus	23.0	7.3e-23
>prophage 58
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	580748	589047	3637729		Bacillus_virus(100.0%)	3	NA	NA
WP_008355145.1|580748_584144_-	SMC family ATPase	NA	G3MAB6	Bacillus_virus	24.0	1.2e-10
WP_008355143.1|584140_585316_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_071167809.1|585342_589047_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	22.5	8.7e-15
>prophage 59
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	597807	603439	3637729		uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_008355122.1|597807_598170_+	hypothetical protein	NA	A0A2H4J238	uncultured_Caudovirales_phage	31.4	2.4e-10
WP_008355120.1|598255_598690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008355118.1|598730_599690_-	LCP family protein	NA	NA	NA	NA	NA
WP_071167811.1|599829_600774_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008359073.1|600796_601555_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.5	2.1e-16
WP_008359071.1|601545_602496_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_008359069.1|602488_603439_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	53.2	9.1e-94
>prophage 60
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	611107	620702	3637729		Trichoplusia_ni_ascovirus(25.0%)	8	NA	NA
WP_071167818.1|611107_611968_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.8	3.2e-53
WP_071167819.1|612109_613642_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008359045.1|613734_615030_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.5	1.9e-09
WP_008359043.1|615092_615677_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_008359041.1|616063_617209_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	35.6	6.3e-41
WP_008359040.1|617256_618540_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071167820.1|618717_619134_+	sporulation protein	NA	NA	NA	NA	NA
WP_008359035.1|619148_620702_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.9	5.2e-46
>prophage 61
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	639076	641974	3637729		Staphylococcus_phage(33.33%)	3	NA	NA
WP_008361146.1|639076_639817_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	3.4e-27
WP_008361144.1|640304_640733_+	HIT family protein	NA	X4YER2	Lactococcus_phage	29.2	6.1e-05
WP_071167829.1|640894_641974_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.0	5.5e-79
>prophage 62
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	660298	660655	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_008361320.1|660298_660655_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	27.9	5.0e-05
>prophage 63
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	665938	673659	3637729	transposase	Bacillus_phage(80.0%)	6	NA	NA
WP_008361307.1|665938_667045_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.6	4.6e-20
WP_008361305.1|667272_667476_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	73.0	1.5e-17
WP_008361302.1|667760_668378_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_145939389.1|668467_669819_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	73.2	3.8e-109
WP_008362065.1|669889_671905_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.7e-44
WP_071167839.1|671901_673659_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.7	6.7e-42
>prophage 64
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	676973	680114	3637729		Bacillus_phage(50.0%)	4	NA	NA
WP_008359835.1|676973_677720_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	30.0	8.9e-20
WP_008359837.1|677734_678823_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_008359843.1|678987_679089_-	YhdX family protein	NA	NA	NA	NA	NA
WP_008359844.1|679397_680114_+	glycerophosphoryl diester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	30.5	1.6e-18
>prophage 65
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	689673	690495	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_008359873.1|689673_690495_-	C40 family peptidase	NA	M1HNA7	Bacillus_virus	41.1	2.1e-09
>prophage 66
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	695851	701897	3637729		Tupanvirus(50.0%)	6	NA	NA
WP_008359888.1|695851_697327_+	catalase	NA	A0A2K9L572	Tupanvirus	50.2	5.5e-122
WP_008359890.1|697372_697693_-	YqzG/YhdC family protein	NA	NA	NA	NA	NA
WP_008359893.1|697885_698134_+	YhdB family protein	NA	NA	NA	NA	NA
WP_071167845.1|698203_698854_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_008359898.1|698850_699996_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_071167846.1|700151_701897_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	51.9	1.3e-165
>prophage 67
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	705368	706184	3637729		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_008361510.1|705368_706184_-	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	35.1	6.7e-29
>prophage 68
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	713930	719813	3637729		Acanthocystis_turfacea_Chlorella_virus(50.0%)	5	NA	NA
WP_071167849.1|713930_714596_-	HAD family hydrolase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	30.3	5.0e-14
WP_008361526.1|714902_715244_-	DUF5365 family protein	NA	NA	NA	NA	NA
WP_071167850.1|715353_716256_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_071167851.1|716287_716857_-	class D sortase	NA	NA	NA	NA	NA
WP_071167852.1|716906_719813_-	5'-nucleotidase C-terminal domain-containing protein	NA	V5UN65	Mycobacterium_phage	33.3	1.6e-08
>prophage 69
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	726711	728215	3637729		Bacillus_phage(50.0%)	2	NA	NA
WP_071167856.1|726711_727803_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.9	6.1e-17
WP_003212277.1|728014_728215_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	60.6	2.1e-16
>prophage 70
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	731892	735092	3637729		Bacillus_phage(50.0%)	2	NA	NA
WP_008358696.1|731892_733056_-	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	42.8	8.4e-25
WP_071167857.1|733196_735092_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.1	4.8e-102
>prophage 71
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	742535	752503	3637729		Bacillus_virus(40.0%)	10	NA	NA
WP_008358675.1|742535_743282_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.3	8.4e-10
WP_008358673.1|743397_743610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008358669.1|744153_745296_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_071167862.1|745310_746144_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071167863.1|746143_747133_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	G3M9Z0	Bacillus_virus	34.7	1.6e-08
WP_071167864.1|747147_747915_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	1.1e-28
WP_034739115.1|748078_748234_-	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_071167865.1|748498_749791_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.7	1.0e-18
WP_071167866.1|749836_750403_-	signal peptidase I	NA	NA	NA	NA	NA
WP_034739123.1|750559_752503_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	42.9	3.5e-124
>prophage 72
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	773713	777537	3637729		Planktothrix_phage(66.67%)	3	NA	NA
WP_071167871.1|773713_774691_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	2.0e-19
WP_071167872.1|774659_775682_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.7e-16
WP_008361055.1|775794_777537_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	6.0e-59
>prophage 73
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	789857	790841	3637729		Salmonella_phage(100.0%)	1	NA	NA
WP_008360610.1|789857_790841_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	40.3	9.8e-59
>prophage 74
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	804034	809864	3637729		uncultured_virus(33.33%)	5	NA	NA
WP_071167887.1|804034_804361_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	39.6	4.3e-11
WP_071167888.1|804378_806094_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	5.0e-58
WP_071167889.1|806106_807030_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071167890.1|807140_808745_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_008359275.1|808823_809864_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	25.8	1.3e-13
>prophage 75
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	826898	828296	3637729		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_071169182.1|826898_828296_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	39.2	4.2e-87
>prophage 76
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	840708	841862	3637729	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_145939387.1|840708_841862_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	3.2e-40
>prophage 77
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	856274	862246	3637729		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_008357689.1|856274_857999_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.5	6.7e-10
WP_008357687.1|858030_859689_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_071167912.1|860266_862246_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	42.1	2.0e-127
>prophage 78
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	866070	866208	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_008357676.1|866070_866208_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	61.0	1.3e-06
>prophage 79
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	875765	888501	3637729		Cedratvirus(20.0%)	10	NA	NA
WP_083381080.1|875765_878375_-	hypothetical protein	NA	A0A285PXU9	Cedratvirus	62.5	2.7e-47
WP_008355895.1|878500_878713_-	bifunctional 5-amino-6-(5-phosphoribosylamino)uracil reductase/diaminohydroxyphosphoribosylaminopyrimidine deaminase	NA	NA	NA	NA	NA
WP_034738326.1|878794_879142_-	general stress protein	NA	NA	NA	NA	NA
WP_034738324.1|879363_879741_+	YfmB family protein	NA	NA	NA	NA	NA
WP_008355888.1|879863_880868_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071167917.1|881035_882178_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.7	1.0e-46
WP_071167918.1|882330_883884_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	8.5e-57
WP_008355881.1|884319_885216_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_071167919.1|885407_887294_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	26.0	3.5e-44
WP_071167920.1|887427_888501_+	glycosyltransferase family 2 protein	NA	A0A1V0SAJ8	Catovirus	24.9	3.1e-13
>prophage 80
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	899966	900938	3637729		Tupanvirus(100.0%)	1	NA	NA
WP_008355855.1|899966_900938_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9L0I7	Tupanvirus	27.2	2.0e-27
>prophage 81
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	912620	922033	3637729	transposase,tRNA	Streptococcus_phage(25.0%)	6	NA	NA
WP_071167934.1|912620_913973_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.4	1.5e-89
WP_008355826.1|914101_915076_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_071169184.1|915330_916707_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.9	8.2e-120
WP_007496845.1|916768_917677_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.4	1.1e-22
WP_071167935.1|917858_918812_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_071167936.1|918841_922033_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.1	2.2e-67
>prophage 82
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	928472	935869	3637729		Bacillus_virus(33.33%)	5	NA	NA
WP_174549249.1|928472_929171_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.9	2.5e-16
WP_071167938.1|929215_930223_-	phosphotransferase	NA	NA	NA	NA	NA
WP_008355806.1|930392_931580_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_008355804.1|931595_933602_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.4	1.3e-129
WP_071167939.1|933646_935869_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.4	1.2e-128
>prophage 83
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	944833	946198	3637729		Klosneuvirus(100.0%)	1	NA	NA
WP_071167945.1|944833_946198_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.8	1.2e-22
>prophage 84
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	951340	962856	3637729		Synechococcus_phage(44.44%)	11	NA	NA
WP_071167950.1|951340_952879_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	1.9e-77
WP_008355770.1|952894_953464_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.0	5.0e-31
WP_071167951.1|953460_954501_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	43.4	9.7e-65
WP_071167952.1|954597_956028_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	7.6e-52
WP_071167953.1|956003_958235_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	6.5e-159
WP_008355760.1|958218_958902_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003214349.1|958898_959153_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	34.6	1.6e-05
WP_008355756.1|959145_959868_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	2.4e-46
WP_008355754.1|959940_961236_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.9	2.9e-18
WP_008355752.1|961232_962375_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_071167954.1|962367_962856_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.4	3.4e-20
>prophage 85
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	974421	1040340	3637729	plate,capsid,protease,integrase,terminase,tail,holin,portal,head	uncultured_Caudovirales_phage(76.36%)	80	997292:997311	1038365:1038384
WP_071167962.1|974421_975153_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071167963.1|975243_977610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071167965.1|978463_980125_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_071167966.1|980125_981235_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071167967.1|981216_981693_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_008355721.1|981776_983318_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.9	3.4e-21
WP_071167968.1|983505_985704_-	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_071167969.1|985713_986904_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_071167970.1|986900_987863_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_008355713.1|987969_988869_-	cation transporter	NA	NA	NA	NA	NA
WP_008355711.1|989352_990741_+	GABA permease	NA	NA	NA	NA	NA
WP_071167971.1|990838_992371_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_008355707.1|992653_993028_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_071167972.1|993244_994294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008344356.1|994367_994736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071167973.1|994945_995620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071167974.1|995743_996211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008355699.1|996242_996680_-	hypothetical protein	NA	NA	NA	NA	NA
997292:997311	attL	TTACATCATTCCACCCATGC	NA	NA	NA	NA
WP_071167975.1|997568_997934_-	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_071167976.1|997967_999395_-	type II toxin-antitoxin system RnlA family toxin	NA	A0A1X9I9U6	Staphylococcus_phage	36.9	2.3e-16
WP_071167977.1|999531_999789_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	91.2	4.9e-34
WP_071167978.1|1000211_1001033_-	M15 family metallopeptidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	90.8	4.1e-119
WP_046526956.1|1001091_1001355_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	97.7	6.1e-40
WP_071167979.1|1001374_1001653_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	97.8	1.2e-41
WP_083381083.1|1001717_1001864_-	XkdX family protein	NA	NA	NA	NA	NA
WP_071167980.1|1001864_1002218_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	43.6	4.0e-10
WP_071167981.1|1003275_1003905_-	DUF2612 domain-containing protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	97.6	5.1e-109
WP_071167982.1|1003901_1005077_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	98.2	4.3e-210
WP_071167983.1|1005066_1005429_-	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	83.3	1.9e-44
WP_008348688.1|1005425_1005770_-	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	98.2	1.5e-59
WP_071167984.1|1005769_1006765_-	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	98.2	3.2e-158
WP_071167985.1|1006751_1007102_-	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	98.3	2.0e-59
WP_071167986.1|1007112_1007658_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	91.2	1.1e-86
WP_145939427.1|1007657_1010324_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	97.0	0.0e+00
