The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	218855	267533	4586755	transposase	Leptospira_phage(22.22%)	49	NA	NA
WP_070963504.1|218855_219281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081562163.1|219414_219639_+	LCP family protein	NA	NA	NA	NA	NA
WP_070963506.1|219656_221033_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_070963508.1|221262_221997_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_070963510.1|222640_223870_-	MFS transporter	NA	NA	NA	NA	NA
WP_070963513.1|223859_224660_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.7	1.2e-14
WP_070963514.1|224660_225668_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_070963516.1|225669_226656_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_070963518.1|226642_227596_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070963519.1|227900_228902_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070963521.1|229234_230455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169824173.1|230518_230902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963527.1|232733_233606_-	radical SAM protein	NA	NA	NA	NA	NA
WP_070972874.1|233602_234361_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081562164.1|234777_235134_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_070963531.1|235205_236330_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_070963533.1|236301_236700_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	62.1	1.5e-45
WP_081562165.1|236828_238454_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.6	5.1e-60
WP_070963534.1|238527_238878_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_081561990.1|238871_239210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963536.1|239283_239586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070963538.1|240134_240710_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070963540.1|240882_241608_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070963542.1|241612_241801_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	66.7	1.8e-17
WP_070963417.1|242030_242792_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.4	7.4e-38
WP_070963420.1|242788_244372_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_070963544.1|244695_245118_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_169824174.1|245686_245848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070963546.1|245882_247532_+	recombinase family protein	NA	A0A1B1P7M0	Bacillus_phage	28.5	1.9e-38
WP_070963547.1|248083_248899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963549.1|248921_251642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963550.1|251655_252405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169824175.1|252401_253685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963554.1|253688_254966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963556.1|254956_255391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562166.1|255413_257558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963558.1|257582_258131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963559.1|258130_259333_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_070963561.1|259395_260385_-	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_169824176.1|260461_261025_-	GGDEF domain-containing protein	NA	A0A1L6BY33	Clostridium_phage	31.5	2.0e-08
WP_070963565.1|262568_262799_-	DUF3953 domain-containing protein	NA	NA	NA	NA	NA
WP_070963567.1|263024_263384_+	DUF882 domain-containing protein	NA	A0A2K9V4C5	Faecalibacterium_phage	43.2	4.4e-17
WP_070963569.1|263397_263805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070963570.1|263862_264087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070963572.1|264125_264347_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_070963576.1|264814_265072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081561990.1|265152_265491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070963578.1|265484_265835_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_081562101.1|265907_267533_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.6	5.1e-60
>prophage 2
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	290570	301975	4586755	integrase	Thermoanaerobacterium_phage(50.0%)	13	282590:282604	302982:302996
282590:282604	attL	TAGTAACGATATATT	NA	NA	NA	NA
WP_070963608.1|290570_293279_-	DUF927 domain-containing protein	NA	I3VYX9	Thermoanaerobacterium_phage	50.9	5.5e-261
WP_070963610.1|293328_294069_-	hypothetical protein	NA	I3VYY1	Thermoanaerobacterium_phage	55.4	2.5e-70
WP_156778683.1|294070_294226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963611.1|294240_294648_-	hypothetical protein	NA	I3VYY4	Thermoanaerobacterium_phage	58.1	7.2e-40
WP_156778684.1|296253_296409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070963613.1|296439_296655_-	helix-turn-helix domain-containing protein	NA	A0A2I7SCU5	Paenibacillus_phage	58.7	8.2e-11
WP_070963615.1|296720_296930_-	helix-turn-helix transcriptional regulator	NA	I3VYZ0	Thermoanaerobacterium_phage	51.5	1.5e-12
WP_081562170.1|297136_297529_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	38.0	2.4e-16
WP_070963617.1|297546_298011_+	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	33.6	3.5e-06
WP_070963618.1|298078_299209_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	54.9	2.8e-118
WP_156778879.1|299305_301039_-	recombinase family protein	NA	A0A2I4R675	Erysipelothrix_phage	50.4	1.1e-156
WP_070963622.1|301302_301575_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070963623.1|301564_301975_-	hypothetical protein	NA	A0A1S5SEW0	Streptococcus_phage	34.3	6.0e-10
302982:302996	attR	AATATATCGTTACTA	NA	NA	NA	NA
>prophage 3
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	636178	654098	4586755	integrase,transposase	Leptospira_phage(100.0%)	16	648602:648617	653872:653887
WP_081562197.1|636178_637807_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.8	6.2e-58
