The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017754	Cupriavidus malaysiensis strain USMAA1020 isolate pure chromosome 1, complete sequence	4383984	144485	219672	4383984	tRNA,protease,holin,plate,portal,terminase,capsid	Ralstonia_virus(30.77%)	57	NA	NA
WP_071037744.1|144485_146450_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_071037743.1|146675_147551_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_071037742.1|147553_148558_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_071010414.1|148682_149627_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.3	5.3e-17
WP_071010415.1|149891_150635_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.9	2.2e-10
WP_071010417.1|150648_152478_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A1M7XV31	Cedratvirus	30.0	1.5e-15
WP_071010419.1|152481_153534_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_071010420.1|153990_155145_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_084084902.1|155439_155814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083383864.1|156358_157378_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_071010422.1|157404_158289_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_071010423.1|158503_159712_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071010425.1|159788_160532_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_071010427.1|160561_161338_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	5.8e-14
WP_071037738.1|161722_163336_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	9.8e-56
WP_071010430.1|163570_164449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071068419.1|164543_165473_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071010432.1|165585_166014_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_167366682.1|166010_168461_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.9	5.6e-111
WP_071010434.1|168669_168870_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_071068421.1|168953_169676_-	OmpW family protein	NA	NA	NA	NA	NA
WP_071037735.1|169888_170869_-	delta(1)-pyrroline-2-carboxylate reductase family protein	NA	NA	NA	NA	NA
WP_071068422.1|171020_173357_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_071068423.1|173353_174055_-	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_071068424.1|174051_180129_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
WP_071010440.1|180216_180690_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071010441.1|180900_181842_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_071068425.1|182026_182338_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_071010443.1|182456_183161_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071010444.1|183181_184756_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_071010445.1|184775_185321_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_071010446.1|186621_186900_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	44.4	1.3e-11
WP_071068426.1|187125_188097_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_071037730.1|188249_189014_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_071068427.1|189070_190045_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_071068428.1|190237_191158_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_071010451.1|191301_192429_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_084545617.1|192863_194837_+	maltoporin	NA	NA	NA	NA	NA
WP_071068429.1|194820_195567_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_071010453.1|195773_196265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903128.1|196508_197375_+	class D beta-lactamase	NA	NA	NA	NA	NA
WP_084545437.1|197790_198981_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_157903129.1|198964_199882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071068431.1|199878_201876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903130.1|201838_202546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071068432.1|203976_205008_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	79.4	6.7e-151
WP_071068433.1|205004_206786_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	80.9	6.1e-285
WP_071068434.1|206929_207802_+|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	54.9	1.7e-78
WP_071068435.1|207848_208190_+	hypothetical protein	NA	A4PE30	Ralstonia_virus	70.7	1.0e-31
WP_071068436.1|208193_209375_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.1	1.8e-06
WP_157903131.1|209642_210929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071068437.1|211320_211902_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	63.9	3.0e-55
WP_071010455.1|213257_213959_-	response regulator	NA	NA	NA	NA	NA
WP_071010456.1|214012_216442_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_071068439.1|216438_217290_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_071010458.1|217299_218670_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_071010459.1|218811_219672_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 2
NZ_CP017754	Cupriavidus malaysiensis strain USMAA1020 isolate pure chromosome 1, complete sequence	4383984	1302181	1310505	4383984		Enterobacteria_phage(66.67%)	6	NA	NA
WP_071068711.1|1302181_1303357_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	48.2	3.3e-109
WP_071014928.1|1303663_1304728_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.0	4.6e-86
WP_071068712.1|1304717_1305635_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.0	4.8e-23
WP_071068713.1|1305645_1306524_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	5.6e-98
WP_071068714.1|1306541_1307090_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.4	1.2e-53
WP_071068715.1|1308492_1310505_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.5	3.7e-20
>prophage 3
NZ_CP017754	Cupriavidus malaysiensis strain USMAA1020 isolate pure chromosome 1, complete sequence	4383984	1487280	1496229	4383984		Bacillus_phage(16.67%)	8	NA	NA
WP_071011649.1|1487280_1488666_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.2	4.9e-72