WP_145939390.1|1011432_1011735_-	hypothetical protein	NA	A0A2H4J4Q2	uncultured_Caudovirales_phage	95.0	1.8e-48
WP_071167989.1|1011826_1012222_-	DUF3277 family protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	99.2	3.0e-67
WP_071167990.1|1012236_1013271_-	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	99.1	2.5e-190
WP_081378175.1|1013275_1013755_-	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	96.9	5.6e-84
WP_083381084.1|1013747_1014098_-	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	88.8	7.5e-54
WP_071167992.1|1014097_1014598_-	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	97.6	3.3e-87
WP_071167993.1|1014602_1014938_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J6J9	uncultured_Caudovirales_phage	97.3	4.7e-53
WP_071167994.1|1014937_1015795_-	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	95.4	5.8e-148
WP_167358856.1|1015806_1015953_-	hypothetical protein	NA	A0A2H4JA81	uncultured_Caudovirales_phage	91.5	4.9e-15
WP_071167995.1|1015952_1016888_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	90.4	1.6e-159
WP_071167996.1|1016899_1017478_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	88.5	2.5e-86
WP_071167997.1|1017511_1018957_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	95.4	3.7e-264
WP_071167998.1|1018961_1020164_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	98.8	2.2e-233
WP_083381086.1|1020150_1020906_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	87.5	9.4e-118
WP_071167999.1|1020949_1021177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145939391.1|1021307_1021487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168001.1|1021560_1022061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168002.1|1022216_1022681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168003.1|1023337_1023700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168004.1|1023696_1024107_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	42.6	1.2e-13
WP_071168005.1|1024346_1024580_-	hypothetical protein	NA	R4JMN7	Bacillus_phage	54.5	5.1e-14
WP_083381157.1|1024748_1024952_-	hypothetical protein	NA	O64167	Bacillus_phage	53.7	5.2e-15
WP_071168006.1|1025173_1025446_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	63.3	1.9e-28
WP_071168007.1|1025426_1026323_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	74.2	2.0e-127
WP_071168008.1|1026373_1026631_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	92.6	1.8e-33
WP_071168009.1|1026655_1026859_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	86.2	9.5e-25
WP_017360274.1|1026932_1027097_-	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	73.3	4.6e-06
WP_052320733.1|1027210_1027666_-	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	92.7	2.1e-72
WP_052320732.1|1027655_1027958_-	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	81.0	1.4e-40
WP_052006302.1|1028354_1029284_-	ATP-binding protein	NA	Q0H276	Geobacillus_phage	41.9	7.2e-43
WP_071168010.1|1029186_1029849_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	69.8	1.7e-70
WP_071168011.1|1030010_1030850_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	96.1	4.6e-150
WP_071168012.1|1030849_1031800_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	97.5	5.8e-173
WP_008348780.1|1031802_1031982_-	hypothetical protein	NA	A0A2H4JCC7	uncultured_Caudovirales_phage	93.2	2.4e-24
WP_071169190.1|1032185_1032464_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	78.3	3.4e-33
WP_071168013.1|1032466_1033036_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	80.4	1.9e-83
WP_045035258.1|1033102_1033792_-	ORF6C domain-containing protein	NA	A0A1B1IMQ3	Lactococcus_phage	44.7	2.5e-32
WP_071168014.1|1033788_1034097_-	hypothetical protein	NA	S6C476	Thermus_phage	56.1	1.8e-14
WP_071168015.1|1034164_1034497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168016.1|1034645_1034870_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	97.3	1.2e-33
WP_071168017.1|1035032_1035410_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	90.2	1.3e-51
WP_071168018.1|1035579_1036512_+	hypothetical protein	NA	A0A2H4JCX8	uncultured_Caudovirales_phage	80.3	1.6e-114
WP_071168019.1|1036577_1037081_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	97.0	5.5e-90
WP_071168020.1|1037093_1038281_+|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	50.4	4.3e-101
WP_008355697.1|1038364_1039999_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.2	3.4e-157
1038365:1038384	attR	TTACATCATTCCACCCATGC	NA	NA	NA	NA
WP_003214120.1|1040055_1040340_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	50.5	3.7e-19
>prophage 86
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1044489	1047712	3637729	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_071168024.1|1044489_1046412_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	4.7e-57
WP_008355682.1|1046683_1047712_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.0	1.6e-67
>prophage 87
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1060924	1061587	3637729		Mycobacterium_phage(100.0%)	1	NA	NA
WP_008359803.1|1060924_1061587_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	40.0	6.0e-36
>prophage 88
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1079779	1079983	3637729		Lactococcus_phage(100.0%)	1	NA	NA
WP_003214229.1|1079779_1079983_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	75.4	1.3e-21
>prophage 89
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1084198	1085578	3637729		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_008359582.1|1084198_1085578_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.9	4.2e-47
>prophage 90
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1089012	1089480	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_008359575.1|1089012_1089480_-	SprT family protein	NA	U5J9G1	Bacillus_phage	26.8	7.8e-06
>prophage 91
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1092568	1093357	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_008359569.1|1092568_1093357_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	33.6	3.7e-24
>prophage 92
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1096939	1099051	3637729		Lactobacillus_phage(50.0%)	3	NA	NA
WP_003214169.1|1096939_1097290_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A1S5RCS0	Lactobacillus_phage	39.5	3.4e-14
WP_008359553.1|1097294_1097576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168044.1|1097872_1099051_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.7	3.2e-32
>prophage 93
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1103577	1105119	3637729		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_082194753.1|1103577_1105119_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.0	5.1e-62
>prophage 94
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1109131	1112171	3637729		Staphylococcus_phage(100.0%)	5	NA	NA
WP_008359532.1|1109131_1109452_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	27.6	3.5e-05
WP_008359530.1|1109799_1109949_+	Fur-regulated basic protein FbpB	NA	NA	NA	NA	NA
WP_008359528.1|1110046_1110382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008359526.1|1110499_1111267_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071168050.1|1111244_1112171_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.7	5.3e-38
>prophage 95
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1126116	1129632	3637729		Bacillus_phage(50.0%)	2	NA	NA
WP_071168055.1|1126116_1127676_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	40.2	2.8e-39
WP_071168056.1|1127910_1129632_-	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	26.7	1.4e-36
>prophage 96
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1139015	1141202	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_071168063.1|1139015_1141202_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.5	8.7e-39
>prophage 97
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1146587	1147457	3637729		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_071168066.1|1146587_1147457_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	1.3e-57
>prophage 98
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1174049	1175366	3637729		Klosneuvirus(100.0%)	1	NA	NA
WP_008357047.1|1174049_1175366_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.8	2.6e-22
>prophage 99
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1184009	1186122	3637729		Bacillus_phage(100.0%)	2	NA	NA
WP_008357028.1|1184009_1185440_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	35.5	7.4e-39
WP_008357026.1|1185429_1186122_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.9	7.7e-42
>prophage 100
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1191115	1191862	3637729		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_071168086.1|1191115_1191862_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.5	4.7e-13
>prophage 101
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1195435	1198976	3637729		Bacillus_phage(50.0%)	2	NA	NA
WP_083381090.1|1195435_1197220_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	37.1	2.9e-109
WP_071168089.1|1197482_1198976_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	41.8	1.0e-83
>prophage 102
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1209776	1210520	3637729		Planktothrix_phage(100.0%)	1	NA	NA
WP_071168094.1|1209776_1210520_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-32
>prophage 103
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1221421	1271025	3637729		Tupanvirus(71.43%)	12	NA	NA
WP_071168101.1|1221421_1222111_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	1.5e-21
WP_071168102.1|1222067_1222601_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_071168103.1|1222620_1223160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168104.1|1223187_1223928_-	thioesterase	NA	NA	NA	NA	NA
WP_071168105.1|1223934_1232133_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.4	4.3e-107
WP_071168106.1|1232147_1242284_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.8	1.6e-74
WP_008357659.1|1242346_1246180_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.3	9.1e-76
WP_071168107.1|1246225_1256923_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.3	1.8e-158
WP_071168108.1|1256942_1267661_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.9	1.1e-155
WP_071168109.1|1268268_1269072_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_008359509.1|1269064_1269934_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_008359507.1|1269933_1271025_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.0	1.8e-29
>prophage 104
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1276527	1280116	3637729		Bacillus_phage(66.67%)	4	NA	NA
WP_071168113.1|1276527_1276956_+	sporulation protein	NA	F8WPS9	Bacillus_phage	55.6	2.3e-36
WP_071168114.1|1277082_1278780_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.5	1.0e-15
WP_008359494.1|1278918_1279308_+	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_008359492.1|1279309_1280116_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	54.7	2.9e-80
>prophage 105
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1283608	1284940	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_167358857.1|1283608_1284940_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	60.6	9.6e-142
>prophage 106
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1289039	1293428	3637729		Pseudomonas_phage(33.33%)	5	NA	NA
WP_083381095.1|1289039_1289843_-	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	44.2	6.0e-46
WP_008359470.1|1289903_1290218_+	hypothetical protein	NA	A0A0M4R382	Bacillus_phage	54.0	2.7e-18
WP_071168120.1|1290256_1291213_-	acetylxylan esterase	NA	NA	NA	NA	NA
WP_008359465.1|1291480_1292266_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_008361558.1|1292510_1293428_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.7	5.3e-14
>prophage 107
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1305907	1306729	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_071168125.1|1305907_1306729_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.8	1.9e-92
>prophage 108
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1322900	1325656	3637729		Bacillus_virus(50.0%)	2	NA	NA
WP_071168136.1|1322900_1324163_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.5	1.3e-34
WP_008360346.1|1324561_1325656_-	toxic anion resistance protein	NA	A0A1L2CV51	Pectobacterium_phage	25.2	2.4e-21
>prophage 109
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1329271	1334625	3637729		Caulobacter_phage(60.0%)	6	NA	NA
WP_071168140.1|1329271_1330603_-	phosphoribosyltransferase family protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	9.1e-07
WP_071168141.1|1330586_1331780_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_071168142.1|1331880_1332660_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	65.8	6.6e-82
WP_071168143.1|1332800_1333379_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.9	2.4e-28
WP_008360338.1|1333419_1334001_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.4	8.2e-29
WP_008360337.1|1334022_1334625_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.6	1.1e-23
>prophage 110
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1338205	1350868	3637729	transposase	Staphylococcus_phage(60.0%)	12	NA	NA
WP_008360333.1|1338205_1338634_-	cell wall hydrolase	NA	A0A172JHR8	Bacillus_phage	37.5	9.4e-06
WP_071168146.1|1339173_1340235_+	DUF5105 domain-containing protein	NA	NA	NA	NA	NA
WP_145939396.1|1340345_1341453_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	62.7	1.4e-32
WP_071168149.1|1342012_1342390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168150.1|1342406_1342958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145939397.1|1343088_1344250_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.0	1.9e-37
WP_071168153.1|1344577_1345471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168155.1|1345898_1347080_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_008358249.1|1347079_1347820_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.1	1.8e-25
WP_071168156.1|1347980_1348682_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071168157.1|1348693_1349659_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_145939398.1|1349714_1350868_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	3.2e-40
>prophage 111
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1363037	1364546	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_008358232.1|1363037_1364546_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.2	2.4e-40
>prophage 112
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1369083	1376269	3637729		Bacillus_phage(33.33%)	9	NA	NA
WP_071168165.1|1369083_1370715_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	46.6	4.3e-43
WP_008358226.1|1370751_1371288_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_008358225.1|1371402_1371609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168166.1|1371666_1372203_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071168167.1|1372415_1373633_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.9	7.5e-32
WP_167358858.1|1373662_1373824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168168.1|1373820_1374408_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_008358220.1|1374400_1374718_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082194740.1|1375411_1376269_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.0	1.2e-44
>prophage 113
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1379639	1382306	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_071168170.1|1379639_1382306_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.6	2.4e-30
>prophage 114
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1392051	1394683	3637729	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_145939399.1|1392051_1393160_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.0	1.2e-33
WP_071168180.1|1393261_1394683_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	31.8	1.4e-50
>prophage 115
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1401210	1402041	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_174549225.1|1401210_1402041_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	49.3	1.3e-72
>prophage 116
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1406646	1408080	3637729	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_071168192.1|1406646_1408080_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	41.5	1.9e-103