WP_070964101.1|637880_638231_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_070964102.1|638224_638563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156778692.1|638901_639417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964106.1|639489_640368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964108.1|640382_641324_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	34.1	1.3e-39
WP_070964110.1|641323_641806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169824188.1|642006_642237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964116.1|644169_645849_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_070964118.1|645841_648004_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_070964120.1|648000_648846_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
648602:648617	attL	TGTTCTCTAATATCAA	NA	NA	NA	NA
WP_081562101.1|649004_650630_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.6	5.1e-60
WP_070963578.1|650702_651053_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_081561990.1|651046_651385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964122.1|651465_653268_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_070964123.1|653282_654098_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
653872:653887	attR	TGTTCTCTAATATCAA	NA	NA	NA	NA
>prophage 4
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	1130780	1181019	4586755	integrase,protease,transposase	Streptococcus_phage(25.0%)	44	1131781:1131840	1174011:1174442
WP_070964966.1|1130780_1131341_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	46.0	1.3e-36
1131781:1131840	attL	ATGTATACACCAAATAAACATTTTTCACCCTGCAAATAAACATTTATCATAATTCTCCCC	NA	NA	NA	NA
WP_070964969.1|1132300_1133086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964972.1|1133159_1134776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964975.1|1134868_1136902_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_070964977.1|1137068_1138799_-	TniQ family protein	NA	NA	NA	NA	NA
WP_070964980.1|1138795_1140343_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_070964983.1|1140335_1142462_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_070964985.1|1142458_1143304_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_070964987.1|1143311_1143590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964990.1|1143700_1143898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070964992.1|1144127_1144415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070964995.1|1144424_1145177_-	DUF1444 family protein	NA	NA	NA	NA	NA
WP_070964997.1|1145321_1145600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070965000.1|1145667_1146354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156778712.1|1146359_1147487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965003.1|1147518_1147800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965007.1|1147818_1148274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965011.1|1148608_1149502_+|integrase	tyrosine-type recombinase/integrase	integrase	B3GAN2	uncultured_virus	30.4	1.4e-06
WP_070965014.1|1149584_1151204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965017.1|1151348_1152254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070965021.1|1152508_1154557_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_070965024.1|1154579_1157135_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_070965026.1|1157150_1160735_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_070965028.1|1160754_1164336_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_070965031.1|1164356_1164935_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_070965034.1|1164935_1165532_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_070965036.1|1165757_1166042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070965039.1|1166119_1166680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965042.1|1166812_1167922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965045.1|1167960_1168554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156778713.1|1168620_1169199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562229.1|1169417_1170545_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070965054.1|1170858_1171179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070965057.1|1171225_1171507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965060.1|1171512_1172436_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_070965063.1|1172755_1173040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070965065.1|1173257_1173656_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_070965069.1|1174456_1175056_-	recombination protein RecR	NA	NA	NA	NA	NA
1174011:1174442	attR	ATGTATACACCAAATAAACATTTTTCACCCTGCAAATAAACATTTATCATAATTCTCCCCACAAGCCCCTACTCAAGCCAATCCCCATTTTTATCCATTTTATCATCCATTCTCAATTCCATTCACTTTTCCCTTAAATCTTAGGCCTTAATCCTGCTGAAATGCAAATAAAGTTGTTTCAGAATTAAGGGTTAAGGATCAAGGGTTAAGAGATGTTTTTATCCATTTTTCTTTTCCATTCTGTTTTCCATTTAGGGGCTTCAGGTCTTTATTTCAGGGCTTTTTAGGGACTAGGTTTAAGGTACAAGGGGGTAAGTCCTAAAAACGAAAAAACATGGTACAGGGAGGTTTTTACGCTTCCTGAAACCATGTTTATGATAGAACTTTCGTGTTGAATTTGATTTTTGATATAAGTTTATTTGGGTAATACAT	NA	NA	NA	NA
WP_070965072.1|1175141_1175486_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_070965076.1|1175543_1177181_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	43.9	2.5e-51
WP_070965079.1|1177284_1177968_-	CvpA family protein	NA	NA	NA	NA	NA
WP_070965082.1|1177978_1179091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070965085.1|1179212_1180304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562231.1|1180431_1181019_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	34.5	2.9e-18
>prophage 5
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	1628072	1634138	4586755		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_070966101.1|1628072_1628588_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.9	6.6e-22
WP_070973066.1|1628769_1629480_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.3	1.1e-40
WP_070966104.1|1629519_1630947_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.0	2.1e-57
WP_070973068.1|1630958_1631987_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.6	9.6e-73