WP_071011651.1|1488737_1489685_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.4	1.3e-12
WP_071011652.1|1489750_1490743_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	33.1	1.2e-27
WP_071068751.1|1490907_1491252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071011655.1|1491646_1492951_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	64.9	2.8e-146
WP_071068752.1|1493036_1493939_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.2	4.3e-53
WP_071068753.1|1494063_1495170_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_071068754.1|1495305_1496229_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	33.5	3.7e-39
>prophage 4
NZ_CP017754	Cupriavidus malaysiensis strain USMAA1020 isolate pure chromosome 1, complete sequence	4383984	2012374	2021299	4383984		Burkholderia_virus(42.86%)	11	NA	NA
WP_071069062.1|2012374_2012554_+	hypothetical protein	NA	I6NRM1	Burkholderia_virus	52.6	3.2e-08
WP_071069064.1|2012609_2012912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069066.1|2013628_2013958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069068.1|2014011_2014236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069070.1|2014389_2015565_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	75.2	7.2e-165
WP_071069072.1|2015574_2016315_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	48.9	5.1e-52
WP_071069074.1|2016311_2016833_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	64.7	3.7e-57
WP_071069076.1|2017012_2017711_-	SOS response-associated peptidase	NA	A0A2H4J991	uncultured_Caudovirales_phage	36.7	2.6e-29
WP_071069078.1|2017755_2019684_-	hypothetical protein	NA	Q7M2A9	Enterobacteria_phage	34.3	6.3e-17
WP_071069080.1|2019869_2020205_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071069082.1|2020426_2021299_-	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	41.9	1.9e-05
>prophage 5
NZ_CP017754	Cupriavidus malaysiensis strain USMAA1020 isolate pure chromosome 1, complete sequence	4383984	3012246	3118013	4383984	tRNA,tail,protease,transposase,head,portal,terminase,capsid,integrase	Burkholderia_phage(28.0%)	150	3008046:3008098	3109662:3109714
3008046:3008098	attL	TGGTCGGGGCGAGAGGATTTGAACCTCCGACCACCTGCACCCCATGCAGGTAC	NA	NA	NA	NA
WP_071070844.1|3012246_3012612_-	DUF1353 domain-containing protein	NA	A0A1L2CVI8	Pectobacterium_phage	47.8	1.1e-15
WP_071069769.1|3012635_3013112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069770.1|3013163_3013382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071036663.1|3013371_3013860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069772.1|3013921_3015427_-	hypothetical protein	NA	A0A0B4ZZU0	Achromobacter_phage	37.9	9.1e-64
WP_071069774.1|3015442_3015829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071036656.1|3015900_3016236_-	ammonia monooxygenase	NA	A0A291AUV3	Sinorhizobium_phage	49.6	5.2e-28
WP_071069776.1|3016232_3016715_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	63.4	3.0e-45
WP_071069778.1|3016704_3017151_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	55.7	6.3e-29
WP_071040206.1|3017235_3017418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071070846.1|3017427_3018135_-|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	57.5	1.9e-59
WP_071069780.1|3018864_3019524_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	58.6	1.8e-72
WP_071069783.1|3019525_3020710_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	58.9	7.6e-114
WP_071069785.1|3020706_3021060_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	64.1	8.2e-32
WP_071069787.1|3021098_3021605_-	Rha family transcriptional regulator	NA	A0A0K0N5U2	Gordonia_phage	37.6	6.3e-09
WP_157903278.1|3021745_3022408_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	72.3	4.3e-82
WP_071069791.1|3022484_3023408_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	48.9	1.7e-60
WP_157903279.1|3023407_3023719_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	48.5	1.0e-17
WP_084545580.1|3023715_3024342_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	42.5	6.8e-21
WP_071069795.1|3024338_3026204_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	45.6	2.6e-84
WP_167366675.1|3026193_3026349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084545581.1|3026384_3026831_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	32.2	2.2e-13
WP_071069797.1|3026843_3027284_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	53.4	5.1e-39
WP_071069799.1|3027292_3029110_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	43.0	6.9e-58
WP_071069801.1|3029171_3029753_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	62.5	1.7e-63
WP_071069803.1|3029756_3030128_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	53.7	1.2e-28
WP_157903224.1|3030134_3030293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903225.1|3030289_3031102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903226.1|3031098_3031458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069810.1|3031599_3032133_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	52.6	4.7e-39
WP_071069811.1|3032129_3032513_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	66.7	4.2e-42
WP_071069813.1|3032552_3033014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069816.1|3033015_3034104_-	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	83.7	1.4e-146
WP_071069819.1|3034172_3034679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084545582.1|3034688_3036143_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	61.6	2.4e-122
WP_071069823.1|3036309_3036831_-	hypothetical protein	NA	A9YX01	Burkholderia_phage	53.2	2.7e-47
WP_071069825.1|3036835_3037573_-|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	57.0	2.7e-69
WP_071069827.1|3037569_3039015_-	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	70.0	1.5e-196
WP_071069829.1|3039036_3040587_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.9	1.1e-112
