The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	201572	272277	4352852	tRNA,protease,transposase,coat	Pandoravirus(20.0%)	57	NA	NA
WP_003440504.1|201572_202514_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440507.1|202942_206047_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	35.3	4.8e-184
WP_003440509.1|206279_207278_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003440511.1|207364_207949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440514.1|208040_208445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440516.1|208720_209650_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440519.1|209764_210046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440522.1|210395_210581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087946533.1|210917_211064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760344.1|211161_211335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440545.1|213829_215353_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003440548.1|215432_215627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158380935.1|217271_217916_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003440556.1|218624_219383_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003440571.1|219560_223613_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003440573.1|223704_224277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440576.1|224483_226478_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	3.4e-05
WP_003440580.1|226501_227725_+	peptidase T	NA	NA	NA	NA	NA
WP_003440583.1|227729_228092_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003440585.1|228588_230778_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	26.6	1.1e-25
WP_003440587.1|230959_231643_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144311755.1|231639_233052_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003440593.1|233294_233858_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	44.9	3.3e-35
WP_034830481.1|233905_234382_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003440599.1|234451_235261_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.6	9.4e-23
WP_003440602.1|235262_236090_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	36.2	1.4e-13
WP_087946534.1|236086_236503_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_003440606.1|236472_237210_-	class B sortase	NA	NA	NA	NA	NA
WP_003440607.1|237482_238748_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174548957.1|238816_239506_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.8	5.7e-37
WP_003440617.1|239502_240699_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_034830476.1|240721_241696_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	41.3	2.8e-50
WP_003440623.1|241865_242642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440625.1|242871_243780_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003440628.1|243784_245086_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003440630.1|245066_245903_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003440633.1|246494_247874_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003440637.1|248189_249455_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003440640.1|249709_250852_-	glycosyltransferase family 4 protein	NA	A0A1X9SKE5	Sulfolobus_islandicus_rod-shaped_virus	26.8	4.3e-05
WP_003440641.1|251007_252018_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440642.1|252026_252239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440643.1|252245_253004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440644.1|253146_254175_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_034830471.1|255705_256833_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003440649.1|257016_258021_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440652.1|258135_259116_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_003440655.1|259361_259598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440657.1|260108_261671_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_003440660.1|261806_262649_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003440664.1|262766_263651_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_003440666.1|264165_264579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440668.1|264729_265845_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_003440673.1|265873_267037_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003440676.1|267333_268707_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_003440679.1|268898_269930_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003440682.1|270124_270541_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_034830312.1|270648_272277_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	30.6	4.3e-51
>prophage 2
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	986045	1022208	4352852	transposase,integrase	Streptococcus_phage(50.0%)	39	995670:995691	1019931:1019952
WP_034829662.1|986045_987305_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_143756607.1|988492_989425_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_003448163.1|989601_990936_+	chloride channel protein	NA	NA	NA	NA	NA
WP_003448166.1|991424_991994_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_081353594.1|992023_992824_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003441125.1|992868_993198_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003448167.1|993429_994719_+	MFS transporter	NA	NA	NA	NA	NA