WP_070966106.1|1631974_1632598_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	32.8	1.1e-18
WP_070966109.1|1632608_1634138_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	44.4	2.2e-65
>prophage 6
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	1938448	1987355	4586755	tRNA,transposase	Bacillus_phage(25.0%)	38	NA	NA
WP_070973109.1|1938448_1939444_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_169824205.1|1939477_1939669_+	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_070966732.1|1939831_1940548_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_156778747.1|1940607_1940766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070966735.1|1941018_1941612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966738.1|1941698_1942604_+	agmatinase	NA	NA	NA	NA	NA
WP_081561914.1|1942706_1943540_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_070966740.1|1944062_1944494_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_070966742.1|1944490_1944796_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_070966745.1|1945763_1946156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966747.1|1946175_1946664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966749.1|1947126_1947852_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_070966752.1|1948105_1948831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966754.1|1949427_1950000_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070966757.1|1950002_1950509_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_070966760.1|1950794_1952597_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_070973113.1|1952963_1954124_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_070966763.1|1954328_1955291_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_070966766.1|1955390_1955573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966768.1|1955747_1956959_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	8.2e-47
WP_156778748.1|1957254_1958663_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.4	1.4e-42
WP_070966782.1|1959075_1963494_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.1	1.6e-28
WP_070966785.1|1963562_1969361_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	36.2	5.3e-11
WP_070966788.1|1969398_1969842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966791.1|1970311_1970740_+	GBS Bsp-like repeat-containing protein	NA	NA	NA	NA	NA
WP_070966794.1|1970863_1972363_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_070966797.1|1972947_1973463_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_070966801.1|1973582_1974725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966804.1|1974746_1978976_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	35.7	6.0e-12
WP_070966807.1|1978988_1979330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966809.1|1980588_1981038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966812.1|1981207_1981819_+	recombinase family protein	NA	Q2A092	Sodalis_phage	32.6	1.0e-13
WP_081561916.1|1981889_1982066_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_070966815.1|1982276_1983509_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	25.1	2.3e-12
WP_070966818.1|1983890_1984256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966821.1|1984329_1984656_+	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	53.1	3.3e-19
WP_070966823.1|1984678_1985113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070966826.1|1986152_1987355_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	2858452	2866999	4586755		Clostridium_phage(20.0%)	17	NA	NA
WP_070968599.1|2858452_2860018_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	43.9	6.5e-105
WP_070968601.1|2860035_2860509_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	45.9	1.0e-29
WP_070968604.1|2860532_2861150_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	47.0	2.6e-09
WP_070968607.1|2861379_2861616_+	helix-turn-helix transcriptional regulator	NA	Q9ZXD1	Bacillus_phage	51.4	1.1e-11
WP_081561980.1|2861644_2862181_+	Bro-N domain-containing protein	NA	A0A2R2ZGJ9	Clostridioides_phage	61.8	2.5e-32
WP_070968610.1|2862196_2862385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169824217.1|2862648_2862816_+	hypothetical protein	NA	A8ATM6	Listeria_phage	51.2	8.9e-05
WP_070968613.1|2862815_2863064_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	49.4	2.3e-17
WP_070968617.1|2863068_2863266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968620.1|2863258_2863555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968623.1|2863600_2863810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968626.1|2864027_2864780_+	hypothetical protein	NA	I2E8X7	Clostridium_phage	58.9	9.8e-75
WP_156778779.1|2864799_2864964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070973208.1|2864997_2865498_+	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	42.4	1.9e-26
WP_156778780.1|2865937_2866102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968629.1|2866108_2866333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968632.1|2866372_2866999_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4JC68	uncultured_Caudovirales_phage	34.5	3.9e-08
>prophage 9
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	2870344	2924324	4586755	integrase,head,plate,capsid,terminase,protease,portal,bacteriocin,tail,transposase	Clostridium_phage(22.73%)	64	2889761:2889775	2924574:2924588
WP_070968652.1|2870344_2870743_+	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	55.5	9.6e-29
WP_070968655.1|2870827_2871355_+|terminase	P27 family phage terminase small subunit	terminase	A0A2I7SBY3	Paenibacillus_phage	31.0	4.5e-10
WP_070968658.1|2871344_2872913_+|terminase	terminase large subunit	terminase	A0A2I7SBY8	Paenibacillus_phage	77.0	5.0e-246
WP_070973210.1|2872972_2874184_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	63.2	1.4e-147
WP_070968661.1|2874176_2874947_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.4	1.7e-53
WP_070968664.1|2874995_2876168_+|capsid	phage major capsid protein	capsid	A0A2H4JHG1	uncultured_Caudovirales_phage	51.1	6.2e-100