>prophage 117
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1419446	1420328	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071168205.1|1419446_1420328_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	39.5	8.9e-43
>prophage 118
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1424007	1434186	3637729		Tupanvirus(33.33%)	9	NA	NA
WP_071169203.1|1424007_1427013_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	31.6	6.5e-69
WP_034739668.1|1427090_1427276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168207.1|1427284_1427704_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_071168208.1|1427703_1428219_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_071168209.1|1428237_1429659_-	sporulation killing factor system integral membrane protein	NA	NA	NA	NA	NA
WP_071168210.1|1429651_1430374_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	3.4e-16
WP_071168211.1|1430596_1431007_-	RidA family protein	NA	NA	NA	NA	NA
WP_008360580.1|1431976_1432321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008360582.1|1432383_1434186_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	40.4	1.8e-103
>prophage 119
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1439946	1440858	3637729		Klosneuvirus(100.0%)	1	NA	NA
WP_008360591.1|1439946_1440858_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.7	1.9e-24
>prophage 120
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1452372	1455458	3637729		Diadromus_pulchellus_ascovirus(50.0%)	3	NA	NA
WP_008361401.1|1452372_1453128_-	glucose 1-dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.6	1.1e-17
WP_071168219.1|1453139_1454150_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_071168220.1|1454204_1455458_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	30.6	2.3e-44
>prophage 121
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1465217	1465931	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_008356568.1|1465217_1465931_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	28.3	1.7e-12
>prophage 122
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1470580	1478126	3637729	transposase,tRNA	Enterobacteria_phage(25.0%)	8	NA	NA
WP_071168226.1|1470580_1472161_-	AAA family ATPase	NA	Q2P9X8	Enterobacteria_phage	24.6	3.1e-14
WP_145939400.1|1472647_1473800_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	64.0	5.4e-40
WP_007496354.1|1473874_1474267_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003217042.1|1474287_1474725_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_008356552.1|1474889_1475633_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_071168228.1|1475644_1476442_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_071168229.1|1476438_1477308_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.0	6.1e-12
WP_008356549.1|1477283_1478126_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.0e-16
>prophage 123
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1495782	1506678	3637729		Streptococcus_phage(33.33%)	6	NA	NA
WP_008356523.1|1495782_1497861_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.9	6.1e-66
WP_008356520.1|1497915_1498386_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_008356518.1|1498507_1498927_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_008356515.1|1499040_1499289_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_008356513.1|1499435_1503035_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.7	4.9e-63
WP_008356511.1|1503096_1506678_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.6	2.3e-49
>prophage 124
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1510198	1510732	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_034323246.1|1510198_1510732_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	4.1e-11
>prophage 125
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1513743	1515144	3637729	tRNA	Catovirus(100.0%)	1	NA	NA
WP_071168234.1|1513743_1515144_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.0	1.1e-60
>prophage 126
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1522645	1525081	3637729	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_008356478.1|1522645_1525081_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.3	5.7e-132
>prophage 127
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1539264	1554492	3637729	protease,tRNA	Tupanvirus(12.5%)	16	NA	NA
WP_008357370.1|1539264_1540764_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.4	4.2e-93
WP_008357372.1|1540852_1541854_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_008357374.1|1541846_1542080_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	40.0	4.3e-05
WP_008357376.1|1542031_1542535_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_034738726.1|1542531_1542894_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_071168238.1|1542886_1543744_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_008357383.1|1543753_1544602_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_008357385.1|1544598_1545192_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.5	3.2e-65
WP_008357387.1|1545205_1546627_-	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	31.4	4.6e-33
WP_008357389.1|1546751_1547675_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	64.9	1.2e-106
WP_071168239.1|1547752_1548661_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_008357393.1|1548707_1549583_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_008357395.1|1549597_1550374_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_071168240.1|1550536_1552438_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.1	1.3e-112
WP_008357399.1|1552533_1553073_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.1	2.0e-05
WP_083381101.1|1553088_1554492_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	23.4	1.1e-13
>prophage 128
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1564857	1565394	3637729		Paenibacillus_phage(100.0%)	1	NA	NA
WP_008357424.1|1564857_1565394_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 129
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1570893	1573240	3637729		Hokovirus(50.0%)	2	NA	NA
WP_008357434.1|1570893_1571847_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.8	2.4e-46
WP_071168249.1|1571869_1573240_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	36.4	1.6e-30
>prophage 130
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1579711	1590502	3637729	tRNA	Streptococcus_phage(42.86%)	13	NA	NA
WP_008357455.1|1579711_1580914_-	G5 and 3D domain-containing protein	NA	A0A217ER34	Bacillus_phage	59.1	2.6e-29
WP_071168251.1|1581158_1581926_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_008357460.1|1582007_1584008_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.4	2.5e-101
WP_087975202.1|1584526_1584817_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	71.4	1.0e-16
WP_071168252.1|1584861_1585743_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	1.3e-65
WP_008357464.1|1585717_1586017_-	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	40.2	4.2e-05
WP_071168253.1|1586003_1586747_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_008357468.1|1586802_1587156_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_007496230.1|1587170_1587998_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_008357472.1|1588000_1588990_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.5	6.1e-32
WP_008357474.1|1589001_1589442_-	YaaR family protein	NA	NA	NA	NA	NA
WP_071169204.1|1589454_1589784_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_008357479.1|1589863_1590502_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.2	5.1e-56
>prophage 131
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1601047	1608921	3637729	transposase	Clostridium_phage(20.0%)	7	NA	NA
WP_008360290.1|1601047_1602760_-	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.6	4.0e-55
WP_071168256.1|1603431_1603908_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_071168257.1|1603987_1604542_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_071168258.1|1604587_1605889_+	glycoside hydrolase family 18 protein	NA	A0A2P1CIG4	Microbacterium_phage	34.8	1.4e-07
WP_008360301.1|1605968_1606592_+	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	29.3	2.0e-12
WP_008360303.1|1606588_1607248_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	1.4e-21
WP_145939401.1|1607569_1608921_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	73.6	1.5e-110
>prophage 132
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1616287	1621211	3637729	tRNA	Chrysochromulina_ericina_virus(25.0%)	5	NA	NA
WP_071168261.1|1616287_1616989_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.2	3.0e-09
WP_071168262.1|1616978_1617812_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_071168263.1|1617826_1618396_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.4	4.1e-41
WP_071168264.1|1619004_1619835_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.1	3.5e-09
WP_008360325.1|1619936_1621211_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.3e-95
>prophage 133
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1627570	1629037	3637729		Klosneuvirus(100.0%)	1	NA	NA
WP_008362147.1|1627570_1629037_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.5	4.2e-98
>prophage 134
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1635560	1643166	3637729		Bacillus_virus(66.67%)	6	NA	NA
WP_071168271.1|1635560_1638065_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.6	7.7e-116
WP_071168272.1|1638297_1640214_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.0	2.4e-154
WP_008360920.1|1640271_1640517_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_071168273.1|1640534_1641647_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_008360916.1|1641663_1641879_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_008360914.1|1642029_1643166_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.6	2.4e-16
>prophage 135
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1651981	1656322	3637729	protease	Leptospira_phage(25.0%)	5	NA	NA
WP_008360893.1|1651981_1652857_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.2	5.0e-14
WP_008360891.1|1652986_1653820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008360890.1|1654061_1654823_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	31.0	1.0e-26
WP_008360886.1|1654815_1655670_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	40.1	1.7e-22
WP_008359093.1|1655695_1656322_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	35.8	7.0e-18
>prophage 136
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1661472	1666442	3637729		Bacillus_phage(50.0%)	6	NA	NA
WP_008359104.1|1661472_1662015_+	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	65.2	1.7e-49
WP_008359105.1|1662055_1662295_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_145939402.1|1662562_1663513_+	VOC family protein	NA	NA	NA	NA	NA
WP_071168277.1|1663509_1664121_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_051009120.1|1664180_1664804_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_008359115.1|1664852_1666442_-	catalase	NA	A0A2K9L572	Tupanvirus	45.6	3.7e-100
>prophage 137
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1682206	1685941	3637729		Streptococcus_phage(50.0%)	3	NA	NA
WP_003214779.1|1682206_1683571_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.4	1.4e-127
WP_071168285.1|1683701_1684115_+	VOC family protein	NA	NA	NA	NA	NA
WP_071168286.1|1684645_1685941_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.6	1.9e-70
>prophage 138
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1689089	1695932	3637729	protease	Bacillus_phage(50.0%)	6	NA	NA
WP_008360147.1|1689089_1689797_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.4	1.1e-46
WP_071168289.1|1689804_1691643_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.9	8.9e-37
WP_008360143.1|1691632_1693012_+	regulatory protein	NA	NA	NA	NA	NA
WP_008360141.1|1692998_1693862_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_008360139.1|1693868_1694663_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.9	1.4e-42
WP_071168290.1|1694744_1695932_+|protease	serine protease	protease	W5SAB9	Pithovirus	34.9	4.1e-11
>prophage 139
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1700103	1701819	3637729		Planktothrix_phage(100.0%)	1	NA	NA
WP_071168295.1|1700103_1701819_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	4.6e-19
>prophage 140
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1734103	1735282	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_071168316.1|1734103_1735282_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	42.1	2.1e-76
>prophage 141
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1741333	1744163	3637729		Streptococcus_phage(50.0%)	3	NA	NA
WP_071168320.1|1741333_1742473_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.1	1.3e-49
WP_071168321.1|1742566_1742905_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_008359913.1|1743233_1744163_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.5	1.4e-41
>prophage 142
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1754407	1756474	3637729		Enterobacteria_phage(50.0%)	2	NA	NA
WP_071168327.1|1754407_1755403_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	1.3e-10
WP_071168328.1|1755574_1756474_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	39.8	4.7e-07
>prophage 143
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1778116	1778965	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_071168338.1|1778116_1778965_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	36.3	1.5e-31
>prophage 144
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1784430	1787983	3637729		Geobacillus_virus(50.0%)	5	NA	NA
WP_008355638.1|1784430_1785732_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	59.8	5.9e-136
WP_071168340.1|1785783_1786341_-	VanZ family protein	NA	NA	NA	NA	NA
WP_071168341.1|1786368_1786659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051009096.1|1786887_1787331_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008355631.1|1787344_1787983_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	51.0	2.4e-05
>prophage 145
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1795583	1797182	3637729		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_071168347.1|1795583_1797182_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	5.6e-19
>prophage 146
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1808203	1811246	3637729		Indivirus(50.0%)	3	NA	NA
WP_071168352.1|1808203_1808893_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.2	1.7e-12
WP_071168353.1|1808889_1810005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168354.1|1810124_1811246_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.1	1.2e-92
>prophage 147
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1814326	1815220	3637729		Escherichia_phage(100.0%)	1	NA	NA
WP_071168356.1|1814326_1815220_-	2-hydroxy-3-oxopropionate reductase	NA	A0A077SLF7	Escherichia_phage	33.8	1.5e-37
>prophage 148
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1822598	1822946	3637729		Paenibacillus_phage(100.0%)	1	NA	NA
WP_008355544.1|1822598_1822946_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SDF8	Paenibacillus_phage	33.3	3.3e-09
>prophage 149
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1837343	1839183	3637729		Staphylococcus_phage(100.0%)	2	NA	NA
WP_071168364.1|1837343_1838435_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.9	9.6e-55
WP_071168365.1|1838421_1839183_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	43.5	1.7e-29
>prophage 150
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1845843	1857772	3637729		Bacillus_phage(60.0%)	10	NA	NA
WP_071168369.1|1845843_1846614_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	2.9e-13
WP_008355495.1|1846640_1847393_+	class B sortase	NA	NA	NA	NA	NA
WP_071168370.1|1847411_1848350_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071168371.1|1848346_1849360_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_071168372.1|1849361_1850483_+	heme oxygenase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	5.7e-10
WP_071168373.1|1850808_1852224_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_008355485.1|1852210_1853227_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071168374.1|1853226_1854963_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.1	1.3e-24
