The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	336405	347176	5178450	tRNA	Micromonas_pusilla_virus(16.67%)	7	NA	NA
WP_011347109.1|336405_338082_+	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.7	1.9e-41
WP_011347110.1|338167_338809_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_008574635.1|338981_340016_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.1e-113
WP_011347111.1|340312_340801_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011347112.1|340902_343551_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	4.8e-84
WP_003481884.1|343690_343903_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_029819220.1|345217_347176_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.9	1.6e-12
>prophage 2
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	422583	432338	5178450	transposase,integrase	Leptospira_phage(80.0%)	7	422555:422614	454477:455702
422555:422614	attL	TGACCTGCCCCCATCGTCCGTACCAGTGATTACTGATAAAGCCCGGGGTTGAAGGGTACT	NA	NA	NA	NA
WP_087942069.1|422583_423716_-|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_087944903.1|424711_425867_+|transposase	IS3-like element ISXc8 family transposase	transposase	NA	NA	NA	NA
WP_126952920.1|426055_426487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087944180.1|426545_427654_-|transposase	IS3-like element ISXca2 family transposase	transposase	S5WIU1	Leptospira_phage	38.3	5.9e-44
WP_005916811.1|427919_429377_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	24.8	3.9e-11
WP_126965074.1|430228_431239_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	8.6e-42
WP_087944180.1|431229_432338_-|transposase	IS3-like element ISXca2 family transposase	transposase	S5WIU1	Leptospira_phage	38.3	5.9e-44
454477:455702	attR	AGTACCCTTCAACCCCGGGCTTTATCAGTAATCACTGGTACGGACGATGGGGGCAGGTCACAAGATGCCTGGGCCAGATGCAGGCTAATCGCAGCGTTCGTCTTACAGGGTGGTAAGGAAATTCCACTGCCCTGGCAGTGTTAAGGTTGTTGGCGTCGATGGAAATTGGCAATGAACACAGATCGGTTTAAAGAGAACTTCTTATCTTTTATGAACGGTTGCGAATTTATCTACAGTGAATTCAAGAATGGTGATTTCGGAGATCTTCAGAGAGTGGAGGTTGAAAGTTTTAACAAAATGGGGGCGGTTGAATTTTGGTCCTCAGGCTGGGTAGGAATTGATCTTGTCGATTGCGTTTCTGGAACCCAAGAAATCAGTGTGCTGCTTTCTCCGGAACAGCGAGATCTCGTTGATGGTGAGTTAAGAAGATTTGCCGACCTGATGGCGCGACGCTGACCAACGCTGATGCGAGGCTACAGCAGTCATGACCCAAGATCGTTTCAAAAAATCGCAATGGTTCGGCCTTCTCGGCTGGTTGGTGCTTTGCTATGCCGCAGCCGCGCTGGGCGCAACTGCATCGATCCAGGCCGCCAGCTTTTATGCGCAGCTGCAGCGGCCGGCGTGGGCACCGCCGGGCTGGCTGTTCGGGCCGGTGTGGATGGTGCTGTACGGAATGATGGCGGTGTCGGTGTGGTTGGTGTGGCGCCGTGGGAGATGGGCTGGTGCGCGCATGGCGCTGACACTGTTCGTCGTGCAGCTGGCGCTCAACGGGCTTTGGAGTTGGTTGTTCTTTGCGTGGCATCTGGGGGCGTGGGCATTCGCGGACATCGTGGCGCTGTGGCTCGTGCTGGTGGGCACCATTGGGGCGTTTGCGAAGAGGCACGCTTTGGCGGGGTGGTTGTTGGTGCCGTATCTGGCGTGGGTGAGCTTTGCGGCGGCGCTCAATTTTTCGGTCTGGCAACTCAACCCTCAGGTGCTTGGCTGATCTGCGCTGCTGACCTTGGCCCGCACCGACTCGGGGTCGCGATAGCGACGATCTGTTGCTTGATGCGAAGTTGTCTATTGCTTGAAGCGACCTGCTGCCTGCAGCGATGTGATGCATCGAACGCTGGCGATCCAGTCAGCCTATCGCGTCGGCCGAGCACACGACTCGATCAATGAAGGTTAGAAAGCTGCGCAGCATGGCTCTGCAAGGCCGGTCCAAAAGTTTCCATAGCAATCAATTG	NA	NA	NA	NA
>prophage 3
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	939539	978410	5178450	transposase,integrase	Salmonella_phage(40.0%)	30	945046:945062	981881:981897
WP_087944903.1|939539_940696_-|transposase	IS3-like element ISXc8 family transposase	transposase	NA	NA	NA	NA
WP_011347465.1|941627_941933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347466.1|942021_942342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347467.1|942390_943500_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_011347468.1|943563_944214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347469.1|944341_944665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347470.1|944756_945437_-	DUF3275 family protein	NA	NA	NA	NA	NA
945046:945062	attL	CGGGATGCTCTGGCCGG	NA	NA	NA	NA
WP_011347471.1|945498_946428_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_080954318.1|947835_948192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011347473.1|948329_951326_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.8	1.4e-84
WP_011347474.1|951334_952609_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011345701.1|952802_953870_+	cointegrate resolution protein T	NA	NA	NA	NA	NA
WP_011347477.1|955305_956628_-	pectate lyase	NA	NA	NA	NA	NA
WP_080505918.1|957286_957817_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_011347479.1|957950_959027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011347481.1|959340_960267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347482.1|960266_962393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347483.1|962633_963026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347484.1|963047_963260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347485.1|963732_965271_-	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	40.0	1.7e-94