WP_070968667.1|2876213_2876516_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I7SBZ6	Paenibacillus_phage	55.1	2.9e-22
WP_070968670.1|2876512_2876842_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_070968673.1|2876841_2877267_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_070968676.1|2877275_2877722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968680.1|2877726_2878824_+|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	32.1	1.8e-32
WP_070968683.1|2878839_2879253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968686.1|2879329_2879713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778782.1|2879733_2879877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968692.1|2879887_2881891_+|tail	phage tail tape measure protein	tail	R9TF76	Synechococcus_phage	37.9	1.3e-41
WP_070968695.1|2881902_2882322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968700.1|2882324_2883329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968704.1|2883328_2883727_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_070968707.1|2883741_2884188_+	DUF2634 domain-containing protein	NA	A0A0A7RUS1	Clostridium_phage	32.1	1.9e-09
WP_070968710.1|2884188_2885223_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	42.3	3.8e-61
WP_070973212.1|2885239_2885755_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	34.7	6.2e-20
WP_070968713.1|2885755_2886043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968717.1|2886055_2886868_+	collagen-like protein	NA	NA	NA	NA	NA
WP_070968720.1|2886879_2887746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968723.1|2887759_2887996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968726.1|2888100_2888304_+|bacteriocin	bacteriocin	bacteriocin	A0A2H4JAI7	uncultured_Caudovirales_phage	49.2	3.6e-08
WP_070968729.1|2888317_2889097_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWP2	uncultured_phage	31.0	8.2e-16
WP_070968733.1|2889099_2890146_+	hypothetical protein	NA	NA	NA	NA	NA
2889761:2889775	attL	ATTACTATAAATTTG	NA	NA	NA	NA
WP_070968736.1|2890158_2890446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968742.1|2890855_2891698_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070968745.1|2892051_2893014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968748.1|2893227_2894466_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_156778783.1|2894714_2895788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778784.1|2895814_2895967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968752.1|2896133_2896376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778785.1|2896372_2896519_+	hypothetical protein	NA	Q0SPG6	Clostridium_phage	47.8	3.5e-05
WP_070968755.1|2896950_2897910_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_070968758.1|2898222_2898798_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_070968761.1|2898811_2900077_+	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_169824218.1|2900165_2900330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968765.1|2900292_2902983_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	30.3	1.3e-63
WP_070968768.1|2902998_2903598_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_070973214.1|2903642_2904188_+	lytic transglycosylase domain-containing protein	NA	A0A0A0RVE6	Bacillus_phage	35.5	1.1e-14
WP_070968771.1|2904273_2905902_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070968776.1|2906896_2907286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070963417.1|2907250_2908012_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.4	7.4e-38
WP_070963420.1|2908008_2909592_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_081561985.1|2909702_2910716_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_070968781.1|2911304_2912615_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_070968784.1|2912819_2913173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081561986.1|2913744_2913915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968788.1|2913960_2914377_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_070968791.1|2914453_2914651_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	49.2	4.6e-08
WP_070968794.1|2914786_2916847_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_156778787.1|2917179_2917398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156894491.1|2917466_2918468_+	DUF790 family protein	NA	D6PI11	uncultured_phage	31.0	5.8e-06
WP_070968805.1|2919511_2920087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968809.1|2920183_2920990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778789.1|2921187_2921403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968814.1|2921477_2921672_+	transcription initiation factor TFIIIB	NA	NA	NA	NA	NA
WP_156778790.1|2921683_2922217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968819.1|2922294_2922690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968822.1|2922728_2923301_+	hypothetical protein	NA	A0A2H4JAE2	uncultured_Caudovirales_phage	38.0	2.8e-21
WP_070968825.1|2923475_2924324_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	29.0	2.6e-23
2924574:2924588	attR	CAAATTTATAGTAAT	NA	NA	NA	NA
>prophage 10
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	2928139	2979048	4586755	tRNA,capsid,portal,transposase	Leptospira_phage(30.0%)	57	NA	NA
WP_070968835.1|2928139_2929405_+|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.3	4.5e-56
WP_070968838.1|2929397_2930156_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_081561988.1|2930205_2930616_+	cysteine-rich VLP protein	NA	NA	NA	NA	NA
WP_070968843.1|2930809_2931367_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_070968848.1|2931397_2931781_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	53.5	1.3e-30
