The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016394	Streptococcus thermophilus strain ND07, complete genome	1869510	4875	80945	1869510	transposase,bacteriocin,integrase,protease,tRNA	Streptococcus_phage(38.89%)	64	121:146	81086:81111
121:146	attL	TCTAACTTTTGGGGTGCAGTTCATTT	NA	NA	NA	NA
WP_014621488.1|4875_5568_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014621486.1|6389_6584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014621484.1|8566_9199_+	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	48.8	9.5e-47
WP_106693466.1|12686_14256_+|transposase	IS3-like element ISSth1b family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.0e-53
WP_014621469.1|14515_14716_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	90.9	3.4e-27
WP_002944716.1|14995_15196_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	53.1	1.1e-12
WP_081005008.1|15284_15509_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002945081.1|16506_17418_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	7.1e-104
WP_014621467.1|17414_18389_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	73.8	4.0e-137
WP_011225838.1|18385_19276_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	3.3e-05
WP_014621466.1|19256_20027_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_014608216.1|20231_20420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014608215.1|21240_21732_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	56.7	1.8e-45
WP_014608214.1|21851_22568_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	46.9	3.4e-61
WP_014608213.1|22560_23004_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	56.3	3.5e-40
WP_024704316.1|23003_23657_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	55.9	9.7e-63
WP_002950526.1|23831_24212_-	RidA family protein	NA	NA	NA	NA	NA
WP_011681059.1|25727_27074_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.8	1.9e-57
WP_004197254.1|27110_28292_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011681058.1|28296_28779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014608206.1|28923_31410_-	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	47.6	1.5e-212
WP_011681057.1|31504_32140_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	60.5	4.5e-73
WP_011681056.1|32243_33200_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002950506.1|33201_34269_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024704315.1|34261_35800_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.5e-16
WP_002950498.1|35913_36984_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	38.1	6.7e-53
WP_002950496.1|37046_37445_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_014621456.1|38166_38967_-	hypothetical protein	NA	A0A0H3UZD4	Geobacillus_virus	43.4	2.2e-48
WP_002950491.1|38947_39358_-	glycosyl transferase family 3	NA	A0A0H3UZD4	Geobacillus_virus	64.8	4.6e-42
WP_002950490.1|39396_39987_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002950487.1|40309_41230_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.6	3.8e-36
WP_002947597.1|41298_41535_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_014621725.1|41634_42939_-|transposase	ISL3-like element ISSth1 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	71.0	1.3e-167
WP_024704321.1|44760_49617_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	27.7	4.3e-06
WP_011681051.1|50441_51980_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_011681050.1|52097_53168_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014621445.1|53526_54738_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.4	1.0e-166
WP_087009847.1|54928_56499_-|transposase	IS3-like element ISSth1b family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.0e-53
WP_014621443.1|56599_57115_-	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	29.8	1.1e-05
WP_014621442.1|57134_57296_-	histidine kinase	NA	NA	NA	NA	NA
WP_014621441.1|57318_57642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014621440.1|57719_58019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024704082.1|58868_60539_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_002948206.1|60732_61416_+	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_014608202.1|61408_61954_+	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	35.6	4.4e-24
WP_011681047.1|61981_62554_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_024704080.1|62636_64355_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	83.0	2.9e-271
WP_014621437.1|64494_65370_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_002950451.1|65558_67808_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_002948199.1|68136_68472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011227104.1|68587_69754_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	69.3	1.9e-154
WP_014608201.1|69836_70349_-	helix-turn-helix transcriptional regulator	NA	A0A286QPK5	Streptococcus_phage	52.8	4.0e-19
WP_014608200.1|70511_70709_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	67.7	1.9e-17
WP_024704078.1|70947_71241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024704077.1|71244_71439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024704076.1|71452_71689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011227098.1|71931_72204_+	MerR family transcriptional regulator	NA	A0A1X9I5U9	Streptococcus_phage	50.6	1.4e-18
WP_024704075.1|72218_73079_+	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	62.5	3.1e-101
WP_024704074.1|73068_74574_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	35.7	2.2e-62
WP_024704073.1|74871_75057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014727423.1|75073_75349_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	45.2	7.8e-14
WP_014727422.1|75832_75994_+	hypothetical protein	NA	A3F673	Streptococcus_phage	45.0	2.0e-06
WP_014608193.1|76413_78132_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.2	2.1e-27
WP_014621434.1|78308_80945_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	29.2	2.8e-84
81086:81111	attR	AAATGAACTGCACCCCAAAAGTTAGA	NA	NA	NA	NA
>prophage 2
NZ_CP016394	Streptococcus thermophilus strain ND07, complete genome	1869510	85307	94232	1869510		Bacillus_phage(50.0%)	8	NA	NA
WP_011681022.1|85307_86858_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	29.3	2.0e-42
WP_002885174.1|86866_86998_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_011681020.1|87174_88923_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	7.1e-52
WP_011681019.1|88912_90652_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	2.6e-46
WP_014621429.1|90684_91296_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.0	4.6e-22
WP_014608183.1|91297_92275_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011227085.1|92281_93532_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.1	2.0e-96
WP_002948474.1|93626_94232_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	33.7	8.0e-19
>prophage 3
NZ_CP016394	Streptococcus thermophilus strain ND07, complete genome	1869510	206316	219365	1869510		Streptococcus_phage(77.78%)	12	NA	NA
WP_011225712.1|206316_207483_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	1.6e-39
WP_011680944.1|207483_208551_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011680943.1|208563_209421_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002947238.1|209410_210088_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	100.0	1.9e-122
WP_024009810.1|210084_211248_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	99.2	1.7e-219
WP_002947233.1|211409_213596_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	99.2	0.0e+00
WP_011680940.1|213757_213943_+	hypothetical protein	NA	W6LMT3	Streptococcus_phage	96.7	3.0e-25
WP_011680939.1|214094_215399_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	99.5	1.4e-246