WP_003448168.1|994906_995398_-	hypothetical protein	NA	NA	NA	NA	NA
995670:995691	attL	ACTTGGCGTTGAACTCCTACTT	NA	NA	NA	NA
WP_003448169.1|995979_996714_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	62.3	6.2e-90
WP_003448170.1|996943_997123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003448171.1|997162_997681_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003448173.1|997709_997856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003448174.1|997902_998562_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_003448176.1|998657_999041_+	VOC family protein	NA	NA	NA	NA	NA
WP_003448180.1|999368_999833_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_051035279.1|1000366_1001038_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_034829492.1|1001133_1001628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003448185.1|1001664_1002231_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_003448186.1|1002262_1002445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003448187.1|1002655_1002871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155760355.1|1003073_1003250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152414189.1|1003392_1003752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003448189.1|1003860_1004328_+	VOC family protein	NA	NA	NA	NA	NA
WP_003448191.1|1005047_1005458_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_003448192.1|1005496_1006453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003448194.1|1006509_1007265_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	9.7e-22
WP_003448196.1|1007360_1007681_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003448197.1|1007785_1008322_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003448198.1|1008970_1010563_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003448199.1|1010773_1011655_-	radical SAM protein	NA	NA	NA	NA	NA
WP_003448200.1|1011791_1012079_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003448201.1|1012484_1013849_-	radical SAM protein	NA	NA	NA	NA	NA
WP_003448202.1|1013878_1014409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003448280.1|1014501_1014876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034829696.1|1014875_1016837_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003448282.1|1016829_1017957_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_003444851.1|1018294_1019620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444848.1|1020002_1020608_-	hypothetical protein	NA	NA	NA	NA	NA
1019931:1019952	attR	ACTTGGCGTTGAACTCCTACTT	NA	NA	NA	NA
WP_003444845.1|1020981_1022208_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	2062084	2070409	4352852		uncultured_Mediterranean_phage(42.86%)	8	NA	NA
WP_003444245.1|2062084_2062963_+	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	25.8	6.0e-15
WP_003444249.1|2063046_2064213_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003444257.1|2064225_2065041_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.7	1.8e-53
WP_003444259.1|2065123_2065942_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	47.5	3.3e-60
WP_003444261.1|2065960_2067262_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	62.5	5.9e-144
WP_003444263.1|2067441_2068653_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.0	5.7e-32
WP_003444265.1|2069070_2069829_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_034830758.1|2069812_2070409_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.3	1.1e-20
>prophage 4
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	2086226	2136108	4352852	bacteriocin,transposase,protease,coat,tRNA,integrase	Paenibacillus_phage(22.22%)	42	2114338:2114353	2117509:2117524
WP_003444313.1|2086226_2087279_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003444314.1|2087453_2088326_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155760368.1|2088392_2088539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444315.1|2088997_2090329_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003444316.1|2090373_2093001_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	27.5	3.2e-56
WP_003444318.1|2093076_2094969_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.5	2.1e-81
WP_034830709.1|2095107_2096046_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_174548953.1|2096146_2096398_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003444325.1|2097142_2098264_+	nitrogenase component 1	NA	NA	NA	NA	NA
WP_003444327.1|2098426_2099704_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003444329.1|2099865_2100477_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	39.7	1.9e-12
WP_003444331.1|2100733_2101297_-|protease	tesA-like protease	protease	NA	NA	NA	NA
WP_003444332.1|2101381_2101636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444335.1|2102072_2102753_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003444338.1|2102807_2103683_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003444339.1|2103958_2105893_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_003444341.1|2106175_2107159_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	E3SJ83	Synechococcus_phage	25.7	1.1e-09
WP_003444343.1|2107160_2108135_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_003444345.1|2108182_2109499_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_003444347.1|2109512_2110904_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.9	1.8e-53