WP_011347486.1|965805_967818_-	DNA topoisomerase III	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	23.6	5.8e-13
WP_011347487.1|968097_968538_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_011347488.1|968611_969145_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_011347489.1|969141_969897_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011347490.1|970218_971445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347491.1|971448_972009_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_011347492.1|972024_973668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347493.1|973660_973921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087944892.1|974037_975193_+|transposase	IS3-like element ISXc8 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	1.6e-39
WP_011347495.1|976466_978410_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	49.9	2.7e-100
981881:981897	attR	CCGGCCAGAGCATCCCG	NA	NA	NA	NA
>prophage 4
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	996033	1028062	5178450	transposase,integrase	Escherichia_phage(40.0%)	30	1016103:1016162	1028057:1028937
WP_001389365.1|996033_996798_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_011347518.1|997373_999101_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003465017.1|999196_1000081_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003830781.1|1000264_1000528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077203601.1|1000379_1000910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|1001098_1001935_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|1001934_1002738_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000904906.1|1002803_1003418_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001389365.1|1003961_1004726_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_011347521.1|1004754_1005249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011347522.1|1005251_1006400_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011347523.1|1006418_1007597_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011347524.1|1007633_1008662_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	30.0	4.7e-27
WP_011347525.1|1008714_1009944_+	MFS transporter	NA	NA	NA	NA	NA
WP_011347526.1|1010017_1010497_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011347527.1|1010512_1013014_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	31.9	1.4e-88
WP_011347528.1|1013181_1013535_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011347529.1|1013723_1014725_+	cation transporter	NA	A0A1V0SED0	Indivirus	26.4	4.1e-20
WP_049756420.1|1015019_1016138_+	MFS transporter	NA	NA	NA	NA	NA
1016103:1016162	attL	GGCTCTGTTGCAAAGATTGGCGGCAGTCAGAGGTAGGCTGTCGCTCTGCGCCGATCAGGC	NA	NA	NA	NA
WP_001389365.1|1016156_1016921_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_011347531.1|1016886_1017771_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|1017767_1018676_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011347532.1|1018678_1020397_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041855125.1|1020590_1020803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003830784.1|1022045_1022888_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032437899.1|1023005_1023539_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
WP_011347538.1|1024460_1025477_-	MFS transporter	NA	NA	NA	NA	NA
WP_087944905.1|1025442_1026592_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.6e-52
WP_011347540.1|1026724_1027165_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_001389365.1|1027297_1028062_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
1028057:1028937	attR	GCCTGATCGGCGCAGAGCGACAGCCTACCTCTGACTGCCGCCAATCTTTGCAACAGAGCCTTCAATCCACTGGGGTATATGAATTTTTCCTCGATTCCCATTCCTAGACAAATGAGATAAAGTTTTTCTGTGTAGAAGAAAAACTTTATTGCAATGAAATCACCCGTCCACCTGAATGCCTTGCGGGCGTTCGAGGCCAGCGCGCGCCACCAGAGCTTTTCCGCGGCAGCGGCCGAACTGAACGTGACGCCGGCAGCCGTTGGTCAGCTTGTGCGCACGCTGGAGGACGCGCTGGGGGCGCCGCTGTTCGAGCGGAGCAGCAGTGGGAAGGTGCGGCTGGTGCCGACCGAGGCGGCCGAGCGCGCGCTACCCGATATCCGGGCCGGGTTCAGTCGGTTGACGCTGGGTATGGAGCGATTGCGCGAGGGATCGACCAGCGGGGTGCTCACCGTGACGGTCAGCCCGGCGTTCGCCGCCAAGTGGCTGCTGCCGCGCATCGACCGATTCCAGGCCGCGTGCCCGGATACCGACGTGCGCCTGGACACCAATCACAAGTCGGTGGATTTCGTGGCCCAGCGGATCGATATCGGCGTGCGCTACGGCCTGGGGAACTGGCCGGGCCTGCAGGCCGACAAGCTCATGGATGAAGAAGTGTTCCCGGTGTGCTCCCCGGATCTGCTGCGCCAGCGCGGAAAGCTGCGTAAGCCGGGCGATCTGGCACGGCAGACCCTCATCCATGACCTGTCGATGGTCGGCCATGCGGGCTTCCCCACATGGGAGGCGTGGATGGAGAAAGCCGGAGTGGCAGATGCCGCGATGATCTGGCGCGGCTTGCAGATCAACAATTCAGCGGCCGTCCTGCAGGCGGCAATCGAGGGACA	NA	NA	NA	NA
>prophage 5
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	1112480	1143705	5178450	transposase,coat,integrase	Xanthomonas_phage(66.67%)	38	1098277:1098291	1150333:1150347
1098277:1098291	attL	GTGGCCTGCGCGCGA	NA	NA	NA	NA
