The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5363581	1339938	1351708	5363581		Enterobacteria_phage(37.5%)	11	NA	NA
WP_005913435.1|1339938_1340895_-	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
WP_005920793.1|1340875_1341604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851443.1|1341767_1342712_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_016851442.1|1342711_1343458_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_005920787.1|1343677_1344733_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	8.0e-83
WP_005913450.1|1344784_1345672_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.5	8.5e-94
WP_016851441.1|1345668_1346226_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
WP_029829443.1|1346222_1347122_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	4.1e-27
WP_016850197.1|1347462_1348629_+	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.1	2.7e-116
WP_016850199.1|1348911_1350315_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	6.5e-48
WP_005913455.1|1350361_1351708_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
>prophage 2
NZ_CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5363581	1862350	1951167	5363581	terminase,head,integrase,capsid,portal,transposase,tail,tRNA,plate,holin	Stenotrophomonas_phage(53.85%)	87	1913286:1913330	1951313:1951357
WP_029996360.1|1862350_1864501_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_078585854.1|1867248_1867431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003489572.1|1867504_1868749_-	MFS transporter	NA	NA	NA	NA	NA
WP_005913639.1|1869205_1869499_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_026007111.1|1869810_1871088_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_016849979.1|1873383_1874346_-|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016849980.1|1875644_1877192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851028.1|1878716_1879247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081341541.1|1879554_1882743_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_026007320.1|1883209_1883524_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_070996147.1|1885368_1885899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070996149.1|1886206_1889701_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_026007320.1|1890167_1890482_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_026007196.1|1894564_1895104_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.9	9.6e-24
WP_016850980.1|1895261_1895546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078585916.1|1895604_1896321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029829333.1|1896494_1897238_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_016850983.1|1897396_1899163_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005913643.1|1899585_1900113_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005913644.1|1900288_1900888_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003482581.1|1900977_1901706_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003482580.1|1901835_1902360_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003482577.1|1902478_1903063_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005921446.1|1903259_1905164_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	3.7e-78
WP_016849298.1|1905166_1905397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003482572.1|1905436_1906477_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_033483113.1|1906529_1906988_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003482569.1|1906999_1907779_+	protein TolQ	NA	NA	NA	NA	NA
WP_016849299.1|1907936_1908386_+	protein TolR	NA	NA	NA	NA	NA
WP_029829330.1|1908375_1909416_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003482565.1|1909601_1910921_+	protein TolB	NA	NA	NA	NA	NA
WP_003482562.1|1910978_1911497_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011052060.1|1911503_1912322_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_016850466.1|1912364_1913048_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.0	3.0e-38
1913286:1913330	attL	TGGTGGGCCGTGATGGATTCGAACCATCGACCAAAAGATTAAAAG	NA	NA	NA	NA
WP_011038085.1|1913484_1913820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850467.1|1914163_1914649_+	peptidase S24	NA	A0A218MND2	uncultured_virus	38.7	1.1e-13
WP_050595578.1|1916655_1917882_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016851201.1|1917881_1918349_+	DUF4411 domain-containing protein	NA	NA	NA	NA	NA
WP_029996358.1|1918380_1919076_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	1.1e-107
WP_053503138.1|1918993_1919239_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_029996356.1|1919264_1920287_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	3.1e-140
WP_033483117.1|1920286_1922071_-|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	76.8	6.6e-271
WP_029996354.1|1922192_1923035_+|capsid	phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	1.4e-66
WP_029996353.1|1923081_1924098_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	8.4e-138
WP_016851435.1|1924101_1924821_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.5	1.0e-68
WP_029996352.1|1924919_1925387_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.4e-31
WP_005917735.1|1925386_1925596_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005917737.1|1925600_1925957_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_005922189.1|1925949_1926225_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_080671044.1|1926221_1926863_+	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.9	1.3e-48
WP_016851123.1|1926862_1927351_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.4	5.8e-28
WP_016851122.1|1927347_1927767_+|tail	tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	7.4e-40
WP_016851121.1|1927754_1928210_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	59.0	1.3e-37
WP_080573070.1|1928382_1929207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081341542.1|1929389_1929692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851120.1|1930098_1930989_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	4.7e-84
WP_026007225.1|1930981_1931530_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.6	7.9e-50
WP_016851118.1|1931533_1932739_+	hypothetical protein	NA	A0A1S5NTG6	Burkholderia_phage	46.2	9.6e-32
WP_080573069.1|1932692_1932968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851116.1|1933046_1933610_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.6	7.4e-27
WP_016851115.1|1933606_1933966_+|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.6e-35
WP_016851114.1|1933977_1935144_+|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	64.5	2.6e-135
WP_016851197.1|1935174_1935684_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	78.1	5.8e-71
WP_029996350.1|1935729_1936032_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	1.4e-24
WP_005922203.1|1936040_1936154_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029996349.1|1936183_1939054_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	5.2e-185