WP_003444349.1|2111165_2111741_+	arylesterase	NA	NA	NA	NA	NA
WP_003444351.1|2112064_2112475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444353.1|2112592_2113582_-	tyrosine recombinase XerC	NA	A0A2R2ZHE2	Clostridioides_phage	26.3	8.8e-15
2114338:2114353	attL	AAAAAGTCAAATTATT	NA	NA	NA	NA
WP_003448320.1|2114540_2115347_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_034829662.1|2115362_2116622_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155760369.1|2119222_2119372_+	hypothetical protein	NA	NA	NA	NA	NA
2117509:2117524	attR	AATAATTTGACTTTTT	NA	NA	NA	NA
WP_003442373.1|2119812_2121033_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003442371.1|2121046_2122168_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003442369.1|2122412_2123249_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003442366.1|2123261_2124116_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003442365.1|2124153_2124666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442364.1|2124686_2126048_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_034830050.1|2126351_2126657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442362.1|2126978_2128370_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003442361.1|2128481_2130326_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	24.0	4.3e-15
WP_143756567.1|2130406_2130601_-|bacteriocin	CA_C0660 family putative sactipeptide bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003442358.1|2130691_2132053_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.4	1.3e-13
WP_034830048.1|2132062_2133628_-	radical SAM protein	NA	NA	NA	NA	NA
WP_087946539.1|2133945_2134089_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_051035244.1|2134090_2134705_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_076719024.1|2134810_2135098_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143756622.1|2135187_2136108_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	21.6	9.3e-11
>prophage 5
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	2552951	2609852	4352852	transposase,portal,capsid,terminase,head,tRNA,integrase,tail	Bacillus_phage(23.81%)	59	2599179:2599198	2612511:2612530
WP_003441319.1|2552951_2553689_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003441315.1|2553874_2554399_+	rubrerythrin	NA	NA	NA	NA	NA
WP_003441311.1|2554511_2555867_-	nitrogenase	NA	NA	NA	NA	NA
WP_003441308.1|2555903_2557454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441306.1|2557969_2559721_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_034829996.1|2559992_2560136_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_003441304.1|2560554_2561337_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	65.3	6.9e-39
WP_003441302.1|2561482_2563267_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.9	3.8e-16
WP_003441298.1|2563647_2564229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441294.1|2564724_2565561_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003441290.1|2565567_2566482_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	27.3	5.6e-16
WP_003441287.1|2566783_2567905_-	DUF4885 family protein	NA	NA	NA	NA	NA
WP_003441284.1|2567950_2568838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440352.1|2569611_2570907_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003441281.1|2571073_2571661_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003441277.1|2572276_2573443_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003441274.1|2573512_2573878_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003441270.1|2574254_2574773_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003441264.1|2575307_2575628_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003441259.1|2575827_2576097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2576112_2577339_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003441250.1|2578042_2579251_-	response regulator	NA	NA	NA	NA	NA
WP_003441247.1|2579264_2579711_-	response regulator	NA	NA	NA	NA	NA
WP_003441244.1|2579685_2583171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441241.1|2583222_2583393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441238.1|2583464_2585030_-	recombinase family protein	NA	NA	NA	NA	NA
WP_155760376.1|2585112_2585253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441235.1|2585383_2586799_-	hypothetical protein	NA	Q0H227	Geobacillus_phage	27.5	6.9e-21
WP_003441232.1|2586815_2588444_-|tail	phage tail protein	tail	A0A0A7RUI9	Clostridium_phage	38.7	2.1e-50
WP_003441229.1|2588443_2589145_-|tail	phage tail family protein	tail	A0A0A7RWN1	Clostridium_phage	39.3	6.2e-39
WP_003441227.1|2589144_2591004_-	hypothetical protein	NA	M4QNS0	Tetraselmis_viridis_virus	24.6	7.2e-18
WP_003441224.1|2591003_2591324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441221.1|2591341_2591677_-	hypothetical protein	NA	A0A0U4KKN8	Bacillus_phage	33.3	1.2e-05
WP_003441218.1|2591803_2592373_-	hypothetical protein	NA	A0A0U4IS63	Bacillus_phage	40.6	8.8e-36
WP_152982474.1|2592390_2592777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441214.1|2592766_2593105_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003441209.1|2593094_2593397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441207.1|2593401_2593698_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003441204.1|2593707_2593893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441203.1|2593978_2595028_-|capsid	major capsid protein	capsid	S5MNB6	Brevibacillus_phage	72.2	2.1e-144