WP_071168375.1|1854952_1856695_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.5	5.3e-23
WP_034738258.1|1856740_1857772_-	pectate lyase	NA	A0A140XB77	Dickeya_phage	33.3	1.4e-10
>prophage 151
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1871157	1885322	3637729		Bacillus_phage(50.0%)	14	NA	NA
WP_071168380.1|1871157_1872609_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	3.1e-24
WP_174549252.1|1872605_1873289_-	response regulator	NA	W8CYM9	Bacillus_phage	36.4	4.6e-39
WP_071168381.1|1873569_1874478_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_008355443.1|1874984_1876103_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008355441.1|1876175_1877672_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.3e-14
WP_008355439.1|1877668_1878682_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008355437.1|1878776_1879409_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_167358859.1|1879460_1879610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168382.1|1879629_1880715_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	29.2	4.4e-36
WP_008355433.1|1881228_1881993_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008355431.1|1882063_1882708_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_008355429.1|1882710_1883433_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	1.3e-31
WP_008355427.1|1883638_1884022_-	VOC family protein	NA	NA	NA	NA	NA
WP_071168383.1|1884140_1885322_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.0	9.6e-77
>prophage 152
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1897449	1898442	3637729		Tupanvirus(100.0%)	1	NA	NA
WP_008359625.1|1897449_1898442_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	41.5	1.1e-57
>prophage 153
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1909806	1912233	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_071168390.1|1909806_1912233_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	38.6	1.1e-21
>prophage 154
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1920929	1921610	3637729		Pandoravirus(100.0%)	1	NA	NA
WP_008360976.1|1920929_1921610_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	56.1	8.3e-49
>prophage 155
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1926078	1965574	3637729	protease,transposase,coat,bacteriocin	Escherichia_phage(25.0%)	48	NA	NA
WP_008360964.1|1926078_1926609_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_008360962.1|1926760_1927435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169213.1|1927610_1928381_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_071168397.1|1928387_1929800_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_008360957.1|1929821_1931000_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_071168398.1|1930996_1931872_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071168399.1|1931873_1932998_+	N-acetylneuraminate synthase family protein	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	29.7	4.5e-23
WP_071168400.1|1932987_1933728_+	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_071168401.1|1933724_1934753_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_071168402.1|1934755_1935496_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	39.6	4.7e-45
WP_071168403.1|1935492_1936458_+	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	45.9	1.4e-78
WP_071168404.1|1936461_1937316_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	9.5e-34
WP_008360938.1|1937308_1937764_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_071168405.1|1937822_1939043_-	MFS transporter	NA	NA	NA	NA	NA
WP_071168406.1|1939188_1939668_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_008362086.1|1940359_1941130_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_008362084.1|1941370_1942342_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_034740044.1|1942523_1942925_+	DUF5082 family protein	NA	NA	NA	NA	NA
WP_071168407.1|1942926_1943205_+	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_083381109.1|1943216_1944752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071168408.1|1944763_1945159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048002985.1|1945171_1945498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071169214.1|1945571_1945934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168409.1|1945962_1946235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168410.1|1946299_1946575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083381110.1|1946608_1947004_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_071168411.1|1947220_1948066_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_071168412.1|1948108_1948594_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_008355090.1|1948635_1948869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168413.1|1948903_1949704_-	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	48.0	6.0e-06
WP_003215259.1|1949946_1950168_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_008355085.1|1950337_1951639_+	HD domain-containing protein	NA	A0A1V0SGM3	Hokovirus	30.3	1.6e-24
WP_008355083.1|1951669_1952170_+	YwgA family protein	NA	NA	NA	NA	NA
WP_071168414.1|1952262_1953006_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	8.3e-34
WP_071168415.1|1953002_1953713_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_071168416.1|1953729_1954572_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071168417.1|1954589_1955354_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_008355075.1|1955367_1955931_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008355073.1|1955966_1956221_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_008355070.1|1956220_1957246_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008355067.1|1957229_1957781_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_008355065.1|1957931_1958813_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008355062.1|1958855_1960184_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008355060.1|1960558_1961371_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_008355058.1|1961669_1961987_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_008355057.1|1962067_1963807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168418.1|1963832_1964324_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_008355051.1|1964917_1965574_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	33.2	1.5e-15
>prophage 156
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1979303	1983849	3637729		Bacillus_phage(100.0%)	5	NA	NA
WP_008355024.1|1979303_1981019_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	2.7e-56
WP_008355022.1|1981144_1981387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168424.1|1981476_1982475_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_008355018.1|1982558_1982813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008355016.1|1982886_1983849_-	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	36.5	2.2e-42
>prophage 157
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	1993512	1998030	3637729		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_008354987.1|1993512_1995120_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	7.5e-149
WP_008354985.1|1995161_1995692_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_003214681.1|1995872_1996247_+	response regulator	NA	W8CYM9	Bacillus_phage	36.5	1.3e-11
WP_008354982.1|1996422_1997280_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_071168431.1|1997391_1998030_+	fructose-6-phosphate aldolase	NA	A0A1D7SNI1	Cyanophage	48.6	9.0e-45
>prophage 158
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2002636	2003239	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_008354973.1|2002636_2003239_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	49.2	8.7e-42
>prophage 159
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2007102	2015898	3637729		Pseudomonas_phage(33.33%)	11	NA	NA
WP_008354965.1|2007102_2008170_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	5.2e-05
WP_071168435.1|2008159_2009047_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_008354961.1|2009184_2009664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008354958.1|2009813_2010470_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_071168436.1|2010533_2010977_+	general stress acyl- n-acyltransferase	NA	NA	NA	NA	NA
WP_083381112.1|2011138_2012191_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	42.6	4.3e-60
WP_008354952.1|2012251_2012806_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_071168438.1|2012869_2013328_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_008354947.1|2013470_2013920_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_008354944.1|2013932_2014472_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_008354942.1|2014650_2015898_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.2	1.5e-99
>prophage 160
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2027462	2028488	3637729		Pseudomonas_phage(100.0%)	1	NA	NA
WP_071168441.1|2027462_2028488_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	41.3	2.3e-42
>prophage 161
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2040081	2047282	3637729		Indivirus(33.33%)	8	NA	NA
WP_071168447.1|2040081_2041881_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.3	6.1e-14
WP_008354886.1|2041882_2042452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168448.1|2042448_2042979_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_034738194.1|2043165_2043663_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_008354880.1|2043790_2044687_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	41.4	1.6e-07
WP_007497589.1|2044773_2045121_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_008354877.1|2045139_2046348_-	ammonium transporter	NA	NA	NA	NA	NA
WP_071168449.1|2046541_2047282_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	1.1e-33
>prophage 162
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2053175	2053454	3637729		Clostridium_phage(100.0%)	1	NA	NA
WP_008343327.1|2053175_2053454_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.3e-15
>prophage 163
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2061894	2079028	3637729	transposase	Choristoneura_murinana_nucleopolyhedrovirus(20.0%)	15	NA	NA
WP_071168457.1|2061894_2064672_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.2	2.2e-39
WP_071168458.1|2064658_2066266_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_003214884.1|2066452_2066596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168459.1|2066711_2068031_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.5	2.5e-89
WP_034738190.1|2068070_2068604_-	chromate transporter	NA	NA	NA	NA	NA
WP_051009093.1|2068603_2069155_-	chromate transporter	NA	NA	NA	NA	NA
WP_071169219.1|2069201_2069678_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071167934.1|2069919_2071272_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.4	1.5e-89
WP_071168460.1|2071404_2072175_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_071168461.1|2072210_2073911_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_071168462.1|2074061_2074976_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	1.3e-12
WP_174549228.1|2075008_2075626_+	flavin reductase	NA	NA	NA	NA	NA
WP_008354820.1|2075660_2076578_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_071168464.1|2076591_2077545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168465.1|2077546_2079028_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	1.4e-16
>prophage 164
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2088961	2094060	3637729		Streptomyces_phage(50.0%)	4	NA	NA
WP_071168472.1|2088961_2090185_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	33.6	5.6e-11
WP_008354793.1|2090241_2091123_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_071168473.1|2091457_2092423_-	LCP family protein	NA	NA	NA	NA	NA
WP_145939406.1|2092695_2094060_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.1	2.5e-36
>prophage 165
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2116918	2122296	3637729		Staphylococcus_virus(50.0%)	4	NA	NA
WP_071168483.1|2116918_2119549_+	N-acetylglucosaminidase	NA	Q4ZC50	Staphylococcus_virus	44.3	8.3e-36
WP_008357547.1|2119566_2120754_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_071168484.1|2120765_2121536_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_008357543.1|2121906_2122296_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.6	9.7e-18
>prophage 166
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2128801	2137703	3637729	transposase	Bacillus_phage(20.0%)	7	NA	NA
WP_071168488.1|2128801_2129683_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.3	1.1e-80
WP_071168489.1|2129885_2131025_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	27.7	5.4e-24
WP_071167934.1|2131155_2132508_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.4	1.5e-89
WP_008357528.1|2132629_2133550_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071168490.1|2133732_2134056_+	LytA	NA	NA	NA	NA	NA
WP_071168491.1|2134080_2136189_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	32.8	6.0e-21
WP_008357523.1|2136212_2137703_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	37.2	1.2e-20
>prophage 167
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2142930	2145209	3637729		Bacillus_phage(50.0%)	2	NA	NA
WP_071168496.1|2142930_2144265_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	42.1	2.3e-90
WP_008357508.1|2144279_2145209_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	34.4	1.0e-41
>prophage 168
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2152539	2157911	3637729		Streptococcus_phage(66.67%)	5	NA	NA
WP_008360208.1|2152539_2153208_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	42.3	1.9e-37
WP_008360205.1|2153427_2154603_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008348273.1|2154667_2155357_+	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_071168501.1|2155569_2156412_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	36.2	6.8e-16
WP_167358870.1|2156537_2157911_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	38.7	2.5e-68
>prophage 169
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2163810	2164035	3637729		Vibrio_phage(100.0%)	1	NA	NA
WP_008360181.1|2163810_2164035_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.1	1.4e-08
>prophage 170
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2167259	2168945	3637729		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_071168502.1|2167259_2168945_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.4	6.1e-16
>prophage 171
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2178257	2183596	3637729		Planktothrix_phage(33.33%)	5	NA	NA
WP_008358447.1|2178257_2178944_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-27
WP_008358446.1|2178936_2179827_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008358444.1|2179942_2181205_+	M23 family metallopeptidase	NA	O03937	Lactobacillus_phage	38.2	5.6e-14
WP_071168506.1|2181253_2181994_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_071168507.1|2182147_2183596_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.3	2.7e-20
>prophage 172
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2190278	2195734	3637729		Bacillus_phage(66.67%)	4	NA	NA
WP_008358427.1|2190278_2191271_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	41.0	4.0e-60
WP_008358425.1|2191300_2193445_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_071168509.1|2193635_2195051_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	35.3	4.6e-41
WP_071168510.1|2195047_2195734_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.9	2.3e-38
>prophage 173
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2199028	2208044	3637729		Hokovirus(33.33%)	6	NA	NA
WP_071168512.1|2199028_2201560_-	phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.7	6.3e-33
WP_008358409.1|2201843_2202089_+	CsbA family protein	NA	NA	NA	NA	NA
WP_071168513.1|2202380_2204366_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_071168514.1|2204373_2207250_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_008358394.1|2207282_2207513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008358389.1|2207708_2208044_+	hypothetical protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	37.6	1.5e-06
>prophage 174
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2231325	2245880	3637729		Streptococcus_phage(25.0%)	14	NA	NA