WP_071069831.1|3040537_3040948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903227.1|3041193_3041523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069835.1|3041519_3042902_-	chromosome partitioning protein ParB	NA	A0A1P8VV91	Erythrobacter_phage	30.5	4.9e-80
WP_071069837.1|3043095_3043677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069839.1|3043773_3043974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069841.1|3044058_3044661_-	DNA-binding protein	NA	Q3HR05	Burkholderia_phage	53.1	2.5e-49
WP_071040239.1|3044689_3045160_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	59.6	3.9e-45
WP_071069845.1|3046204_3046522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069846.1|3046579_3047629_-	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	55.5	2.6e-105
WP_071069852.1|3048237_3048549_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071069854.1|3048862_3049099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903228.1|3049501_3050452_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	44.2	5.1e-20
WP_157903229.1|3050459_3051296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069860.1|3051608_3052034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069862.1|3052075_3052291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069864.1|3052468_3052816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069866.1|3052819_3053116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069868.1|3053112_3053586_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	76.4	4.7e-59
WP_157903230.1|3053582_3053741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069870.1|3053868_3054663_+	nuclease	NA	J7HXJ4	Pseudomonas_phage	47.2	2.8e-56
WP_157903231.1|3054670_3055162_+	hypothetical protein	NA	I2GUC6	Acinetobacter_phage	46.8	1.3e-30
WP_071069872.1|3055158_3056235_+	hypothetical protein	NA	H2BD49	Pseudomonas_phage	54.2	3.9e-77
WP_071069875.1|3056246_3056927_+	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	40.2	1.0e-09
WP_071069877.1|3056923_3058663_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	38.7	6.8e-79
WP_071038316.1|3058662_3058845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069879.1|3058841_3059156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069881.1|3059158_3059410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069883.1|3059406_3059679_+	hypothetical protein	NA	B1GS76	Salmonella_phage	39.8	2.9e-05
WP_071069885.1|3059675_3060578_+	hypothetical protein	NA	Q3HQV8	Burkholderia_phage	55.9	1.9e-08
WP_071069888.1|3060574_3062446_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	62.0	1.5e-172
WP_071069890.1|3062448_3062973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069892.1|3062971_3063697_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	42.4	1.6e-37
WP_071069893.1|3063684_3063897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069895.1|3063893_3064430_+	DUF1643 domain-containing protein	NA	A0A142F2K6	Mycobacterium_phage	41.5	1.2e-23
WP_157903232.1|3064426_3064603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084545583.1|3064599_3064899_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_071069897.1|3064895_3066014_+|integrase	tyrosine-type recombinase/integrase	integrase	Q8W6R7	Burkholderia_virus	42.6	4.0e-72
WP_071069899.1|3066460_3066751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069900.1|3066761_3067022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071070854.1|3068404_3068776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069903.1|3068775_3069249_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	40.1	1.0e-21
WP_071069905.1|3069250_3069448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069906.1|3069912_3070245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069908.1|3070241_3071423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069910.1|3071425_3071635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069912.1|3071634_3071901_-	hypothetical protein	NA	I3UM19	Rhodobacter_phage	41.8	2.6e-06
WP_071069915.1|3071961_3072564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069916.1|3072572_3073211_-|tail	tail fiber protein	tail	A0A0F6YNJ5	Sinorhizobium_phage	43.4	3.1e-29
WP_157903233.1|3073228_3076306_-	hypothetical protein	NA	A0A2L0V157	Salmonella_phage	29.9	2.5e-52
WP_162287347.1|3076423_3076825_-	hypothetical protein	NA	A0A2L0V149	Salmonella_phage	37.4	1.1e-11
WP_071069921.1|3076824_3077376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069923.1|3077372_3078035_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	32.7	2.2e-22
WP_071069925.1|3078034_3080920_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	28.0	5.8e-67
WP_084545586.1|3080912_3081347_-	hypothetical protein	NA	A0A1W6JP15	Morganella_phage	32.4	5.9e-08
WP_071069927.1|3081346_3081592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069928.1|3081636_3082041_-	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	41.7	4.5e-10
WP_071069930.1|3082042_3082684_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071069932.1|3082750_3083155_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_071069934.1|3083147_3083477_-|head	phage head closure protein	head	Q6JIM4	Burkholderia_virus	40.0	7.2e-14
WP_071069936.1|3083479_3084016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069938.1|3084019_3084211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069941.1|3084272_3085652_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	40.0	3.0e-77
WP_071069943.1|3085674_3086370_-|head,protease	HK97 family phage prohead protease	head,protease	B0VK32	Azospirillum_phage	49.8	1.7e-49
WP_071069945.1|3086347_3087559_-|portal	phage portal protein	portal	B0VK31	Azospirillum_phage	41.1	1.9e-75
WP_071069948.1|3087558_3087750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069950.1|3087746_3089402_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	73.5	3.0e-241
WP_071069952.1|3089404_3089872_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	66.7	1.4e-39