WP_003441202.1|2595049_2595433_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	62.2	3.5e-36
WP_003441201.1|2595449_2596007_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_034829991.1|2596289_2596745_-	hypothetical protein	NA	A6N234	Microbacterium_phage	48.6	1.7e-18
WP_003441199.1|2596827_2597244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760556.1|2597570_2597912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441190.1|2597874_2598774_-|capsid	minor capsid protein	capsid	S5M601	Brevibacillus_phage	30.0	8.2e-20
WP_003441188.1|2598760_2600038_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.3	5.6e-62
2599179:2599198	attL	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
WP_003441184.1|2600099_2600519_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003441180.1|2600515_2600983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441177.1|2600988_2601408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034829988.1|2601480_2603031_-|terminase	phage terminase large subunit	terminase	A0A0N7AEF1	Bacillus_phage	35.6	9.7e-77
WP_003441172.1|2603200_2604250_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	30.6	1.6e-27
WP_003441170.1|2604279_2605125_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	28.9	3.5e-20
WP_003441168.1|2605309_2606014_-	hypothetical protein	NA	A0A2H4JAE2	uncultured_Caudovirales_phage	47.9	1.9e-24
WP_003441166.1|2606066_2606729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441163.1|2606851_2607274_-	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	35.6	4.0e-17
WP_003441161.1|2607344_2608253_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	45.5	6.9e-67
WP_003441158.1|2608341_2608611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441156.1|2608607_2609852_-	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	50.7	1.8e-121
2612511:2612530	attR	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
>prophage 6
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	2647488	2661861	4352852		Synechococcus_phage(33.33%)	10	NA	NA
WP_003447551.1|2647488_2648991_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.8	2.5e-61
WP_003447550.1|2649379_2649997_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	1.5e-20
WP_003447549.1|2649984_2650980_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	45.1	2.1e-64
WP_003447548.1|2651000_2652410_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.8	2.0e-57
WP_003447546.1|2652435_2653146_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.7	5.3e-46
WP_003447544.1|2653145_2653625_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	1.9e-31
WP_003447542.1|2654224_2657986_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.1	1.3e-34
WP_003447540.1|2658198_2658723_+	tryptophan transporter	NA	NA	NA	NA	NA
WP_003447538.1|2659029_2659401_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	32.7	1.7e-11
WP_003447537.1|2659575_2661861_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.6	7.5e-110
>prophage 7
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	2829030	2885341	4352852	tRNA,protease,transposase	Bacillus_phage(21.43%)	47	NA	NA
WP_051803910.1|2829030_2830359_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003442552.1|2831433_2832591_-	putative DNA binding domain-containing protein	NA	A0A1B3AYT3	Gordonia_phage	28.7	3.0e-22
WP_003442554.1|2835356_2835905_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	45.2	8.8e-33
WP_003442556.1|2836088_2836871_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003442558.1|2836986_2837358_-	VOC family protein	NA	NA	NA	NA	NA
WP_003442561.1|2837613_2838354_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003442563.1|2838466_2838730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003442565.1|2838948_2839839_-	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_003442574.1|2840029_2840863_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003442575.1|2840940_2841684_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003442578.1|2841715_2842819_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_034829953.1|2842954_2844082_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003442592.1|2844280_2844499_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_003442595.1|2844607_2845255_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_071167516.1|2845527_2846208_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003442599.1|2846375_2847401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442602.1|2847411_2848440_-	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	26.9	1.2e-09
WP_003442605.1|2848582_2849623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442608.1|2849640_2850723_-	phosphodiester glycosidase family protein	NA	A0A291LB83	Escherichia_phage	37.2	4.5e-12
WP_003442611.1|2851044_2852421_-	PhoH family protein	NA	A0A141HS37	Bacillus_phage	48.0	9.7e-121
WP_003442614.1|2852894_2853323_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003442617.1|2853437_2854388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003441259.1|2854555_2854825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2854840_2856067_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003442620.1|2856390_2856975_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003442623.1|2856955_2859298_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.6	9.9e-174