WP_071168523.1|2231325_2232702_+	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	53.4	3.1e-26
WP_008361089.1|2232936_2233887_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.4	9.8e-88
WP_008361087.1|2234245_2234710_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_071169225.1|2234749_2235637_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.3	3.3e-05
WP_008361083.1|2235637_2236597_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.1	1.4e-62
WP_071168524.1|2236614_2237565_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.8	7.3e-51
WP_008348124.1|2237591_2237849_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_071168525.1|2237889_2238633_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_008361076.1|2238683_2239172_-	ribonuclease	NA	NA	NA	NA	NA
WP_071168526.1|2239548_2240526_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	25.5	2.1e-16
WP_008361979.1|2242190_2242787_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.4	2.0e-54
WP_008361976.1|2243014_2243323_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_008361975.1|2243817_2244282_+	DinB family protein	NA	NA	NA	NA	NA
WP_083381117.1|2244710_2245880_+	UDP-glucosyltransferase	NA	A0A2L0WU77	Oxyplax_ochracea_nucleopolyhedrovirus	23.2	4.7e-07
>prophage 175
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2249645	2261120	3637729	holin	Bacillus_phage(20.0%)	11	NA	NA
WP_071168530.1|2249645_2250464_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.3e-08
WP_008361781.1|2250457_2251222_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.8	4.9e-05
WP_174549231.1|2251409_2252840_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_034739956.1|2253119_2254172_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.2	1.3e-13
WP_008361775.1|2254168_2255170_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_082194768.1|2255186_2256083_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071168531.1|2256432_2256657_+|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	51.4	3.0e-16
WP_071168532.1|2256947_2257418_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071168533.1|2257675_2258407_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_008361201.1|2258396_2259080_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_071168534.1|2259245_2261120_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.8	1.7e-27
>prophage 176
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2265335	2266364	3637729		Catovirus(100.0%)	1	NA	NA
WP_071168536.1|2265335_2266364_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.9	9.8e-09
>prophage 177
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2270212	2271391	3637729		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_071169227.1|2270212_2271391_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	24.8	7.0e-11
>prophage 178
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2284718	2287375	3637729		Streptococcus_phage(50.0%)	3	NA	NA
WP_008358278.1|2284718_2286011_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.8	1.6e-173
WP_008358279.1|2286259_2286526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008358281.1|2286607_2287375_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	4.3e-09
>prophage 179
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2291570	2346503	3637729	plate,capsid,transposase,protease,integrase,terminase,tail,holin,portal,head	Bacillus_phage(71.43%)	69	2288424:2288441	2341885:2341902
2288424:2288441	attL	AATTTGTTGATATATTTT	NA	NA	NA	NA
WP_071168546.1|2291570_2292719_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	1.2e-12
WP_071168547.1|2292732_2293386_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008358303.1|2293399_2294317_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071168548.1|2294338_2295028_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008358306.1|2295110_2295431_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174549232.1|2295513_2295918_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	60.3	6.5e-17
WP_008358310.1|2296045_2296450_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	43.3	4.2e-16
WP_008347669.1|2296604_2296838_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008358314.1|2296875_2297166_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	47.5	8.8e-08
WP_003212746.1|2297352_2297586_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_071168550.1|2297710_2298457_+	carboxylesterase	NA	NA	NA	NA	NA
WP_071168551.1|2298476_2300819_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.8	9.5e-92
WP_008347658.1|2300958_2301429_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	62.5	1.4e-47
WP_071168552.1|2302046_2303114_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	65.5	3.5e-134
WP_071168553.1|2303367_2304468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168554.1|2304842_2305241_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071168555.1|2305418_2305622_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066030369.1|2305660_2305864_+	helix-turn-helix domain-containing protein	NA	A0A0S2GLE9	Bacillus_phage	56.5	3.5e-11
WP_167358860.1|2305860_2306028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145939410.1|2306102_2306348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168557.1|2306445_2306637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168558.1|2306711_2307575_+	conserved phage C-terminal domain-containing protein	NA	A0A0U3TZZ4	Bacillus_phage	51.1	3.7e-62
WP_071168559.1|2307558_2308380_+	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	41.0	2.8e-51
WP_167358861.1|2308491_2308647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168560.1|2308643_2309174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108611783.1|2309282_2309423_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_167358862.1|2309438_2309612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168561.1|2309682_2309892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168562.1|2309925_2310174_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	72.8	6.1e-26
WP_071168563.1|2310331_2311363_+	patatin-like phospholipase family protein	NA	A0A1X7C039	Faustovirus	30.7	3.3e-33
WP_071168564.1|2311938_2312544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168565.1|2312771_2313221_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.5	4.5e-35
WP_060596944.1|2313217_2313760_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	57.9	2.6e-53
WP_071168566.1|2313993_2314875_+	hypothetical protein	NA	C9E2Q0	Enterococcus_phage	38.2	2.3e-27
WP_071168567.1|2315106_2315589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083381119.1|2315630_2315990_+	HNH endonuclease	NA	Q38456	Bacillus_phage	73.5	2.5e-52
WP_071168568.1|2315979_2316303_+	hypothetical protein	NA	Q9T203	Bacillus_phage	45.5	1.3e-20
WP_071168569.1|2316389_2316920_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	3.4e-66
WP_071168570.1|2316919_2318626_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	82.4	3.2e-283
WP_066030385.1|2318637_2318820_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	65.5	6.5e-09
WP_071168571.1|2318826_2320068_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	81.2	7.7e-202
WP_071168572.1|2320060_2320696_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	3.9e-93
WP_071168573.1|2320736_2321924_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	65.9	2.9e-145
WP_071168574.1|2321943_2322240_+	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	71.1	2.3e-27
WP_071168575.1|2322264_2322666_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	50.6	1.1e-11
WP_071168576.1|2322680_2323022_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	50.0	1.6e-24
WP_071168577.1|2322957_2323323_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	48.8	1.8e-26
WP_071168578.1|2323315_2323699_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	73.2	8.8e-48
WP_071168579.1|2323695_2324064_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	57.4	4.1e-34
WP_071168580.1|2324075_2324702_+|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	52.4	2.7e-54
WP_071168581.1|2324742_2325078_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	6.1e-29
WP_071168582.1|2325080_2325275_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	71.4	1.2e-13
WP_071168583.1|2325290_2329307_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	65.5	3.0e-311
WP_071168584.1|2329306_2330140_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	66.8	2.5e-103
WP_071168585.1|2330155_2331898_+|tail	phage tail protein	tail	D6R400	Bacillus_phage	65.7	4.1e-209
WP_071168586.1|2331936_2333811_+	right-handed parallel beta-helix repeat-containing protein	NA	Q9ZXE2	Bacillus_phage	51.7	1.3e-22
WP_071168587.1|2333824_2335066_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	55.3	2.5e-51
WP_071168588.1|2335080_2335365_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	37.3	3.9e-08
WP_071168589.1|2335361_2335541_+	XkdX family protein	NA	NA	NA	NA	NA
WP_071168590.1|2335583_2336003_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	74.2	2.4e-46
WP_071168591.1|2336047_2336857_+	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	65.3	4.9e-88
WP_145939411.1|2336969_2338122_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	64.0	5.4e-40
WP_071168594.1|2338190_2338397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168595.1|2338420_2338912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168596.1|2340906_2342802_+	AAA family ATPase	NA	NA	NA	NA	NA
2341885:2341902	attR	AAAATATATCAACAAATT	NA	NA	NA	NA
WP_071168597.1|2342786_2344670_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	29.1	1.9e-58
WP_145939412.1|2345273_2345525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008358323.1|2345508_2345889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083381120.1|2346314_2346503_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 180
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2351240	2357666	3637729		Bacillus_phage(50.0%)	4	NA	NA
WP_071168605.1|2351240_2351849_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.8	5.8e-17
WP_083381121.1|2352096_2353641_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2I6UHU5	Bacillus_phage	88.9	5.6e-258
WP_071168606.1|2353617_2354511_-	hypothetical protein	NA	A0A2I6UHT9	Bacillus_phage	96.2	2.5e-21
WP_071168607.1|2356187_2357666_-	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	33.3	1.9e-45
>prophage 181
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2362202	2364638	3637729		uncultured_virus(100.0%)	1	NA	NA
WP_071168612.1|2362202_2364638_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.1	9.4e-119
>prophage 182
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2372716	2375981	3637729		Staphylococcus_phage(50.0%)	2	NA	NA
WP_071168614.1|2372716_2373460_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.1	1.9e-14
WP_071168615.1|2373881_2375981_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	8.1e-119
>prophage 183
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2381523	2386439	3637729		Staphylococcus_phage(33.33%)	5	NA	NA
WP_008361606.1|2381523_2382369_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.7	1.6e-73
WP_071168618.1|2382407_2383073_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_071168619.1|2383072_2383855_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008361620.1|2383971_2385822_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.0	3.5e-81
WP_008361622.1|2385947_2386439_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	3.0e-08
>prophage 184
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2391657	2396171	3637729		Bacillus_phage(50.0%)	4	NA	NA
WP_008356577.1|2391657_2392680_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.7	1.4e-18
WP_071168622.1|2392701_2393517_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.6	2.7e-09
WP_008356581.1|2393690_2394413_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	2.4e-30
WP_008356582.1|2394416_2396171_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.9	4.0e-18
>prophage 185
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2404385	2406727	3637729		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_008356598.1|2404385_2405444_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.2	2.1e-14
WP_071168628.1|2405440_2406727_+	heme ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	6.1e-16
>prophage 186
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2415952	2416699	3637729		Hirudovirus(100.0%)	1	NA	NA
WP_034738528.1|2415952_2416699_-	SDR family oxidoreductase	NA	V5L4T3	Hirudovirus	32.6	1.3e-07
>prophage 187
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2430958	2435970	3637729		Bacillus_phage(33.33%)	5	NA	NA
WP_008356649.1|2430958_2431633_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	1.5e-29
WP_008356651.1|2431969_2433334_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.6	1.0e-21
WP_083381123.1|2433578_2434460_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_008356655.1|2434547_2434994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008356658.1|2435139_2435970_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.2	1.6e-09
>prophage 188
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2442787	2464458	3637729		Bacillus_phage(30.0%)	26	NA	NA
WP_008356673.1|2442787_2443144_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	52.4	1.3e-21
WP_008356675.1|2443210_2443594_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_008356677.1|2443638_2443875_+	YusG family protein	NA	NA	NA	NA	NA
WP_008347035.1|2444005_2444350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008356682.1|2444361_2444664_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_008356684.1|2444784_2445126_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008356686.1|2445492_2446518_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	1.3e-29
WP_008356688.1|2446510_2447179_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008356691.1|2447193_2448015_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003212803.1|2448119_2448488_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_008356693.1|2448704_2448842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007500355.1|2449052_2449838_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.9	5.3e-07
WP_008356697.1|2449856_2451170_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_008356699.1|2451169_2452390_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	49.3	1.9e-120
WP_008356701.1|2452379_2452826_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	36.6	7.5e-14
WP_008356703.1|2452843_2454241_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_071168643.1|2455566_2455950_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	47.4	3.6e-25
WP_071168644.1|2456228_2456441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168645.1|2456524_2457025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168646.1|2457151_2458279_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	39.0	6.2e-65
WP_165378950.1|2458422_2458575_-	hypothetical protein	NA	M5ABW1	Bacillus_phage	73.3	2.8e-05
WP_008362055.1|2459524_2460478_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071168647.1|2460549_2461566_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.5	4.1e-15
WP_008362051.1|2461558_2462596_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_071168648.1|2462617_2463361_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_008360483.1|2463579_2464458_-	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	36.4	1.6e-23
>prophage 189
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2469986	2470838	3637729		Port-miou_virus(100.0%)	1	NA	NA
WP_071168651.1|2469986_2470838_+	DUF72 domain-containing protein	NA	A0A0N9P8W6	Port-miou_virus	26.1	3.9e-11
>prophage 190
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2474132	2475113	3637729		Microcystis_phage(100.0%)	1	NA	NA
WP_071168653.1|2474132_2475113_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	36.3	1.5e-06
>prophage 191
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2478659	2481357	3637729	coat	Bacillus_virus(50.0%)	3	NA	NA
WP_008360446.1|2478659_2479160_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	2.3e-40
WP_071168655.1|2479273_2480314_+|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_071168656.1|2480388_2481357_+	D-glycerate dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	28.7	2.9e-23
>prophage 192