WP_011347617.1|1112480_1113443_+|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011347618.1|1113618_1114674_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_011347619.1|1114858_1116133_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011347620.1|1116140_1119131_+|transposase	Tn3-like element TnXax1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.4	7.6e-86
WP_011347621.1|1119263_1120541_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_155405766.1|1120579_1120816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008575714.1|1121666_1122107_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_008575716.1|1122103_1122535_-	membrane protein	NA	NA	NA	NA	NA
WP_008575717.1|1122531_1122972_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_011347623.1|1122968_1123835_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033479010.1|1124089_1124398_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011347626.1|1124948_1125974_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	37.5	3.2e-52
WP_039417975.1|1126085_1126907_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011347629.1|1127118_1127307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347630.1|1127311_1127959_-	conjugal transfer protein TrbP	NA	A0A1W6DY89	Xanthomonas_phage	88.8	3.4e-108
WP_011347631.1|1127960_1129154_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	94.7	1.0e-211
WP_011347632.1|1129153_1129483_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	98.2	1.1e-54
WP_041855057.1|1129482_1130946_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	75.9	1.2e-172
WP_011347634.1|1131083_1131314_-	hypothetical protein	NA	A0A1W6DXZ2	Xanthomonas_phage	100.0	2.2e-30
WP_011347635.1|1131325_1131529_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	98.5	9.8e-30
WP_011347636.1|1131532_1131829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041855058.1|1132158_1132704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347638.1|1133004_1133190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041855059.1|1133186_1133438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041855132.1|1133990_1134329_+	phage-like protein	NA	Q38057	Xanthomonas_phage	83.0	6.4e-50
WP_005918116.1|1134367_1134760_-	hypothetical protein	NA	A0A077JCA3	Xanthomonas_phage	46.2	2.3e-19
WP_011347640.1|1134789_1136112_-	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	55.2	3.2e-129
WP_005918122.1|1136113_1136434_-	filamentous phage phiLf protein VI	NA	Q4LAU3	Stenotrophomonas_phage	46.2	1.2e-21
WP_005918124.1|1136568_1136808_-	hypothetical protein	NA	Q9XJ91	Xanthomonas_phage	97.5	7.4e-37
WP_005918131.1|1137684_1137813_-|coat	Phi-Lf prophage-derived major coat protein	coat	NA	NA	NA	NA
WP_005918133.1|1137840_1137957_-|coat	Phi-Lf prophage-derived minor coat protein	coat	NA	NA	NA	NA
WP_011347643.1|1137932_1138064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347644.1|1138095_1138392_-	hypothetical protein	NA	A0A1W6DXU2	Xanthomonas_phage	90.7	3.5e-44
WP_011347645.1|1138388_1139429_-	inovirus-type Gp2 protein	NA	A0A077JDC0	Xanthomonas_phage	98.0	5.5e-201
WP_039417963.1|1139760_1139976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080505884.1|1140060_1140564_+	hypothetical protein	NA	A0A077JCZ5	Xanthomonas_phage	96.2	1.5e-63
WP_011347650.1|1141728_1142472_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	52.5	5.7e-67
WP_087944892.1|1142549_1143705_+|transposase	IS3-like element ISXc8 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	1.6e-39
1150333:1150347	attR	TCGCGCGCAGGCCAC	NA	NA	NA	NA
>prophage 7
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	2193597	2229756	5178450	transposase	Leptospira_phage(50.0%)	31	NA	NA
WP_087942069.1|2193597_2194729_+|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_011348344.1|2195122_2195470_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_087944910.1|2195511_2196619_+|transposase	IS3-like element ISXca2 family transposase	transposase	S5WIU1	Leptospira_phage	38.3	7.7e-44
WP_074038731.1|2196824_2197982_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003490678.1|2198151_2198829_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_011348347.1|2198854_2199298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011348348.1|2199506_2200394_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	31.6	1.2e-31