WP_070968851.1|2933075_2933636_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_156778791.1|2933728_2933893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778792.1|2934039_2934282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778793.1|2934365_2934533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169824264.1|2934677_2934911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070973220.1|2935038_2935260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081561990.1|2935522_2935861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968856.1|2935854_2936205_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_081561992.1|2936278_2937907_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.8	2.1e-58
WP_156778794.1|2938078_2938225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968859.1|2938176_2938461_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_156778796.1|2938829_2939819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778797.1|2939910_2940075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968865.1|2940316_2940700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968868.1|2940689_2941490_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_070968871.1|2941482_2942406_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169824220.1|2942621_2943362_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_081561994.1|2943355_2943595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070968874.1|2943997_2944669_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_070968877.1|2944658_2946152_-	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
WP_156778798.1|2947043_2947199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968879.1|2948027_2948729_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_070968882.1|2949164_2950736_+	endoglucanase	NA	NA	NA	NA	NA
WP_070968885.1|2950928_2951366_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_070968888.1|2951553_2952045_-	transporter	NA	NA	NA	NA	NA
WP_156778799.1|2952387_2953089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070968892.1|2954601_2955594_-	asparaginase	NA	NA	NA	NA	NA
WP_081561995.1|2956178_2956790_+	lactate utilization protein	NA	NA	NA	NA	NA
WP_070968895.1|2956995_2958153_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	30.4	2.9e-41
WP_070968899.1|2958160_2959333_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_070968903.1|2959413_2959890_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_070968906.1|2960017_2960521_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_070968909.1|2960732_2961473_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	32.8	5.5e-30
WP_070973226.1|2961499_2963728_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	46.2	1.4e-185
WP_070968911.1|2963956_2964292_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_070973228.1|2964306_2964744_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_070968913.1|2964756_2965527_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	44.8	1.3e-50
WP_156778800.1|2965781_2965946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968916.1|2965948_2966578_+	stage V sporulation protein AA	NA	NA	NA	NA	NA
WP_081561996.1|2966589_2967000_+	stage V sporulation protein AB	NA	NA	NA	NA	NA
WP_156778801.1|2967019_2967178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968921.1|2967224_2967680_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_070968925.1|2967692_2968718_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_070968928.1|2968730_2969087_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_070968930.1|2969225_2969801_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_070968933.1|2969877_2972457_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_070968936.1|2972743_2973043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070968939.1|2973066_2974650_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	41.5	1.6e-111
WP_070968942.1|2975124_2975886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156778802.1|2976103_2976415_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_169824221.1|2976331_2977255_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.7	2.4e-38
WP_081561940.1|2977401_2979048_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.1	3.9e-60
>prophage 11
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	3062454	3153228	4586755	integrase,head,plate,capsid,terminase,protease,tRNA,portal,bacteriocin,tail,transposase	Clostridium_phage(15.15%)	98	3085245:3085304	3122709:3122851
WP_070969204.1|3062454_3062787_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_070969206.1|3062790_3063072_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_070969209.1|3063249_3064533_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_070969211.1|3064556_3064739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969214.1|3064756_3065053_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_070969217.1|3065140_3066217_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_070969220.1|3066471_3067092_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_070969224.1|3067145_3067727_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_070969228.1|3067763_3068903_+	LCP family protein	NA	NA	NA	NA	NA
WP_070969231.1|3069082_3070084_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_070969233.1|3070100_3070469_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_070969236.1|3070779_3073242_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	49.4	1.3e-229
WP_070969239.1|3073263_3073911_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070969241.1|3073951_3074332_+	RidA family protein	NA	NA	NA	NA	NA
WP_070969244.1|3074438_3075107_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_070969247.1|3075133_3076012_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_070969249.1|3076034_3077360_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_070969252.1|3077572_3078208_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081562014.1|3078266_3079307_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_070969257.1|3079558_3080923_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_070969260.1|3081367_3082768_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_070969263.1|3082783_3084679_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	28.7	4.3e-18