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2487181	2487418	3637729		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003212861.1|2487181_2487418_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	3.8e-09
>prophage 193
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2491072	2491435	3637729		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_008357254.1|2491072_2491435_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	46.2	1.3e-19
>prophage 194
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2495448	2501790	3637729		Streptococcus_phage(33.33%)	7	NA	NA
WP_008357239.1|2495448_2496447_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	48.4	4.4e-30
WP_162130799.1|2496837_2498055_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_167358863.1|2498189_2498315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008357234.1|2498396_2498717_+	YuiB family protein	NA	NA	NA	NA	NA
WP_071168665.1|2498816_2499461_+	3D domain-containing protein	NA	A0A2K9V442	Faecalibacterium_phage	49.2	4.8e-06
WP_008346791.1|2499501_2499978_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_008357229.1|2500299_2501790_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	1.9e-61
>prophage 195
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2508897	2513373	3637729		Mycobacterium_phage(100.0%)	1	NA	NA
WP_071168669.1|2508897_2513373_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	21.7	7.2e-40
>prophage 196
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2523111	2525150	3637729		Bacillus_virus(100.0%)	2	NA	NA
WP_008357192.1|2523111_2523663_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.3	1.8e-30
WP_008357190.1|2523680_2525150_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.7	9.4e-114
>prophage 197
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2538670	2543719	3637729		Dickeya_phage(50.0%)	4	NA	NA
WP_071168678.1|2538670_2540008_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	54.1	3.0e-18
WP_008357158.1|2540184_2541144_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071168679.1|2541144_2542191_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071168680.1|2542183_2543719_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.6	7.0e-11
>prophage 198
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2553958	2557725	3637729		Hokovirus(50.0%)	4	NA	NA
WP_008358987.1|2553958_2555251_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.7	2.2e-13
WP_071168687.1|2555384_2556560_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_008358983.1|2556643_2556904_+	DUF1871 family protein	NA	NA	NA	NA	NA
WP_071168688.1|2556900_2557725_-	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.4	3.0e-08
>prophage 199
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2571733	2580768	3637729		uncultured_Caudovirales_phage(80.0%)	5	NA	NA
WP_071168695.1|2571733_2573725_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.6	2.0e-18
WP_071168696.1|2573859_2575842_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.2	1.6e-15
WP_083381125.1|2576020_2577997_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.9	1.5e-13
WP_071168698.1|2578164_2580153_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.4	2.0e-13
WP_071168699.1|2580243_2580768_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	33.7	2.8e-20
>prophage 200
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2586763	2652499	3637729	plate,capsid,terminase,tail,holin,portal	uncultured_Caudovirales_phage(36.67%)	73	NA	NA
WP_071168700.1|2586763_2587141_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	7.2e-18
WP_167358864.1|2587534_2587693_+	hypothetical protein	NA	A0A2H4J4L6	uncultured_Caudovirales_phage	55.3	2.2e-05
WP_034739865.1|2587682_2587865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168701.1|2587967_2588369_+	holliday junction resolvase	NA	NA	NA	NA	NA
WP_071168702.1|2588365_2588596_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	2.9e-14
WP_071168703.1|2588694_2589213_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	48.8	1.6e-36
WP_071168704.1|2589363_2590011_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	43.3	3.6e-41
WP_167358871.1|2590019_2591321_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.3	2.2e-151
WP_071168706.1|2591317_2592775_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	53.0	1.1e-138
WP_071168707.1|2592809_2593901_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	40.0	3.2e-58
WP_008361434.1|2593922_2594846_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.6	2.2e-108
WP_071168708.1|2594859_2595243_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_008361430.1|2595239_2595596_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_071168709.1|2595592_2596090_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.4	5.9e-36
WP_071168710.1|2596094_2596550_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_008361424.1|2596536_2596749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168711.1|2596752_2598099_+|tail	phage tail sheath family protein	tail	A0A0A7S087	Clostridium_phage	40.5	2.1e-80
WP_008361420.1|2598100_2598544_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
WP_072368332.1|2598834_2598924_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_034740076.1|2599073_2599514_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.3e-10
WP_095410046.1|2599555_2599693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168712.1|2599748_2603675_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	44.8	3.2e-44
WP_008361637.1|2603667_2604336_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	29.6	6.5e-22
WP_008361639.1|2604347_2605358_+	hypothetical protein	NA	H7BV96	unidentified_phage	29.3	1.2e-35
WP_071168713.1|2605354_2605621_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	6.2e-08
WP_071168714.1|2605635_2606058_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_008361647.1|2606050_2607097_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.7e-69
WP_071168715.1|2607083_2608007_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.5	2.5e-11
WP_071168716.1|2608018_2608402_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071168717.1|2608417_2609296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008361659.1|2609306_2609636_+	XkdW family protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	34.6	2.6e-08
WP_008361661.1|2609632_2609806_+|portal	phage portal protein	portal	A0A2H4JAA1	uncultured_Caudovirales_phage	53.1	3.1e-08
WP_071168718.1|2609813_2611025_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	62.5	7.6e-77
WP_071168719.1|2611036_2611384_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	93.9	2.3e-55
WP_071168720.1|2611373_2611565_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	87.3	5.2e-25
WP_071168721.1|2611633_2611912_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	97.8	2.0e-41
WP_071168722.1|2611932_2612196_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	81.6	2.7e-32
WP_071168723.1|2612258_2613329_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_071168724.1|2615000_2615558_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071168725.1|2615764_2617234_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_008361692.1|2617256_2618465_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_071169235.1|2618505_2619003_-	DinB family protein	NA	NA	NA	NA	NA
WP_008361696.1|2619207_2619738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008361697.1|2619749_2621297_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	28.8	4.3e-08
WP_071168726.1|2621327_2622470_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_008361702.1|2622466_2623621_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_008361704.1|2623635_2624274_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_071168727.1|2624431_2624986_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_083381128.1|2624945_2625134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071168728.1|2625226_2625802_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_008360700.1|2633947_2634424_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_071168729.1|2634510_2635245_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_008360696.1|2635362_2636301_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_008360695.1|2636683_2638102_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_071168730.1|2638094_2639837_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_071168731.1|2639821_2640646_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_034665273.1|2640666_2641485_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_071168732.1|2641555_2643016_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.4	4.4e-79
WP_008360686.1|2643002_2644127_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_008360684.1|2644233_2644425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008360682.1|2644450_2644609_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_008360680.1|2644677_2645724_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071168733.1|2645746_2647078_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_008360676.1|2647254_2647497_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_008360674.1|2647573_2648530_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071168734.1|2648743_2649310_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003217666.1|2649311_2649536_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	1.6e-25
WP_008360669.1|2649664_2650138_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_008360667.1|2650460_2650898_+	FixH family protein	NA	NA	NA	NA	NA
WP_008360665.1|2650906_2651053_-	YtzI protein	NA	NA	NA	NA	NA
WP_008360664.1|2651184_2651622_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	65.5	3.7e-50
WP_008342942.1|2651744_2651936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071168735.1|2652094_2652499_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 201
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2655878	2656649	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_008361915.1|2655878_2656649_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.2e-32
>prophage 202
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2661899	2668409	3637729		Staphylococcus_phage(75.0%)	5	NA	NA
WP_008361927.1|2661899_2662694_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	41.1	1.7e-40
WP_008361929.1|2662733_2662976_+	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_071168742.1|2663016_2664603_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	62.8	3.5e-191
WP_008361732.1|2665161_2666364_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.6	5.1e-166
WP_008361730.1|2666510_2668409_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2P1ELF7	Moumouvirus	31.3	1.1e-34
>prophage 203
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2672120	2684330	3637729	tRNA	Staphylococcus_phage(66.67%)	13	NA	NA
WP_008361720.1|2672120_2672696_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	49.2	8.9e-44
WP_008361718.1|2672692_2673658_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	77.2	6.9e-57
WP_008361717.1|2673810_2674086_+	YtzC family protein	NA	NA	NA	NA	NA
WP_071168744.1|2674429_2674609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008362024.1|2674626_2675019_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008362023.1|2675011_2675890_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.2e-17
WP_071168745.1|2675883_2676870_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_008362020.1|2676891_2677590_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	8.0e-39
WP_071168746.1|2677579_2678890_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008362017.1|2678949_2679651_-	hypothetical protein	NA	A0A0A7RU41	Clostridium_phage	38.6	5.8e-05
WP_071168747.1|2679937_2680741_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_008356456.1|2681169_2681493_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_071168748.1|2681915_2684330_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.0	0.0e+00
>prophage 204
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2697888	2699160	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071168756.1|2697888_2699160_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	59.4	5.8e-27
>prophage 205
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2705856	2706789	3637729		Lactococcus_phage(100.0%)	1	NA	NA
WP_167358872.1|2705856_2706789_-	cysteine synthase A	NA	A0A1W6JIM2	Lactococcus_phage	54.1	4.8e-79
>prophage 206
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2717955	2722324	3637729	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_034738405.1|2717955_2718768_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	52.6	3.1e-34
WP_071168766.1|2718784_2719390_+|tRNA	DUF4479 domain-containing tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_071169237.1|2719588_2722324_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.2	1.5e-88
>prophage 207
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2725637	2726714	3637729		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_008356369.1|2725637_2726714_+	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase	NA	E3T537	Cafeteria_roenbergensis_virus	29.2	2.4e-13
>prophage 208
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2730837	2734182	3637729	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_071168771.1|2730837_2732562_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	73.7	1.7e-210
WP_071168772.1|2732913_2734182_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.6	3.4e-80
>prophage 209
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2745601	2750058	3637729	tRNA	Faustovirus(33.33%)	4	NA	NA
WP_071168778.1|2745601_2746744_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.9	1.4e-27
WP_071168779.1|2746748_2747954_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003216385.1|2748042_2748255_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	79.1	3.0e-21
WP_071168780.1|2748480_2750058_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.1	1.2e-74
>prophage 210
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2763965	2767957	3637729		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_071168791.1|2763965_2765408_-	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	34.5	1.0e-48
WP_008356109.1|2765705_2766509_-	NAD kinase	NA	NA	NA	NA	NA
WP_071168792.1|2766955_2767957_+	signal peptide peptidase SppA	NA	Q7Y411	Yersinia_phage	28.0	6.6e-18
>prophage 211
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2783079	2786415	3637729		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_071168799.1|2783079_2786415_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.7	1.8e-181
>prophage 212
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2791258	2793019	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_008356060.1|2791258_2793019_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	45.6	2.3e-13
>prophage 213
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2796855	2819341	3637729	tRNA	Bacillus_phage(40.0%)	21	NA	NA
WP_008356049.1|2796855_2798127_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	57.4	5.8e-11
WP_008356047.1|2798161_2799100_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_008356045.1|2799287_2800016_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.4	9.6e-43
WP_071168800.1|2800008_2801751_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	39.2	1.3e-40
WP_071168801.1|2802006_2804646_+	DNA polymerase I	NA	B6V2J7	Bacillus_phage	30.0	5.5e-48
WP_008356038.1|2804670_2805504_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.2	8.2e-22
WP_071168802.1|2805679_2806312_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_008356035.1|2806325_2806931_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_008356032.1|2807103_2808126_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003216492.1|2808360_2808741_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.2	2.8e-17
WP_008356030.1|2808925_2809312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003216720.1|2809316_2809775_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_008356027.1|2809874_2811299_+	replication initiation and membrane attachment family protein	NA	NA	NA	NA	NA
WP_071168803.1|2811316_2812246_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	33.1	1.3e-36
WP_008356024.1|2812280_2812919_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_008356021.1|2812979_2813849_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_008356019.1|2814185_2816126_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.2	2.6e-111