WP_011348349.1|2200895_2203028_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_008576847.1|2203652_2204045_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_008576845.1|2204135_2204528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065613593.1|2204638_2205340_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_011348353.1|2205775_2206024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011348354.1|2206520_2206865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011348355.1|2206928_2207210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756423.1|2207193_2207586_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011348357.1|2207658_2209254_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_011348358.1|2209519_2209846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074038482.1|2210027_2210477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011348359.1|2210450_2211104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011348360.1|2211143_2215106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039419429.1|2215138_2215780_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_087944903.1|2215821_2216978_-|transposase	IS3-like element ISXc8 family transposase	transposase	NA	NA	NA	NA
WP_087942069.1|2217323_2218455_+|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_011348364.1|2218790_2219321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080505898.1|2219686_2220208_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_011348365.1|2220247_2221384_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_011038242.1|2221415_2221928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039418204.1|2223084_2224632_-	histidine kinase	NA	NA	NA	NA	NA
WP_074038727.1|2224710_2225361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345631.1|2225923_2226904_-|transposase	IS5-like element IS1646 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	7.4e-99
WP_087944903.1|2228600_2229756_+|transposase	IS3-like element ISXc8 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	2622218	2630263	5178450		Escherichia_phage(28.57%)	7	NA	NA
WP_011348607.1|2622218_2623565_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	1.3e-32
WP_011348608.1|2623611_2625015_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.8	1.5e-47
WP_008576953.1|2625304_2626471_-	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	57.6	4.7e-116
WP_039416342.1|2626811_2627714_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	2.2e-25
WP_011348610.1|2627710_2628268_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.8	2.5e-43
WP_011348611.1|2628264_2629152_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	1.6e-95
WP_011348612.1|2629207_2630263_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.3	6.8e-82
>prophage 9
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	3133627	3213556	5178450	transposase,plate,protease	Ralstonia_phage(25.0%)	57	NA	NA
WP_011345631.1|3133627_3134608_+|transposase	IS5-like element IS1646 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	7.4e-99
WP_041855153.1|3134719_3135151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011348965.1|3135291_3136023_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.8	1.4e-09
WP_039418991.1|3136205_3136745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011348967.1|3136754_3137186_-	hotdog family protein	NA	NA	NA	NA	NA
WP_011348968.1|3137172_3139539_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_041469883.1|3139528_3139810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011348969.1|3139745_3139973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011348970.1|3140111_3140759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008571161.1|3140682_3141657_-	acyltransferase	NA	NA	NA	NA	NA
WP_011348971.1|3141653_3141941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011348972.1|3141952_3142702_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011348973.1|3142755_3143502_-	xanthomonadin biosynthesis membrane protein	NA	NA	NA	NA	NA
WP_005914783.1|3143476_3143746_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_039418047.1|3144049_3145396_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_074038914.1|3145509_3146403_+	pteridine-dependent deoxygenase	NA	NA	NA	NA	NA
WP_046934810.1|3146708_3148016_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_041855091.1|3148642_3151003_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_039418043.1|3151433_3152150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011348981.1|3152146_3152740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008571148.1|3153142_3154042_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011348983.1|3154885_3157687_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.3	6.2e-66
WP_008571145.1|3157763_3158054_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_011348984.1|3158409_3159453_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011348985.1|3159502_3167686_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_029820696.1|3167697_3169374_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011348987.1|3169370_3169832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011348988.1|3169828_3173524_-	protein kinase	NA	Q0N495	Clanis_bilineata_nucleopolyhedrovirus	29.2	1.2e-08