WP_003442626.1|2859421_2861098_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	33.1	1.0e-15
WP_003442629.1|2861244_2862549_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.4e-140
WP_003442632.1|2862568_2863153_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.2	4.8e-53
WP_003442635.1|2863276_2864572_-	trigger factor	NA	NA	NA	NA	NA
WP_003442639.1|2864795_2865578_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003442642.1|2865601_2866393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442644.1|2866795_2869984_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_003442647.1|2870093_2871179_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.0	1.5e-55
WP_003442650.1|2871524_2873042_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_003442654.1|2873253_2873835_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	31.0	6.3e-05
WP_003442657.1|2873980_2874880_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003442660.1|2874872_2875613_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_003442668.1|2875797_2876661_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003442670.1|2876672_2877860_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003442673.1|2878075_2878498_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003442675.1|2878498_2879422_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.7	1.7e-52
WP_003442677.1|2879894_2880500_+	DedA family protein	NA	NA	NA	NA	NA
WP_003442679.1|2880677_2881250_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003442680.1|2881292_2883032_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.1	3.4e-62
WP_003442685.1|2883303_2883507_+	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_034829948.1|2883712_2885341_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	30.6	2.5e-51
>prophage 8
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	3683723	3786053	4352852	transposase,portal,protease,capsid,terminase,head,tRNA,integrase,tail	Clostridium_phage(47.37%)	102	3732542:3732601	3769206:3769281
WP_003444845.1|3683723_3684950_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_051035266.1|3685068_3685836_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	37.1	3.2e-20
WP_003446396.1|3685981_3687052_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_003446394.1|3687246_3687939_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_003446392.1|3687940_3688912_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003446391.1|3688915_3689497_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	44.0	7.1e-49
WP_003446387.1|3689677_3692347_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	28.2	1.6e-82
WP_003446386.1|3692659_3695044_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.0	1.1e-143
WP_003446383.1|3695333_3695555_-	NifU family protein	NA	NA	NA	NA	NA
WP_003446380.1|3695740_3696157_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446377.1|3696434_3697070_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_003446375.1|3697314_3697656_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003446373.1|3697796_3697964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003446371.1|3698127_3699636_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_003446369.1|3699660_3700509_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003446368.1|3700511_3701453_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003446367.1|3701688_3703005_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003446366.1|3703119_3704097_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003446365.1|3704395_3705367_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003446364.1|3705470_3706325_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446363.1|3706758_3707586_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003446362.1|3707682_3707877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003446005.1|3713745_3714222_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_003446003.1|3714347_3715103_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003446001.1|3715099_3715846_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003446000.1|3715872_3716394_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_087946548.1|3716396_3718274_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_162838520.1|3718329_3720186_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003445997.1|3720548_3721181_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003445996.1|3721549_3721723_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003445995.1|3722058_3722835_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003445993.1|3723599_3723890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445991.1|3724235_3724667_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003445989.1|3724673_3725072_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003445982.1|3725068_3725482_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003445981.1|3726874_3727420_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_034829853.1|3727938_3728295_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_003445979.1|3729030_3730062_-	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
WP_003445978.1|3730217_3731702_-	Lsa family ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	26.6	1.1e-24
3732542:3732601	attL	TTTTGGCAGGGGCAGTAGGATTTGAACCCACAACCAATGGTTTTGGAGACCACTACTCTA	NA	NA	NA	NA