WP_071168804.1|2816298_2817219_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	3.3e-08
WP_071168805.1|2817274_2818054_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_008356012.1|2818209_2818392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034738338.1|2818825_2819341_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	5.4e-16
>prophage 214
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2825615	2826650	3637729	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_008355994.1|2825615_2826650_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	4.5e-30
>prophage 215
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2831098	2838039	3637729		Cafeteria_roenbergensis_virus(33.33%)	5	NA	NA
WP_008355985.1|2831098_2832811_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	23.0	1.9e-12
WP_071169238.1|2832832_2835190_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	46.0	9.1e-18
WP_008355981.1|2835204_2835609_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_071168812.1|2835772_2836228_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_071168813.1|2836329_2838039_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.7	2.1e-40
>prophage 216
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2841875	2842190	3637729		Indivirus(100.0%)	1	NA	NA
WP_007501629.1|2841875_2842190_+	thioredoxin	NA	A0A1V0SD63	Indivirus	44.1	3.0e-09
>prophage 217
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2845907	2847656	3637729		Planktothrix_phage(100.0%)	1	NA	NA
WP_071168819.1|2845907_2847656_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	5.7e-17
>prophage 218
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2858357	2858582	3637729		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003184172.1|2858357_2858582_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
>prophage 219
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2862052	2862655	3637729		Euphorbia_ringspot_virus(100.0%)	1	NA	NA
WP_174549235.1|2862052_2862655_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	31.2	1.8e-10
>prophage 220
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2868199	2880650	3637729		Tupanvirus(20.0%)	11	NA	NA
WP_071168830.1|2868199_2869705_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	24.3	2.0e-34
WP_071168831.1|2869701_2870886_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.3	5.0e-17
WP_008362036.1|2870907_2871144_+	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
WP_071168832.1|2871143_2872310_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_008362032.1|2872405_2872825_+	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	31.1	1.2e-08
WP_071168833.1|2873054_2874098_-	lactonase family protein	NA	NA	NA	NA	NA
WP_008357987.1|2874530_2875445_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_008357985.1|2875823_2877548_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	1.1e-60
WP_071168834.1|2877544_2878063_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_008357979.1|2878081_2879110_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_008357978.1|2879096_2880650_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.6	1.9e-11
>prophage 221
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2886738	2892301	3637729	protease	Moraxella_phage(66.67%)	3	NA	NA
WP_008357967.1|2886738_2888004_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.2	5.0e-148
WP_071168837.1|2888143_2889805_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.3	2.7e-16
WP_071168838.1|2889976_2892301_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	1.1e-180
>prophage 222
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2903920	2906563	3637729	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_008357933.1|2903920_2906563_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.9	1.4e-160
>prophage 223
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2922561	2923704	3637729		Faustovirus(100.0%)	1	NA	NA
WP_174549237.1|2922561_2923704_-	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.6	6.8e-27
>prophage 224
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2930137	2935719	3637729	tRNA	Insectomime_virus(33.33%)	7	NA	NA
WP_071168856.1|2930137_2930782_-	serine/threonine protein kinase	NA	V5L5V0	Insectomime_virus	28.9	3.1e-05
WP_071168857.1|2931007_2931520_+	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_008361001.1|2931668_2932274_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_008361000.1|2932285_2933290_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.0	1.1e-07
WP_008342752.1|2933282_2933483_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_008360998.1|2933517_2934546_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_008360996.1|2934573_2935719_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	1.9e-85
>prophage 225
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2939297	2956450	3637729	tRNA	Bacillus_phage(28.57%)	13	NA	NA
WP_008360988.1|2939297_2941526_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.3	1.5e-30
WP_008360876.1|2941920_2942409_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_008360873.1|2942507_2942864_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_071168859.1|2942945_2945270_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.1	3.2e-92
WP_008342729.1|2945293_2945806_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.5e-29
WP_008360869.1|2945949_2948160_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.2	1.7e-10
WP_008360868.1|2948178_2948622_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_071168860.1|2948706_2950287_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	32.9	1.8e-22
WP_003216250.1|2950424_2950595_+	YrzK family protein	NA	NA	NA	NA	NA
WP_071168861.1|2950965_2952240_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_145939416.1|2952258_2954037_+|tRNA	aspartate--tRNA ligase	tRNA	K7Y9W2	Megavirus	37.6	7.9e-06
WP_008360859.1|2954387_2955152_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_071168863.1|2955184_2956450_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	53.1	1.4e-113
>prophage 226
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2960188	2962573	3637729		Virus_Rctr197k(100.0%)	1	NA	NA
WP_071168864.1|2960188_2962573_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	28.2	2.8e-51
>prophage 227
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2966144	2971132	3637729	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_071168866.1|2966144_2966873_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	5.3e-33
WP_008358527.1|2967097_2968162_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_008358525.1|2968495_2971132_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.3	8.8e-70
>prophage 228
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2975604	2977513	3637729		Phage_TP(50.0%)	2	NA	NA
WP_008358509.1|2975604_2976873_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.7	3.3e-38
WP_008358507.1|2976880_2977513_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.4	1.1e-34
>prophage 229
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2983163	2989124	3637729		Lactococcus_phage(33.33%)	8	NA	NA
WP_008358494.1|2983163_2984087_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.8	4.7e-63
WP_008358492.1|2984088_2985237_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.6	1.2e-23
WP_083381135.1|2985309_2985540_+	YrhC family protein	NA	NA	NA	NA	NA
WP_008358488.1|2985984_2986119_+	YrzI family small protein	NA	NA	NA	NA	NA
WP_155887861.1|2986278_2986440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008342643.1|2986484_2986610_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_071168871.1|2986877_2987480_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_071168872.1|2987909_2989124_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.0	7.2e-11
>prophage 230
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	2995816	2996581	3637729		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_034739082.1|2995816_2996581_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	1.5e-14
>prophage 231
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3029043	3031125	3637729		Bacillus_phage(100.0%)	2	NA	NA
WP_034738387.1|3029043_3029772_-	RNA polymerase sporulation sigma factor SigK	NA	U5PUF5	Bacillus_phage	28.7	2.5e-14
WP_071168897.1|3030003_3031125_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	46.3	7.0e-85
>prophage 232
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3036497	3037067	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_071168899.1|3036497_3037067_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	29.7	1.4e-17
>prophage 233
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3040423	3043313	3637729		Bacillus_phage(50.0%)	2	NA	NA
WP_008356210.1|3040423_3040993_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	50.4	1.7e-31
WP_071168903.1|3040985_3043313_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	32.2	9.2e-31
>prophage 234
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3048228	3050067	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_008356225.1|3048228_3050067_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.7	3.1e-21
>prophage 235
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3053079	3056217	3637729		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_071168906.1|3053079_3054918_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.1	2.8e-139
WP_071168907.1|3055083_3056217_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	30.7	8.8e-27
>prophage 236
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3066193	3067153	3637729		Rhizobium_phage(100.0%)	1	NA	NA
WP_008356254.1|3066193_3067153_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	51.7	1.8e-52
>prophage 237
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3078437	3090677	3637729	tRNA,coat	Caulobacter_phage(16.67%)	12	NA	NA
WP_008356277.1|3078437_3080267_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	4.7e-54
WP_008342392.1|3080469_3081591_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	4.4e-39
WP_008356279.1|3081894_3082254_+	cytochrome c	NA	NA	NA	NA	NA
WP_071168916.1|3082374_3083091_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_008356282.1|3083083_3084205_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	46.9	7.4e-18
WP_071168917.1|3084242_3085187_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_071168918.1|3085344_3086061_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_008356288.1|3086216_3087536_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.5	3.7e-53
WP_008356291.1|3087545_3088439_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.2	5.1e-22
WP_071168919.1|3088487_3088742_-	DUF2624 domain-containing protein	NA	NA	NA	NA	NA
WP_008342375.1|3088882_3089764_+	YitT family protein	NA	NA	NA	NA	NA
WP_008356294.1|3089900_3090677_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	3.2e-20
>prophage 238
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3097508	3098117	3637729		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_071168923.1|3097508_3098117_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.1	1.0e-69
>prophage 239
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3104838	3106437	3637729		Bacillus_virus(50.0%)	2	NA	NA
WP_174549239.1|3104838_3105642_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	6.0e-14
WP_008360054.1|3105657_3106437_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.9	1.4e-15
>prophage 240
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3112535	3114455	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_008360073.1|3112535_3114455_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.4	8.8e-96
>prophage 241
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3129348	3138469	3637729		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_071169245.1|3129348_3131019_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.4	1.3e-55
WP_071168938.1|3131577_3132675_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_071168939.1|3132691_3134038_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	40.8	1.7e-61
WP_008360257.1|3134030_3135491_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	39.6	7.7e-84
WP_071169246.1|3135530_3135911_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_071168940.1|3136131_3136968_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003215946.1|3137053_3137488_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_008360263.1|3137593_3138469_+	patatin-like phospholipase family protein	NA	A0A0G2Y956	Acanthamoeba_polyphaga_mimivirus	28.0	1.5e-13
>prophage 242
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3151817	3154086	3637729		Enterococcus_phage(50.0%)	2	NA	NA
WP_008358610.1|3151817_3152669_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	41.2	1.4e-40
WP_071168948.1|3152739_3154086_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	2.5e-44
>prophage 243
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3162426	3164787	3637729		Bacillus_phage(100.0%)	2	NA	NA
WP_008358592.1|3162426_3163230_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	31.9	2.2e-08
WP_008358589.1|3163686_3164787_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	29.1	1.6e-41
>prophage 244
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3179845	3180568	3637729		Planktothrix_phage(100.0%)	1	NA	NA
WP_008358554.1|3179845_3180568_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	9.8e-32
>prophage 245
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3187421	3190186	3637729		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_071168966.1|3187421_3188678_+	DNA polymerase IV	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	25.3	9.8e-19
WP_008358805.1|3188776_3190186_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	33.3	2.6e-36
>prophage 246
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3194360	3198188	3637729		Pandoravirus(50.0%)	3	NA	NA
WP_071168968.1|3194360_3195767_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.0	3.6e-46
WP_008358792.1|3195943_3196666_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008358790.1|3196712_3198188_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.0	4.7e-81
>prophage 247
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3208191	3209019	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_008358774.1|3208191_3209019_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.6	1.9e-26
>prophage 248
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3212751	3221469	3637729		Bacillus_phage(50.0%)	10	NA	NA
WP_071168974.1|3212751_3213711_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.7	7.4e-27
WP_008358765.1|3213743_3214979_-	MFS transporter	NA	NA	NA	NA	NA
WP_071168975.1|3215214_3215559_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_071168976.1|3215574_3216807_-	DNA polymerase IV	NA	O64031	Bacillus_phage	40.8	2.5e-67
WP_071169249.1|3216948_3217398_-	YfmQ family protein	NA	NA	NA	NA	NA
WP_082194745.1|3217611_3218166_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071168977.1|3218162_3219143_+	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	43.0	1.2e-32
WP_008358751.1|3219254_3219581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008358750.1|3219593_3219833_+	YqkC family protein	NA	NA	NA	NA	NA
WP_008358747.1|3220206_3221469_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	49.1	2.9e-95
>prophage 249
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3226758	3235643	3637729		Bacillus_phage(50.0%)	11	NA	NA
WP_071168981.1|3226758_3227856_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	44.5	1.1e-47
WP_008361816.1|3227972_3228617_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003215577.1|3228738_3229191_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_008361814.1|3229308_3229536_+	YqzK family protein	NA	NA	NA	NA	NA
WP_008361812.1|3229542_3230433_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	35.0	7.6e-42
WP_071168982.1|3230586_3231771_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_008361808.1|3231782_3232595_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	45.4	9.9e-65
WP_008361806.1|3232720_3233908_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_008361804.1|3234072_3234426_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_008361802.1|3234422_3234863_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_071168983.1|3234875_3235643_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	59.2	6.7e-71