WP_011348989.1|3173528_3174245_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_039417626.1|3174241_3174817_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_041855092.1|3174813_3178344_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_039417628.1|3178340_3179618_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011348993.1|3179599_3180934_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011348994.1|3181436_3182327_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_039417629.1|3182576_3183458_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011348996.1|3183516_3184848_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_008573306.1|3185167_3185716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008573304.1|3185712_3187680_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.9	7.3e-37
WP_011348998.1|3187829_3189161_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011348999.1|3189396_3189711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041855093.1|3189754_3192274_-	tetratricopeptide repeat protein	NA	A0A2P1EMR8	Moumouvirus	30.2	1.0e-11
WP_039419276.1|3192252_3192792_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011349002.1|3193141_3193669_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011349003.1|3193659_3194736_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_039419279.1|3195197_3198086_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011349005.1|3198189_3199491_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_011349006.1|3199563_3200868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011349007.1|3201485_3202220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349008.1|3202280_3202940_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011349009.1|3202991_3203381_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_039419229.1|3204571_3204835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126952868.1|3205281_3205776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349013.1|3205908_3206406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942069.1|3206577_3207709_+|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_011349014.1|3207849_3210612_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	27.5	9.5e-75
WP_011349015.1|3210668_3211709_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_041855094.1|3211672_3213556_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	4220298	4231809	5178450	transposase	Leptospira_phage(50.0%)	11	NA	NA
WP_011346248.1|4220298_4220997_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041855019.1|4221389_4221827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011346250.1|4221823_4223467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041855020.1|4223552_4224410_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	34.0	7.6e-39
WP_011346252.1|4224406_4224700_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087944898.1|4224770_4225857_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	2.9e-43
WP_046935371.1|4226960_4227599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345631.1|4227738_4228719_-|transposase	IS5-like element IS1646 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	7.4e-99
WP_080505912.1|4229641_4230070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011346255.1|4230410_4230593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942069.1|4230676_4231809_-|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
>prophage 11
NZ_CP017190	Xanthomonas campestris pv. vesicatoria str. 85-10, complete sequence	5178450	4737476	4780224	5178450	integrase,protease,transposase	Bacillus_phage(18.18%)	42	4765063:4765080	4780310:4780327
WP_003483788.1|4737476_4738763_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
WP_011346585.1|4738907_4741379_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	3.8e-224
WP_011346586.1|4741592_4741865_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	1.7e-21
WP_011346587.1|4742504_4744475_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011346588.1|4745137_4746316_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011346589.1|4746312_4747080_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011346590.1|4747092_4747749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011346591.1|4747776_4748229_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_008571573.1|4748237_4748972_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.9	2.3e-36
WP_011346592.1|4749013_4749718_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_109298542.1|4750274_4751576_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_109298543.1|4751591_4753571_-	molybdopterin-guanine dinucleotide biosynthesis protein MobA	NA	NA	NA	NA	NA