3085245:3085304	attL	GGTCTTCAAAACCAGCGCGAGGGGTTAGTAGCCTCTTGGGTGGGTTCGATTCCCACGTAC	NA	NA	NA	NA
WP_070969266.1|3085446_3086445_+|integrase	phage integrase family protein	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	23.9	1.0e-15
WP_070969268.1|3086444_3087194_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070969271.1|3088156_3088840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969273.1|3088908_3089121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969276.1|3089107_3089425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969280.1|3089515_3089722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969282.1|3089873_3090134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169824222.1|3090153_3090303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969286.1|3090379_3090616_+	hypothetical protein	NA	Q331U1	Clostridium_botulinum_C_phage	59.2	1.2e-15
WP_070969288.1|3090596_3090869_+	DUF3102 domain-containing protein	NA	A0A1P8CWU6	Bacillus_phage	53.8	3.0e-18
WP_070969291.1|3091406_3092294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969294.1|3092376_3092562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969297.1|3092591_3093920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070963420.1|3094010_3095594_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_070963417.1|3095590_3096352_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.4	7.4e-38
WP_070969299.1|3096424_3096895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969302.1|3097318_3099967_+	hypothetical protein	NA	O64076	Bacillus_phage	36.1	4.9e-113
WP_070969305.1|3100358_3100754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969307.1|3100734_3100944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969310.1|3101099_3101687_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_070969313.1|3101679_3102039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969316.1|3102230_3102524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169824223.1|3102633_3103008_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	47.9	2.1e-17
WP_070969322.1|3103065_3103572_+	hypothetical protein	NA	H7BVN4	unidentified_phage	35.0	2.7e-12
WP_070969325.1|3103748_3104210_+|terminase	phage terminase small subunit P27 family	terminase	A0A0A7RUQ4	Clostridium_phage	62.7	7.9e-43
WP_070969327.1|3104206_3105922_+	hypothetical protein	NA	A0A0A7RUM0	Clostridium_phage	42.6	6.9e-116
WP_070969334.1|3106114_3107371_+|portal	phage portal protein	portal	A0A0A7RTS2	Clostridium_phage	49.9	2.3e-113
WP_070969337.1|3107363_3107954_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	47.0	1.6e-43
WP_070969339.1|3108010_3109141_+|capsid	phage major capsid protein	capsid	A0A0A7S154	Clostridium_phage	45.6	1.7e-83
WP_070969342.1|3109194_3109482_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	59.1	6.4e-27
WP_070969344.1|3109481_3109817_+|head	phage head closure protein	head	A0A2I7SCU2	Paenibacillus_phage	55.0	3.1e-28
WP_070969347.1|3109818_3110226_+	HK97 gp10 family phage protein	NA	A0A0C5AJ13	Paenibacillus_phage	38.2	7.3e-16
WP_070969350.1|3110212_3110602_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_070969353.1|3110601_3110988_+|tail	phage major tail protein, TP901-1 family	tail	A0A0C5AMZ4	Paenibacillus_phage	48.7	7.3e-26
WP_070969356.1|3110987_3111302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969357.1|3111394_3111586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969360.1|3111601_3113644_+|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	33.5	1.6e-63
WP_070969363.1|3113643_3114372_+|tail	phage tail family protein	tail	Q0H226	Geobacillus_phage	27.9	3.3e-11
WP_070969366.1|3114384_3117018_+|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_070969370.1|3117028_3117217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969373.1|3117246_3118962_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_156778813.1|3119309_3120860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969379.1|3120878_3121142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969382.1|3121209_3121413_+|bacteriocin	bacteriocin	bacteriocin	A0A2H4JAI7	uncultured_Caudovirales_phage	47.6	9.5e-09
WP_070969386.1|3121424_3122138_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_156778814.1|3122124_3122298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969388.1|3122959_3123196_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	45.2	1.5e-05
3122709:3122851	attR	GGTCTTCAAAACCAGCGCGAGGGGTTAGTAGCCTCTTGGGTGGGTTCGATTCCCACGTACTCCCGCCATATATTGAATTTTCAAGTAAAATCAATGATTATAATGTTTTATGTTATAGTCATTTTTTATTTTTTGAAAATGAT	NA	NA	NA	NA
WP_070969391.1|3123196_3123649_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.8	1.7e-13
WP_070969394.1|3123840_3124950_-	Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain	NA	NA	NA	NA	NA
WP_070973253.1|3125460_3126096_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_070969397.1|3126243_3126444_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_070969400.1|3126609_3127251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969403.1|3127436_3127931_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_070969406.1|3127955_3128534_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_070969409.1|3128550_3129564_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.8	3.4e-06
WP_070969411.1|3129571_3129781_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_070969414.1|3130079_3131762_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	27.7	6.5e-18
WP_070969417.1|3131768_3132794_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_070969420.1|3132810_3133929_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.5	3.5e-92
WP_070969423.1|3134066_3134342_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.7	3.9e-05
WP_070969425.1|3134473_3134857_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_070969429.1|3134926_3135067_+	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
WP_070969432.1|3135187_3136549_+	thioether cross-link-forming SCIFF peptide maturase	NA	NA	NA	NA	NA