>prophage 250
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3240647	3241800	3637729	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_145939419.1|3240647_3241800_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	3.2e-40
>prophage 251
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3249536	3257836	3637729		Staphylococcus_phage(42.86%)	13	NA	NA
WP_008359679.1|3249536_3249974_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	47.5	2.9e-18
WP_008359681.1|3250117_3250354_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_008359682.1|3250603_3250948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008359684.1|3251457_3252108_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.3	1.6e-41
WP_083381140.1|3252119_3252743_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	56.3	2.9e-56
WP_008359688.1|3252769_3253234_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	65.3	6.1e-43
WP_008359690.1|3253346_3253700_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071168990.1|3253722_3254247_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_008359694.1|3254335_3254428_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_071168991.1|3254637_3255396_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.8	3.8e-10
WP_008359698.1|3255385_3255979_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	1.2e-14
WP_071168992.1|3256092_3256572_+	YpuI family protein	NA	NA	NA	NA	NA
WP_008359702.1|3256684_3257836_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	38.1	1.1e-24
>prophage 252
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3263371	3274565	3637729		Bacillus_phage(50.0%)	10	NA	NA
WP_008359715.1|3263371_3264094_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.3	2.0e-45
WP_071168994.1|3264090_3265872_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	37.5	1.3e-40
WP_008359718.1|3266075_3266684_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_071168995.1|3266595_3267702_+	sigma X negative regulator	NA	NA	NA	NA	NA
WP_008359722.1|3267854_3268502_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2K9VGT1	Pontimonas_phage	36.0	7.5e-15
WP_071168996.1|3268537_3270112_-	phosphoglycerate dehydrogenase	NA	M1I539	Acanthocystis_turfacea_Chlorella_virus	33.3	1.4e-27
WP_034739409.1|3270678_3271263_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_008361239.1|3271494_3271743_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	53.3	4.0e-17
WP_071168997.1|3272011_3273064_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071168998.1|3273056_3274565_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	35.4	1.7e-57
>prophage 253
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3281570	3282479	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_071169001.1|3281570_3282479_+	spore cortex-lytic enzyme	NA	A0A141HRV8	Bacillus_phage	39.1	6.6e-17
>prophage 254
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3295951	3311310	3637729		Acinetobacter_phage(22.22%)	18	NA	NA
WP_008356733.1|3295951_3296230_+	non-specific DNA-binding protein Hbs	NA	A0A0H3UZA0	Geobacillus_virus	70.8	4.3e-28
WP_008356734.1|3296420_3296990_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.4	1.8e-49
WP_008344541.1|3297013_3297244_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_008356736.1|3297359_3298127_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_008356738.1|3298130_3298835_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_008356740.1|3298859_3299822_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	26.0	1.7e-07
WP_008356741.1|3299951_3300398_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.3	1.5e-27
WP_008356743.1|3300541_3301321_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_008356745.1|3301394_3302567_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.4	5.9e-42
WP_071169005.1|3302566_3303658_+	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	27.9	7.4e-23
WP_008356748.1|3303654_3304038_+	chorismate mutase	NA	NA	NA	NA	NA
WP_071169006.1|3304269_3305817_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_071169007.1|3305788_3306811_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	41.3	6.4e-61
WP_071169008.1|3306803_3307556_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	43.8	2.3e-47
WP_071169009.1|3307552_3308221_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_008356758.1|3308201_3309401_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_008356760.1|3309397_3310201_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_034738567.1|3310212_3311310_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.6	3.9e-24
>prophage 255
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3315476	3316016	3637729		Bacillus_virus(100.0%)	1	NA	NA
WP_008344562.1|3315476_3316016_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	50.0	1.2e-42
>prophage 256
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3320256	3321129	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_008356777.1|3320256_3321129_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	46.7	4.8e-73
>prophage 257
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3324681	3335039	3637729	tRNA	Bacillus_phage(40.0%)	10	NA	NA
WP_071169014.1|3324681_3325884_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	46.3	9.9e-37
WP_071169015.1|3325856_3326840_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_008356791.1|3327037_3327877_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	41.6	3.7e-54
WP_071169016.1|3327873_3328740_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_008356795.1|3328732_3329116_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_071169017.1|3329231_3332024_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	28.8	1.9e-54
WP_008344594.1|3332159_3332330_+	YpmA family protein	NA	NA	NA	NA	NA
WP_008356799.1|3332342_3332828_+	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_008356801.1|3332943_3334236_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	3.2e-57
WP_008356803.1|3334334_3335039_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	45.9	6.2e-23
>prophage 258
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3338995	3339607	3637729		Brevibacillus_phage(100.0%)	1	NA	NA
WP_071169020.1|3338995_3339607_-	Holliday junction resolvase RecU	NA	A0A0K2CP48	Brevibacillus_phage	39.5	1.2e-25
>prophage 259
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3343342	3344496	3637729	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_145939420.1|3343342_3344496_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	3.2e-40
>prophage 260
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3365564	3369335	3637729		Bacillus_phage(33.33%)	8	NA	NA
WP_008358093.1|3365564_3366452_+	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	33.7	1.2e-42
WP_008358095.1|3366524_3366650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169034.1|3366693_3367089_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_008358099.1|3367090_3367780_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	31.2	5.2e-14
WP_008358101.1|3367874_3368546_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_008358103.1|3368547_3368730_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_008358105.1|3368900_3369083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003215784.1|3369134_3369335_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.1	8.4e-18
>prophage 261
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3374999	3375623	3637729		Pandoravirus(100.0%)	1	NA	NA
WP_034738962.1|3374999_3375623_+	HD domain-containing protein	NA	S4W232	Pandoravirus	26.7	3.2e-07
>prophage 262
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3381060	3382970	3637729		Bacillus_virus(33.33%)	3	NA	NA
WP_071169040.1|3381060_3381588_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.6	1.4e-48
WP_071169041.1|3381690_3382485_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	63.3	3.5e-99
WP_071169042.1|3382481_3382970_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	49.7	6.6e-40
>prophage 263
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3387196	3388039	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071169044.1|3387196_3388039_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	52.3	1.3e-27
>prophage 264
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3393000	3395010	3637729		Moumouvirus(50.0%)	2	NA	NA
WP_008358166.1|3393000_3394029_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	36.8	2.9e-37
WP_008358168.1|3394287_3395010_+	N-acylneuraminate cytidylyltransferase	NA	E3T536	Cafeteria_roenbergensis_virus	25.2	4.6e-05
>prophage 265
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3419701	3422658	3637729		Clostridioides_phage(33.33%)	3	NA	NA
WP_008359989.1|3419701_3421036_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.8	4.1e-15
WP_071169062.1|3421111_3421690_+	superoxide dismutase family protein	NA	A0A2K9L493	Tupanvirus	38.5	1.8e-12
WP_008359985.1|3421779_3422658_+	MoxR family ATPase	NA	R4TG24	Halovirus	27.2	3.4e-10
>prophage 266
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3437443	3440272	3637729		Tupanvirus(50.0%)	2	NA	NA
WP_071169069.1|3437443_3439234_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	40.2	3.8e-85
WP_008357345.1|3439480_3440272_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	73.1	4.1e-31
>prophage 267
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3445425	3446088	3637729		Streptococcus_phage(100.0%)	1	NA	NA
WP_071169072.1|3445425_3446088_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	31.5	1.1e-18
>prophage 268
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3458848	3466476	3637729		Streptococcus_phage(60.0%)	5	NA	NA
WP_082194733.1|3458848_3459694_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	29.0	4.4e-23
WP_071169080.1|3459721_3460840_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.3	2.5e-74
WP_071169081.1|3460858_3462127_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.4	4.6e-101
WP_008357304.1|3462916_3464746_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	2.7e-54
WP_071169082.1|3464742_3466476_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	4.2e-44
>prophage 269
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3491044	3491926	3637729		Bacillus_phage(100.0%)	1	NA	NA
WP_008360534.1|3491044_3491926_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.5	1.5e-79
>prophage 270
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3503080	3504718	3637729		Hepacivirus(100.0%)	1	NA	NA
WP_034739640.1|3503080_3504718_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.3	2.6e-48
>prophage 271
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3509560	3511495	3637729		Staphylococcus_phage(100.0%)	1	NA	NA
WP_071169104.1|3509560_3511495_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	30.7	1.6e-49
>prophage 272
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3527465	3528506	3637729		Enterobacteria_phage(100.0%)	1	NA	NA
WP_008357791.1|3527465_3528506_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.1	5.2e-18
>prophage 273
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3538463	3542875	3637729		Bacillus_phage(50.0%)	2	NA	NA
WP_008357815.1|3538463_3540905_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	30.2	2.5e-95
WP_008357817.1|3540907_3542875_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.1	1.2e-124
>prophage 274
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3546358	3546862	3637729		Streptomyces_phage(100.0%)	1	NA	NA
WP_071169116.1|3546358_3546862_-	TlpA family protein disulfide reductase	NA	A0A1J0GW78	Streptomyces_phage	44.4	4.9e-06
>prophage 275
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3557894	3570745	3637729		Phage_Wrath(25.0%)	10	NA	NA
WP_003212311.1|3557894_3558515_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	1.3e-16
WP_008357854.1|3558561_3559011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008357856.1|3559307_3559850_+	IseA DL-endopeptidase inhibitor family protein	NA	NA	NA	NA	NA
WP_071169120.1|3559882_3560731_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_083381144.1|3560874_3561309_-	sporulation protein	NA	F8WPS9	Bacillus_phage	59.9	3.5e-40
WP_071169121.1|3561489_3563526_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_071169122.1|3563779_3566923_-	bifunctional cytochrome P450/NADPH--P450 reductase	NA	V5UQK0	Mycobacterium_phage	39.8	6.5e-80
WP_008357865.1|3566944_3567523_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071169123.1|3567753_3568464_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_071169124.1|3568528_3570745_-	metallophosphoesterase	NA	Q4Z932	Staphylococcus_phage	38.9	3.4e-139
>prophage 276
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3579817	3585220	3637729		Mycobacterium_phage(33.33%)	5	NA	NA
WP_071169131.1|3579817_3580666_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	34.5	6.3e-38
WP_008361890.1|3580781_3582647_+	DNA ligase D	NA	A0A068CDF3	Rhizobium_phage	29.6	3.6e-09
WP_008361892.1|3582681_3583377_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_008361894.1|3583417_3583651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169132.1|3584107_3585220_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	30.8	1.7e-46
>prophage 277
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3590950	3605932	3637729	portal,terminase	Bacillus_phage(75.0%)	16	NA	NA
WP_145939437.1|3590950_3591286_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	50.0	8.1e-21
WP_071169141.1|3591330_3591540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169142.1|3591693_3592176_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_071169143.1|3592181_3594107_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	42.2	5.0e-91
WP_071169144.1|3594600_3595419_+	oxidoreductase	NA	NA	NA	NA	NA
WP_071169145.1|3595493_3596150_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083381147.1|3596433_3596580_-	peptidoglycan-binding protein	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	73.7	2.1e-10
WP_145939421.1|3596542_3596749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169146.1|3597979_3598561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169147.1|3599518_3601048_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.3	7.2e-141
WP_071169148.1|3601044_3602349_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.2	2.0e-152
WP_008362206.1|3602348_3603068_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	67.3	9.4e-67
WP_071169149.1|3603239_3603641_-	hypothetical protein	NA	Q9T202	Bacillus_phage	79.7	9.6e-53
WP_145939422.1|3603793_3604504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169151.1|3604755_3605454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071169152.1|3605587_3605932_-	structural protein	NA	Q38579	Bacillus_phage	56.1	1.7e-26
>prophage 278
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3609051	3611001	3637729		Bacillus_phage(100.0%)	3	NA	NA
WP_071169154.1|3609051_3609537_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	44.7	3.4e-28
WP_083381149.1|3609548_3610517_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_071169155.1|3610617_3611001_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	48.4	4.9e-22
>prophage 279
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3617176	3623438	3637729		Bacillus_phage(83.33%)	6	NA	NA
WP_008360369.1|3617176_3618136_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.9	6.7e-52
WP_008360371.1|3618456_3619215_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	54.9	1.0e-47
WP_071169159.1|3619282_3619900_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	45.3	1.9e-44
WP_008360375.1|3619985_3620966_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.9	2.4e-150
WP_071169160.1|3620983_3623086_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	83.4	0.0e+00
WP_008360380.1|3623045_3623438_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	54.2	6.1e-28
>prophage 280
NZ_CP017786	Bacillus xiamenensis strain VV3 chromosome, complete genome	3637729	3628430	3633224	3637729		Bacillus_phage(75.0%)	4	NA	NA
WP_008360402.1|3628430_3629165_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	46.3	1.4e-41
WP_071169165.1|3629747_3631070_+	S8 family peptidase	NA	A0A2P0VP02	Tetraselmis_virus	29.6	1.2e-14
WP_008360407.1|3631161_3632310_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.7	2.3e-67
WP_071169166.1|3632474_3633224_-	poly-gamma-glutamate hydrolase family protein	NA	A0A172JHX8	Bacillus_phage	40.0	1.9e-33