WP_011346595.1|4753817_4754171_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_126952843.1|4754281_4754839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011346597.1|4754777_4755164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942069.1|4755233_4756365_+|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_074038611.1|4756694_4757090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011346598.1|4757101_4757851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074038610.1|4757979_4758315_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011346600.1|4758699_4759104_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	1.1e-16
WP_039416578.1|4759315_4760365_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011346602.1|4760385_4761135_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011346603.1|4761134_4761884_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	1.9e-09
WP_011346604.1|4761883_4762915_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011346605.1|4762911_4763292_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011346606.1|4763316_4763814_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_008571288.1|4763810_4764056_+	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_039416583.1|4764052_4764499_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
4765063:4765080	attL	CTGGCGGAGAGAGGGGGA	NA	NA	NA	NA
WP_074038609.1|4765832_4766258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011346608.1|4766576_4767476_-	site-specific DNA-methyltransferase	NA	S4VTY0	Pandoravirus	66.2	1.6e-103
WP_046934847.1|4767688_4768048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011346610.1|4768065_4768380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087944180.1|4768453_4769561_+|transposase	IS3-like element ISXca2 family transposase	transposase	S5WIU1	Leptospira_phage	38.3	5.9e-44
WP_011346611.1|4769932_4770412_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_039417682.1|4770565_4771192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087944892.1|4772123_4773279_+|transposase	IS3-like element ISXc8 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.5	1.6e-39
WP_011346615.1|4774197_4775061_+	excinuclease Cho	NA	NA	NA	NA	NA
WP_011346616.1|4775209_4775464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011346617.1|4775728_4777330_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_011346618.1|4777382_4777724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011346619.1|4777880_4778561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011346620.1|4778706_4780224_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4780310:4780327	attR	CTGGCGGAGAGAGGGGGA	NA	NA	NA	NA
>prophage 1
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	0	8223	182571		Salmonella_phage(100.0%)	6	NA	NA
WP_041854952.1|291_795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129111526.1|791_1706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345660.1|1716_4620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345659.1|4680_5667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345658.1|5669_6323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041854950.1|6831_8223_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	50.0	7.8e-110
>prophage 2
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	23204	24122	182571		Arthrobacter_phage(100.0%)	1	NA	NA
WP_011345641.1|23204_24122_-	M23 family metallopeptidase	NA	V5R8R0	Arthrobacter_phage	41.2	9.6e-08
>prophage 3
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	32534	38518	182571	transposase	Ralstonia_phage(50.0%)	5	NA	NA
WP_011345631.1|32534_33515_+|transposase	IS5-like element IS1646 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	7.4e-99
WP_152667177.1|33619_33901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087944894.1|34302_35458_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	3.1e-88
WP_100101058.1|35920_37022_+|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_011345631.1|37537_38518_-|transposase	IS5-like element IS1646 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	7.4e-99
>prophage 4
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	61213	62506	182571		Aeromonas_phage(100.0%)	1	NA	NA
WP_011345611.1|61213_62506_-	AAA family ATPase	NA	A0A1I9KF58	Aeromonas_phage	29.6	2.8e-29
>prophage 5
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	76289	76796	182571		Pseudomonas_phage(100.0%)	1	NA	NA
WP_046936165.1|76289_76796_-	hypothetical protein	NA	A0A2H4P790	Pseudomonas_phage	37.2	7.6e-23
>prophage 6
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	86353	90073	182571		Streptococcus_phage(50.0%)	3	NA	NA
WP_011345748.1|86353_88540_+	DNA topoisomerase TraE	NA	A0A1X9I6W8	Streptococcus_phage	27.5	1.6e-32