WP_003445977.1|3733243_3733453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838519.1|3733468_3733615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081387060.1|3733626_3734046_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_003445973.1|3734463_3734688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076719123.1|3734710_3736585_-|tail	phage tail protein	tail	H7BV46	unidentified_phage	28.3	3.0e-24
WP_003445971.1|3736767_3737145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445969.1|3737123_3737540_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_003445967.1|3737872_3738169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445965.1|3738186_3740028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445964.1|3740086_3740797_-|tail	phage tail family protein	tail	A0A286QN36	Streptococcus_phage	29.1	1.9e-19
WP_003445963.1|3740797_3743362_-|tail	phage tail tape measure protein	tail	A0A1L2BYA6	Clostridium_phage	45.4	3.8e-70
WP_034830073.1|3743583_3743883_-	hypothetical protein	NA	A0A1L2BYA4	Clostridium_phage	40.2	4.7e-12
WP_003445960.1|3743936_3744512_-|tail	phi13 family phage major tail protein	tail	A0A1L2BYA0	Clostridium_phage	58.9	2.2e-58
WP_003445958.1|3744532_3744865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445955.1|3744867_3745251_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	38.8	1.1e-16
WP_003445954.1|3745250_3745610_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_003445953.1|3745610_3745901_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003445952.1|3745947_3747042_-|capsid	phage major capsid protein	capsid	I2E8V4	Clostridium_phage	53.6	2.3e-96
WP_003445951.1|3747100_3747700_-|head,protease	HK97 family phage prohead protease	head,protease	D7PQ42	Enterococcus_phage	40.9	4.9e-29
WP_003445950.1|3747704_3748922_-|portal	phage portal protein	portal	I2E8V3	Clostridium_phage	41.5	9.6e-80
WP_003445949.1|3748922_3749126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445948.1|3749142_3750828_-|terminase	terminase large subunit	terminase	A0A0A7RUM0	Clostridium_phage	52.0	8.4e-167
WP_003445945.1|3750827_3751286_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7RUQ4	Clostridium_phage	62.7	4.3e-41
WP_003445944.1|3751475_3751910_-	hypothetical protein	NA	Q0SPJ9	Clostridium_phage	36.6	4.7e-13
WP_155760388.1|3751912_3752077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445943.1|3752182_3752452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034830069.1|3752463_3752802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445941.1|3753079_3753301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445940.1|3753380_3753695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034830067.1|3753696_3754149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445937.1|3754148_3754409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445933.1|3754543_3755056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445931.1|3755149_3755899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445929.1|3756424_3758584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760390.1|3758609_3758777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445927.1|3758863_3762151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445925.1|3762656_3762857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445923.1|3762876_3763599_-	hypothetical protein	NA	A0A0K2FM38	Brevibacillus_phage	28.0	1.6e-10
WP_003445921.1|3763672_3764014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445919.1|3764164_3764392_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003445915.1|3764465_3765341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445914.1|3765344_3766478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445912.1|3766571_3766808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445910.1|3767450_3767702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445908.1|3767717_3768032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445907.1|3768034_3769048_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.0	8.1e-32
WP_003445904.1|3769523_3769946_-	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
3769206:3769281	attR	TTTTGGCAGGGGCAGTAGGATTTGAACCCACAACCAATGGTTTTGGAGACCACTACTCTACCGTTGAGCCATACCC	NA	NA	NA	NA
WP_003445901.1|3770017_3770842_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445899.1|3771087_3771471_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003445897.1|3771484_3772387_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003445895.1|3772576_3773839_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003445893.1|3774059_3774518_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003445892.1|3774514_3775228_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003445890.1|3775220_3775670_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003445888.1|3775763_3776387_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003445886.1|3776683_3778840_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_003445883.1|3779113_3779440_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003445881.1|3779604_3780159_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_143756631.1|3780187_3781135_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003445878.1|3781189_3782497_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003445876.1|3782520_3784008_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003445875.1|3784009_3784912_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003445871.1|3784976_3786053_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	4025420	4082710	4352852	tRNA,holin,transposase,coat	Streptococcus_phage(18.75%)	56	NA	NA