WP_169824224.1|3136506_3137055_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_070969438.1|3137253_3138492_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_070969440.1|3138505_3139393_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.7	2.8e-36
WP_070969444.1|3139524_3141198_+	hypothetical protein	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	33.8	1.9e-49
WP_070973255.1|3141283_3143032_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	2.1e-91
WP_070969447.1|3143219_3143738_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.0	2.3e-27
WP_070973257.1|3143794_3145966_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	36.4	1.1e-06
WP_070969450.1|3145981_3146431_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_070969453.1|3146448_3147069_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.4	3.2e-23
WP_070969456.1|3147144_3148617_+	coproporphyrinogen dehydrogenase HemZ	NA	NA	NA	NA	NA
WP_070973260.1|3148633_3150403_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070969458.1|3150750_3151674_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_070969461.1|3152463_3153228_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	3308183	3316799	4586755	protease	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_070969853.1|3308183_3309014_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	44.7	9.5e-63
WP_070969856.1|3309010_3310336_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	55.9	1.7e-130
WP_156778903.1|3310494_3311613_+	serine hydrolase	NA	NA	NA	NA	NA
WP_070969861.1|3311733_3314355_+	CBS domain-containing protein	NA	A0A2H4YF77	Aeromonas_phage	30.7	9.5e-16
WP_070969866.1|3314347_3314968_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_070969869.1|3314979_3315723_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.8	2.5e-06
WP_070973305.1|3315742_3316309_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	1.3e-15
WP_070969872.1|3316385_3316799_-	S-adenosylmethionine decarboxylase proenzyme	NA	A0A1D7SEZ2	Cyanophage	42.2	1.6e-18
>prophage 13
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	3379943	3455386	4586755	integrase,plate,tRNA,portal,tail	Clostridium_phage(23.91%)	95	3380287:3380303	3422948:3422964
WP_070970024.1|3379943_3380552_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	47.4	8.0e-35
3380287:3380303	attL	TTTTCTATTACCTTCTG	NA	NA	NA	NA
WP_070970027.1|3380610_3381186_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070970030.1|3381339_3381552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970033.1|3382860_3383718_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	33.6	1.6e-33
WP_070970035.1|3383733_3384579_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	26.9	1.9e-18
WP_070970038.1|3384662_3384938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970044.1|3385861_3386260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970047.1|3386274_3386883_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	44.7	4.0e-34
WP_070970049.1|3387024_3387438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562039.1|3387635_3387935_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070970053.1|3388080_3388380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070970055.1|3389859_3391362_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_070970058.1|3391363_3392686_-	B12 lower ligand biosynthesis radical SAM protein BzaD	NA	NA	NA	NA	NA
WP_070970061.1|3392690_3394217_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_070970064.1|3394209_3395280_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_070970067.1|3395309_3396596_-	B12 lower ligand biosynthesis ThiC-like protein BzaB	NA	NA	NA	NA	NA
WP_070970070.1|3396719_3398018_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_070970073.1|3398442_3399561_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZHE2	Clostridioides_phage	25.9	7.1e-13
WP_070970076.1|3399647_3400274_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	57.5	7.0e-18
WP_070970078.1|3400481_3401780_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_070970083.1|3401751_3401982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970086.1|3401992_3402556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970089.1|3402536_3403142_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_169824229.1|3403138_3404092_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	43.8	4.2e-54
WP_070970092.1|3404233_3404467_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_070970095.1|3404555_3405497_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_070970099.1|3405508_3407356_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.7	5.9e-73
WP_156778822.1|3407367_3409989_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.7	2.9e-49
WP_070970102.1|3410192_3411623_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_070970105.1|3411700_3412018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970108.1|3412007_3412280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970111.1|3413786_3414032_-	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	52.0	1.5e-13
WP_070970114.1|3414097_3415183_-	RNA-dependent DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	60.3	2.2e-123
WP_070970117.1|3415496_3415838_-	diversity-generating retroelement protein Avd	NA	A0A0N7ACE0	Bacillus_phage	57.3	2.5e-30
WP_081562043.1|3415910_3416939_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A0N7ACM5	Bacillus_phage	48.1	4.9e-77
WP_070970122.1|3416938_3417283_-	hypothetical protein	NA	A0A0N7ACI4	Bacillus_phage	50.9	1.6e-24
WP_169824230.1|3417286_3417448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970130.1|3417447_3417891_-	hypothetical protein	NA	A0A0N7ACL0	Bacillus_phage	43.2	1.6e-21
WP_070970133.1|3417892_3418192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970136.1|3418191_3419088_-	YmfQ family protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	41.6	5.3e-27
WP_070970139.1|3419084_3420221_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	47.1	4.4e-79
WP_070970142.1|3420225_3420690_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	49.7	4.7e-35