WP_011680938.1|215607_216063_+	YueI family protein	NA	W6LLD2	Streptococcus_phage	98.0	2.2e-77
WP_011680937.1|216109_217225_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	99.6	5.2e-157
WP_014608125.1|218107_218305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197422.1|218363_219365_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	27.3	3.7e-21
>prophage 4
NZ_CP016394	Streptococcus thermophilus strain ND07, complete genome	1869510	822894	838466	1869510	tRNA	Streptococcus_phage(30.0%)	15	NA	NA
WP_011226709.1|822894_824517_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	5.4e-46
WP_011681764.1|824583_825456_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	4.8e-33
WP_011681763.1|825883_826906_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011227627.1|827082_828564_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.3	6.8e-96
WP_024704278.1|828732_829833_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_106693492.1|829822_830212_-	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	68.4	2.9e-22
WP_024704277.1|830290_831541_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	39.9	5.0e-92
WP_024704276.1|831542_832820_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	28.1	1.3e-21
WP_011681760.1|832878_833736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024704275.1|833748_834291_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002947776.1|834303_835134_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.3	4.5e-20
WP_002947774.1|835109_835952_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	2.1e-17
WP_002952279.1|835944_836739_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_011226701.1|837042_837597_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	42.2	3.1e-25
WP_011681757.1|837836_838466_+	hypothetical protein	NA	Q4Z8Z7	Staphylococcus_phage	45.2	3.6e-22
>prophage 5
NZ_CP016394	Streptococcus thermophilus strain ND07, complete genome	1869510	917839	975034	1869510	integrase,protease,tRNA,transposase	Staphylococcus_phage(28.57%)	51	932913:932927	938210:938224
WP_080998441.1|917839_918589_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.2	2.5e-38
WP_014608785.1|918690_918825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_037623243.1|918964_919120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037623242.1|919216_919612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014608783.1|919669_920275_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_014608782.1|920691_921573_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_081004997.1|921656_922364_-|integrase	site-specific integrase	integrase	A0A1S5S8R9	Streptococcus_phage	37.2	1.9e-27
WP_011681068.1|922524_923700_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	27.2	6.5e-33
WP_099421058.1|924219_924471_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_024704247.1|927558_929154_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.6	2.4e-123
WP_024704246.1|929143_930370_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.3	5.2e-33
WP_001291323.1|930735_932853_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	62.7	3.1e-235
WP_003726380.1|932849_933209_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	48.2	5.4e-23
932913:932927	attL	TTTAATAAAATAGTA	NA	NA	NA	NA
WP_003331352.1|933915_934212_+	DUF4298 domain-containing protein	NA	NA	NA	NA	NA
WP_024704245.1|934240_934762_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.7	3.4e-18
WP_024704243.1|935125_935581_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	3.9e-10
WP_002953561.1|935772_935898_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014622027.1|936161_936302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002948269.1|936321_936660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011681702.1|936672_937233_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_100284920.1|937288_937837_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_002952104.1|937840_937999_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014608759.1|940380_942276_+	endopeptidase	NA	A0A1V0SHG2	Klosneuvirus	29.0	6.7e-72
938210:938224	attR	TACTATTTTATTAAA	NA	NA	NA	NA
WP_014608758.1|942414_942810_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014608756.1|943119_943947_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_037623252.1|943959_944394_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002952083.1|944377_944611_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014622016.1|944603_944942_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014622015.1|945597_947082_+	threonine synthase	NA	NA	NA	NA	NA
WP_011681699.1|947139_948429_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011681698.1|948538_948904_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_106379849.1|948936_950571_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_014622011.1|952595_954296_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	33.3	2.6e-67
WP_011226635.1|954288_954765_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002952054.1|954840_955863_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011681693.1|955988_957245_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.4	9.6e-75
WP_024704240.1|957345_959769_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002947331.1|960131_963713_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.9	6.8e-49
WP_011681690.1|963813_967452_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.6	5.6e-67
WP_014622006.1|967609_967972_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_022096896.1|968052_968994_+	late competence protein ABC transporter subunit	NA	NA	NA	NA	NA
WP_120764773.1|968875_969976_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_002946126.1|969972_970299_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011681687.1|970324_970687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024704238.1|970658_970952_+	competence protein ComGE	NA	NA	NA	NA	NA
WP_011681686.1|970935_971373_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011681685.1|971350_971668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011681684.1|971712_972669_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014608740.1|972724_973918_+	acetate kinase	NA	NA	NA	NA	NA
WP_011681681.1|974376_974652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014608739.1|974608_975034_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP016394	Streptococcus thermophilus strain ND07, complete genome	1869510	1133062	1143140	1869510	bacteriocin,transposase	uncultured_Caudovirales_phage(50.0%)	14	NA	NA
WP_011681574.1|1133062_1134430_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_011681573.1|1134444_1134606_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_024703993.1|1134623_1135964_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002948869.1|1135963_1136695_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	20.9	5.9e-08
WP_011681570.1|1136950_1137127_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011681569.1|1137145_1137346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014608662.1|1137701_1137932_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011681567.1|1138127_1138343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024703992.1|1138936_1139338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014608660.1|1139588_1139843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106693466.1|1139988_1141559_-|transposase	IS3-like element ISSth1b family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	50.9	2.0e-53
WP_011681563.1|1141752_1142442_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011681562.1|1142472_1142679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197070.1|1142843_1143140_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