WP_158380946.1|4025420_4025567_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_034830606.1|4025677_4027231_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003447816.1|4027314_4027503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034830604.1|4027588_4028359_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.1	4.9e-37
WP_003447612.1|4029974_4030652_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_003447614.1|4030683_4031061_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003447615.1|4031090_4032278_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003447617.1|4032274_4032961_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	2.0e-34
WP_003447619.1|4032938_4033991_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155760402.1|4034115_4034280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447621.1|4034269_4034944_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.4	1.9e-13
WP_003447623.1|4034960_4035461_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003447630.1|4037372_4037693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447632.1|4038309_4039662_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003447635.1|4039855_4040377_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003447637.1|4040433_4041087_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003447638.1|4041279_4041720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447640.1|4041766_4043323_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	7.8e-50
WP_003447643.1|4043443_4044154_-	2-phosphosulfolactate phosphatase family protein	NA	NA	NA	NA	NA
WP_003447646.1|4044278_4045229_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003447648.1|4045240_4046350_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	31.8	1.4e-21
WP_143756599.1|4046444_4047374_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	43.9	1.7e-31
WP_003447653.1|4047470_4048628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447655.1|4048884_4049931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447656.1|4050016_4050916_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003447659.1|4051057_4052857_-	heme NO-binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	1.0e-05
WP_003447661.1|4052876_4053551_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003447663.1|4053556_4053943_-	DUF3783 domain-containing protein	NA	NA	NA	NA	NA
WP_003447665.1|4053998_4054514_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.9	3.5e-23
WP_003447666.1|4054666_4055446_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003447667.1|4055869_4057957_+	glutamine synthetase III	NA	NA	NA	NA	NA
WP_003447668.1|4058050_4058857_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.6	1.0e-37
WP_003447669.1|4059027_4059828_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.8	4.2e-60
WP_003447670.1|4059856_4061113_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.3	5.0e-108
WP_034830663.1|4061189_4061444_+	DUF4491 family protein	NA	NA	NA	NA	NA
WP_003447672.1|4061529_4062921_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.0	1.3e-83
WP_003447673.1|4063298_4065140_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	25.5	2.9e-27
WP_003447684.1|4065192_4065357_-	rubredoxin	NA	NA	NA	NA	NA
WP_003447686.1|4065569_4066106_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003447688.1|4066160_4066388_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003447690.1|4066389_4067316_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	40.7	2.6e-61
WP_003447691.1|4067668_4067965_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_003447692.1|4067985_4068258_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_003447694.1|4068288_4068861_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_003447696.1|4069064_4069604_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_143756635.1|4069608_4070175_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_158380947.1|4070285_4070447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168170744.1|4070604_4070760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447703.1|4070918_4072307_-	Fe-only nitrogenase subunit beta	NA	NA	NA	NA	NA
WP_003447705.1|4072322_4072673_-	Fe-only nitrogenase subunit delta	NA	NA	NA	NA	NA
WP_003447707.1|4072688_4074266_-	nitrogenase iron-iron protein, alpha chain	NA	NA	NA	NA	NA
WP_003440352.1|4074674_4075970_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003447709.1|4076155_4076983_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_003447711.1|4078072_4079830_-	ATP-dependent RNA helicase	NA	A0A248SJQ0	Salicola_phage	31.7	2.5e-60
WP_003447713.1|4080005_4081580_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143756600.1|4081579_4082710_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	44.2	2.6e-18
>prophage 10
NZ_CP013018	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4352852	4269572	4325917	4352852	holin,transposase,protease,terminase,integrase	Clostridium_phage(81.08%)	59	4288800:4288817	4335232:4335249
WP_051035257.1|4269572_4270028_+|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	32.0	1.5e-09