WP_070970145.1|3420689_3421100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970148.1|3421086_3422040_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	45.3	4.1e-62
WP_070970151.1|3422045_3422696_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	41.8	1.2e-31
WP_081562260.1|3422706_3425649_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	34.2	5.6e-65
3422948:3422964	attR	TTTTCTATTACCTTCTG	NA	NA	NA	NA
WP_070973320.1|3425984_3426413_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	66.2	5.6e-43
WP_070970157.1|3426453_3426864_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	60.2	1.7e-44
WP_070970160.1|3426880_3428293_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J1N7	uncultured_Caudovirales_phage	55.1	5.4e-151
WP_070970164.1|3428295_3428526_-	hypothetical protein	NA	A0A2H4J7J8	uncultured_Caudovirales_phage	50.0	4.1e-08
WP_070970168.1|3428537_3429356_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	49.6	2.6e-73
WP_070970172.1|3429366_3429801_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	54.3	6.7e-36
WP_070970175.1|3429776_3430154_-	hypothetical protein	NA	A0A0A8WIZ3	Clostridium_phage	41.1	1.4e-21
WP_070970179.1|3430153_3430474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970184.1|3430515_3431550_-	aspartate ammonia-lyase	NA	A0A0A8WEW9	Clostridium_phage	61.8	3.4e-126
WP_070970187.1|3431561_3431972_-	DUF2190 family protein	NA	A0A0A8WJN5	Clostridium_phage	56.3	1.1e-30
WP_070970190.1|3431990_3433367_-	hypothetical protein	NA	A0A0A8WFF1	Clostridium_phage	54.5	6.7e-130
WP_070970193.1|3433384_3434401_-	hypothetical protein	NA	A0A1J1GF13	Clostridium_phage	46.9	2.0e-86
WP_070970197.1|3434393_3435890_-|portal	phage portal protein	portal	A0A0A8WI73	Clostridium_phage	68.9	7.4e-199
WP_070970199.1|3435882_3437292_-	DEAD/DEAH box helicase family protein	NA	A0A0A8WEW2	Clostridium_phage	76.3	3.9e-210
WP_081562261.1|3437284_3438112_-	hypothetical protein	NA	A0A0A8WJN3	Clostridium_phage	48.1	6.4e-43
WP_070970204.1|3438179_3438374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156778905.1|3438420_3439743_-	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	47.4	9.3e-113
WP_070970207.1|3439769_3439952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970210.1|3440087_3440582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562046.1|3440592_3441354_-	hypothetical protein	NA	D7RWH3	Brochothrix_phage	43.6	1.8e-36
WP_070970216.1|3441337_3441784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970219.1|3441773_3442160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970222.1|3442159_3442720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970225.1|3442703_3443003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970228.1|3443021_3443231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970231.1|3443261_3444440_-	DNA (cytosine-5-)-methyltransferase	NA	W8CQ31	Croceibacter_phage	62.9	4.1e-136
WP_156778823.1|3444615_3444834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970237.1|3444850_3445105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156778824.1|3445206_3445347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081562263.1|3445364_3445634_-	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	60.9	4.2e-20
WP_070970240.1|3445806_3446037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970243.1|3446047_3446266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970246.1|3446277_3446892_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_081562264.1|3446903_3447290_-	DUF1064 domain-containing protein	NA	A0A0A8WFH8	Clostridium_phage	55.2	2.0e-23
WP_169824231.1|3447237_3447420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156894496.1|3447437_3448412_-	ATP-binding protein	NA	A0A067ZJ24	Vibrio_phage	33.9	6.2e-21
WP_169824232.1|3448308_3449079_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_070970256.1|3449118_3449859_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	47.8	3.2e-62
WP_070970258.1|3449858_3450653_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	54.4	1.4e-66
WP_070970262.1|3450673_3450874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970265.1|3450889_3452842_-	AAA family ATPase	NA	A0A0C5AFJ6	Bacillus_phage	32.1	2.8e-57
WP_070970268.1|3452838_3453165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970271.1|3453122_3453368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970274.1|3453383_3453569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970278.1|3453588_3453795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156778826.1|3453769_3453931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070970281.1|3453958_3454216_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070970284.1|3454383_3455022_+	repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	37.8	7.4e-31
WP_070970287.1|3455035_3455386_+	hypothetical protein	NA	S6B1J4	Thermus_phage	60.3	9.3e-28
>prophage 14
NZ_CP017603	Clostridium formicaceticum strain ATCC 27076 chromosome, complete genome	4586755	4522521	4537955	4586755		Bacillus_phage(62.5%)	11	NA	NA
WP_070972757.1|4522521_4525644_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	28.9	7.6e-129
WP_070972759.1|4525646_4526861_-	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	30.1	2.7e-13
WP_156894501.1|4526976_4527129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070972761.1|4527118_4529080_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	7.5e-50
WP_070972765.1|4529076_4530804_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	6.2e-48
WP_070972767.1|4530934_4531624_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	1.0e-41
WP_070972769.1|4531620_4533096_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.3	1.2e-28
WP_070972771.1|4533366_4533993_-	Fe-only nitrogenase accessory protein AnfO	NA	NA	NA	NA	NA
WP_070972773.1|4534204_4534558_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_070972775.1|4534623_4535679_-	response regulator	NA	W8CYM9	Bacillus_phage	35.8	1.4e-10
WP_169824254.1|4535843_4537955_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.1e-58