WP_071069954.1|3089971_3090184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071070858.1|3090180_3090471_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	37.3	5.4e-05
WP_071069956.1|3090711_3091323_-	hypothetical protein	NA	Q3HR05	Burkholderia_phage	41.3	6.6e-29
WP_157903234.1|3091594_3092164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903235.1|3092166_3092520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084545587.1|3092603_3093110_-	DUF1064 domain-containing protein	NA	A0A1X9HVJ6	Ruegeria_phage	42.7	4.2e-13
WP_084545654.1|3093106_3094084_-	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	70.8	4.7e-29
WP_071069965.1|3094174_3094357_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_071069967.1|3094358_3094655_-	DUF1364 family protein	NA	G8C7V5	Escherichia_phage	34.8	6.5e-06
WP_071069970.1|3094654_3094951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069972.1|3095121_3095541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069974.1|3095537_3095765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069976.1|3095761_3095986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071069978.1|3096301_3096808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069980.1|3096788_3097121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084545588.1|3097117_3097402_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071069982.1|3097485_3098208_+	hypothetical protein	NA	G8GWB1	Rhodobacter_phage	28.8	3.5e-13
WP_084545589.1|3098252_3098819_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_071069984.1|3098951_3099401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157903237.1|3099397_3099559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069986.1|3099686_3100223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069988.1|3100219_3100453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069990.1|3100449_3100791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069992.1|3100919_3101846_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	39.9	3.2e-51
WP_071069995.1|3101842_3102328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157903238.1|3102324_3102576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069997.1|3102572_3102791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157903239.1|3102975_3103125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071069999.1|3103124_3103364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071070001.1|3103360_3104017_+	hypothetical protein	NA	K7R9L4	Vibrio_phage	33.2	2.5e-18
WP_071070003.1|3104013_3105627_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.8	9.9e-149
WP_071070864.1|3105629_3105869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157903240.1|3105905_3106178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071070007.1|3106289_3106514_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_071068883.1|3107183_3108212_+|transposase	IS21-like element ISBcen13 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	43.8	6.2e-72
WP_006482411.1|3108208_3108982_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.9	4.2e-81
WP_071013600.1|3109822_3110263_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
3109662:3109714	attR	TGGTCGGGGCGAGAGGATTTGAACCTCCGACCACCTGCACCCCATGCAGGTAC	NA	NA	NA	NA
WP_071013602.1|3110393_3110810_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	40.0	3.8e-12
WP_071070010.1|3110894_3113351_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_071070012.1|3113471_3114515_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.3	4.0e-26
WP_071070014.1|3114798_3115155_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006575466.1|3115182_3115380_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_083384108.1|3115535_3116057_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.7	8.2e-12
WP_071038236.1|3116105_3118013_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.6	1.1e-122
>prophage 1
NZ_CP017755	Cupriavidus malaysiensis strain USMAA1020 isolate pure chromosome 2, complete sequence	3388586	3003576	3022197	3388586	tail	Escherichia_phage(23.08%)	21	NA	NA
WP_071018177.1|3003576_3004038_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	65.4	1.3e-42
WP_071072831.1|3004039_3004234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071072832.1|3004311_3004911_-	hypothetical protein	NA	F5B3N7	Synechococcus_phage	45.0	8.5e-05
WP_084545849.1|3004933_3005584_-|tail	tail fiber protein	tail	A0A1W6JT73	Escherichia_phage	55.5	8.6e-35
WP_157903382.1|3005599_3008737_-	hypothetical protein	NA	A0A2L0V157	Salmonella_phage	28.9	3.2e-50
WP_157903383.1|3008812_3009223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071072838.1|3009222_3009774_-	hypothetical protein	NA	S4TND4	Salmonella_phage	30.4	1.7e-12
WP_071072839.1|3009770_3010394_-	hypothetical protein	NA	Q7Y3Z8	Yersinia_phage	37.9	3.3e-20
WP_071072841.1|3010397_3011753_-	hypothetical protein	NA	A0A2H4J9A1	uncultured_Caudovirales_phage	54.2	9.5e-12
WP_071018161.1|3011755_3012088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071018159.1|3012099_3012516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071072843.1|3012589_3013798_-	hypothetical protein	NA	A0A0S0MV10	Pseudomonas_phage	31.4	2.5e-32
WP_071018155.1|3013872_3014277_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	31.5	1.0e-06
WP_071072852.1|3015156_3016539_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	43.0	1.3e-80
WP_071072854.1|3016535_3017471_-	hypothetical protein	NA	V5URT9	Shigella_phage	58.9	7.0e-46
WP_071072856.1|3017543_3017855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071022133.1|3018251_3018959_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	34.8	8.7e-25
WP_071038990.1|3019110_3019296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071038993.1|3019367_3019601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071018145.1|3019581_3019944_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_071072858.1|3020244_3022197_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	27.0	1.3e-06