WP_158380949.1|4270084_4270246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003445019.1|4270565_4271882_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445018.1|4272292_4274011_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003445017.1|4274273_4275590_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445015.1|4276009_4276687_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445014.1|4276712_4277732_-	sugar kinase	NA	NA	NA	NA	NA
WP_003445013.1|4277750_4278395_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003445012.1|4278637_4279402_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445011.1|4279779_4280220_+	Hsp20/alpha crystallin family protein	NA	A0A218MMV3	uncultured_virus	31.1	1.6e-05
WP_003445010.1|4280852_4281350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445009.1|4281404_4282388_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RUJ1	Clostridium_phage	42.2	2.0e-35
WP_003445002.1|4282406_4282796_-|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	56.7	9.6e-34
WP_003445000.1|4282838_4289741_-	carbohydrate binding domain-containing protein	NA	M9Q2I5	Clostridium_phage	39.7	1.2e-62
4288800:4288817	attL	ATAATTAATACTGTTGGA	NA	NA	NA	NA
WP_003444998.1|4289767_4290145_-	hypothetical protein	NA	M9Q2L1	Clostridium_phage	47.2	1.7e-22
WP_034830556.1|4290210_4290480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444994.1|4290659_4291007_-	hypothetical protein	NA	M9Q2F8	Clostridium_phage	58.3	6.8e-31
WP_003444992.1|4291017_4295145_-	transglycosylase SLT domain-containing protein	NA	M9Q251	Clostridium_phage	46.7	7.5e-100
WP_003444989.1|4295185_4295605_-	hypothetical protein	NA	M9Q2L2	Clostridium_phage	60.9	5.9e-21
WP_034830554.1|4295665_4295974_-	bacteriophage Gp15 protein	NA	M9Q2I4	Clostridium_phage	73.3	8.7e-38
WP_003444987.1|4295988_4296318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444986.1|4296339_4296795_-	hypothetical protein	NA	M9Q1I1	Clostridium_phage	59.7	1.1e-47
WP_003444985.1|4296805_4297192_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	68.0	2.6e-47
WP_003444984.1|4297191_4297575_-	hypothetical protein	NA	M9Q249	Clostridium_phage	64.6	8.3e-38
WP_003444983.1|4297574_4297901_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	54.3	4.1e-30
WP_003444966.1|4297909_4298269_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	56.7	3.7e-32
WP_003444957.1|4298271_4298559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444955.1|4298569_4299535_-	hypothetical protein	NA	A0A1J0MCK3	Streptomyces_phage	55.2	4.4e-88
WP_003444953.1|4299550_4300150_-	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	42.6	2.9e-29
WP_003444951.1|4300288_4300453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143756604.1|4300435_4300636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444947.1|4300646_4300889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444945.1|4300956_4301280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444943.1|4302915_4304421_-	hypothetical protein	NA	M9Q246	Clostridium_phage	63.0	1.3e-182
WP_034830630.1|4304423_4305815_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	72.9	2.0e-198
WP_034830628.1|4305807_4306329_-|transposase	transposase	transposase	A0A0A7RTH0	Clostridium_phage	73.3	2.0e-58
WP_003444940.1|4306545_4307094_-	hypothetical protein	NA	I2E8Y5	Clostridium_phage	30.2	8.6e-12
WP_003444939.1|4307106_4308471_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	62.1	1.7e-162
WP_003444938.1|4308467_4308746_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	52.2	3.1e-18
WP_003444935.1|4309017_4311444_-	putative virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	79.2	0.0e+00
WP_155760405.1|4311478_4311625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444933.1|4311904_4312930_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	33.1	2.1e-43
WP_003444932.1|4312944_4314903_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	78.2	0.0e+00
WP_003444931.1|4314907_4315468_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	84.9	4.4e-88
WP_003444930.1|4315589_4316753_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	66.8	6.2e-145
WP_003444929.1|4316754_4317204_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	32.3	1.6e-08
WP_003444928.1|4317239_4317500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444927.1|4317513_4317975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444925.1|4318295_4318907_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003444924.1|4318893_4319160_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	49.3	8.4e-13
WP_003444922.1|4319290_4319533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444920.1|4319566_4319707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444918.1|4319872_4320040_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	64.2	8.9e-13
WP_003444916.1|4320056_4320305_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	59.7	4.4e-16
WP_003444915.1|4320491_4320932_+	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	57.8	7.3e-22
WP_003444914.1|4320965_4321427_+	hypothetical protein	NA	A0A0A7RVV2	Clostridium_phage	57.9	2.6e-46
WP_003444913.1|4321518_4322568_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	63.8	1.1e-127
WP_003444912.1|4322639_4323971_-	replicative DNA helicase	NA	O80281	Escherichia_phage	47.7	4.2e-105
WP_174548956.1|4323994_4325917_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	23.2	1.0e-22
4335232:4335249	attR	TCCAACAGTATTAATTAT	NA	NA	NA	NA