WP_011345746.1|88765_89506_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011345745.1|89776_90073_+	hypothetical protein	NA	A0A1I9KFG5	Aeromonas_phage	59.3	9.0e-16
>prophage 7
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	95773	97801	182571		Roseobacter_phage(100.0%)	1	NA	NA
WP_011345737.1|95773_97801_+	DEAD/DEAH box helicase	NA	A0A1B0UY08	Roseobacter_phage	25.0	8.9e-22
>prophage 8
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	101942	145879	182571	integrase,transposase	Salmonella_phage(21.43%)	40	106523:106539	142529:142545
WP_011345730.1|101942_102854_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	34.8	5.7e-45
WP_011345729.1|102869_104093_-	site-specific DNA-methyltransferase	NA	A0A142KCX9	Gordonia_phage	25.8	7.1e-06
WP_011345728.1|104106_104685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345727.1|104700_105519_-	DNA methyltransferase	NA	A0A2K8I312	Pseudomonas_phage	44.4	1.2e-54
WP_011345726.1|105765_106143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345725.1|106238_106592_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
106523:106539	attL	CCTGGCGCAGCTGCGGC	NA	NA	NA	NA
WP_011345724.1|106780_107080_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_041854964.1|107388_107739_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_011345722.1|108037_109126_+	acyltransferase	NA	A0A2H4J8Z5	uncultured_Caudovirales_phage	28.8	1.5e-12
WP_129111511.1|109170_109860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129111510.1|109899_110289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100666167.1|110393_111425_-	hypothetical protein	NA	A0A172Q0B8	Acinetobacter_phage	29.6	3.2e-28
WP_011345719.1|111465_111861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345718.1|111928_113149_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	27.4	1.2e-18
WP_129111531.1|113170_113620_-	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	52.1	7.7e-35
WP_011345716.1|113720_114611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345715.1|114607_115078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129111532.1|115097_115796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129111533.1|115792_116203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041854963.1|116253_116592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041854962.1|116749_118105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011345711.1|118365_121326_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.5	1.1e-81
WP_005918428.1|122323_123022_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_011345576.1|123040_126016_-|transposase	Tn3-like element ISXc4 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.1	4.7e-253
WP_003491210.1|126020_126440_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003491212.1|126439_126679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003491216.1|126893_127817_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.4	2.8e-39
WP_087944895.1|127821_128879_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.1	3.9e-37
WP_074038421.1|130343_130991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011037255.1|131081_132419_+	avirulence protein	NA	NA	NA	NA	NA
WP_011345705.1|132690_133257_-	recombinase family protein	NA	Q71TD8	Escherichia_phage	53.0	3.0e-44
WP_005917852.1|133446_133707_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011053002.1|133703_134105_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_005917846.1|134129_134393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011053001.1|134399_135587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011345704.1|135866_137093_+	replication protein	NA	NA	NA	NA	NA
WP_011345703.1|137423_140387_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.2	1.2e-80
WP_011345701.1|141554_142622_+	cointegrate resolution protein T	NA	NA	NA	NA	NA
142529:142545	attR	CCTGGCGCAGCTGCGGC	NA	NA	NA	NA
WP_011345700.1|142609_143647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942069.1|144746_145879_-|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
>prophage 9
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	154916	158228	182571		Bacillus_phage(100.0%)	1	NA	NA
WP_011345687.1|154916_158228_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	28.4	4.2e-29
>prophage 10
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	162299	163391	182571		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_011345682.1|162299_163391_-	AAA family ATPase	NA	A0A2D2W2C3	Stenotrophomonas_phage	31.0	3.2e-10
>prophage 11
NZ_CP017191	Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence	182571	171396	171846	182571		Pseudomonas_phage(100.0%)	1	NA	NA
WP_011345672.1|171396_171846_+	hypothetical protein	NA	A0A1Y0SZR3	Pseudomonas_phage	51.5	2.9e-13