WP_016851190.1|1939066_1939468_+|tail	tail assembly protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	2.5e-37
WP_016851189.1|1939464_1940451_+	phage late control protein	NA	V9IQM7	Stenotrophomonas_phage	55.1	4.0e-92
WP_080573077.1|1940737_1941685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080573076.1|1941650_1941989_+	DUF4325 domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	32.0	1.8e-07
WP_080573075.1|1941993_1942458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026007241.1|1942764_1943193_-	XRE family transcriptional regulator	NA	A4JWR8	Burkholderia_virus	42.8	1.4e-17
WP_016851187.1|1943259_1943514_+	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
WP_080573074.1|1943520_1943832_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.0	5.0e-25
WP_016851186.1|1943854_1944136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038118.1|1944132_1944372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080573081.1|1944399_1947063_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_016851184.1|1947356_1947575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080573080.1|1947625_1947850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851182.1|1947846_1948110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851181.1|1948188_1948599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080573078.1|1948612_1948768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026007240.1|1948760_1949036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080573079.1|1949128_1949278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851176.1|1949543_1949750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038128.1|1949707_1949968_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.2e-18
WP_026007239.1|1949967_1951167_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.5	2.3e-118
1951313:1951357	attR	TGGTGGGCCGTGATGGATTCGAACCATCGACCAAAAGATTAAAAG	NA	NA	NA	NA
>prophage 3
NZ_CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5363581	3198613	3206469	5363581	coat	Xanthomonas_phage(63.64%)	16	NA	NA
WP_033482610.1|3198613_3198952_+	phage-like protein	NA	Q38057	Xanthomonas_phage	81.2	7.1e-49
WP_033482613.1|3199018_3199330_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	89.3	2.1e-47
WP_033482614.1|3199349_3200672_-	filamentous phage phiLf protein I	NA	Q4LAU4	Stenotrophomonas_phage	55.2	2.4e-129
WP_029219915.1|3200673_3200994_-|coat	minor coat protein	coat	Q4LAU3	Stenotrophomonas_phage	46.2	1.5e-21
WP_005918124.1|3201004_3201244_-	hypothetical protein	NA	Q9XJ91	Xanthomonas_phage	97.5	7.4e-37
WP_033482619.1|3202132_3202261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075241185.1|3202289_3202406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080683254.1|3202381_3202513_-|coat	coat protein	coat	NA	NA	NA	NA
WP_033482623.1|3202544_3202841_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	65.6	1.5e-26
WP_033482625.1|3202837_3203944_-	replication protein	NA	S0F3I3	Stenotrophomonas_phage	75.1	1.0e-160
WP_033482627.1|3203936_3204116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033482628.1|3204278_3204503_-	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	89.9	8.0e-25
WP_080683255.1|3204630_3205119_+	hypothetical protein	NA	A0A077JCZ5	Xanthomonas_phage	94.6	8.0e-62
WP_016850842.1|3205192_3205444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050595534.1|3205520_3205871_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	37.7	7.9e-11
WP_050595535.1|3205875_3206469_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	45.2	4.3e-25
>prophage 4
NZ_CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5363581	3710618	3731805	5363581	portal,capsid,tail,head	Xanthomonas_virus(23.08%)	19	NA	NA
WP_033482658.1|3710618_3715019_-	hypothetical protein	NA	C4ML20	Xanthomonas_virus	50.7	0.0e+00
WP_029828853.1|3715009_3715402_-	hypothetical protein	NA	Q2NPH1	Xanthomonas_virus	52.8	4.1e-32
WP_029828851.1|3715401_3715869_-	DUF1833 domain-containing protein	NA	Q52PL0	Xanthomonas_phage	46.5	8.0e-35
WP_029828849.1|3715865_3716222_-	hypothetical protein	NA	Q52PL1	Xanthomonas_phage	44.4	1.6e-19
WP_029828847.1|3716221_3718939_-|tail	phage tail tape measure protein	tail	C4ML16	Xanthomonas_virus	34.0	2.4e-94
WP_029828845.1|3719100_3719580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828844.1|3719576_3720320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828843.1|3720359_3720791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828840.1|3720783_3721104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029828838.1|3721100_3721877_-	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	34.9	7.3e-25
WP_050595538.1|3721924_3722929_-|capsid	minor capsid protein E	capsid	A0A2H4J890	uncultured_Caudovirales_phage	40.8	1.6e-56
WP_033482660.1|3723000_3723672_-|head	head decoration protein	head	NA	NA	NA	NA
WP_029828834.1|3723674_3725078_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.9	1.2e-41
WP_033482662.1|3725067_3726570_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	48.3	4.2e-109
WP_029828831.1|3726562_3726778_-	hypothetical protein	NA	B7SYD5	Stenotrophomonas_phage	41.9	8.0e-06
WP_029828829.1|3726779_3728867_-	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	42.5	2.3e-153
WP_029828821.1|3730373_3730652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050595539.1|3730648_3731152_-	hypothetical protein	NA	Q2NPA5	Xanthomonas_phage	40.0	1.6e-20
WP_029828818.1|3731148_3731805_-	DNA primase	NA	A0A248XCW5	Klebsiella_phage	44.5	2.4e-37
>prophage 5
NZ_CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5363581	3751885	3762722	5363581	tRNA	Salmonella_phage(16.67%)	13	NA	NA
WP_029828741.1|3751885_3752794_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.9	3.1e-43
WP_033482666.1|3752797_3753553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828737.1|3753549_3753768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828735.1|3753764_3754208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828734.1|3754204_3754423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029828732.1|3754556_3754778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033482667.1|3754764_3754989_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_003481884.1|3755209_3755422_-	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_016849897.1|3755561_3758210_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	1.7e-84
WP_003481873.1|3758311_3758800_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_003481871.1|3759111_3760146_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
WP_005915033.1|3760318_3760960_-	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_005915030.1|3761045_3762722_-	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.4	1.9e-41
>prophage 6
NZ_CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5363581	4494981	4538130	5363581	terminase,head,capsid,portal,tail,protease,plate,holin	Stenotrophomonas_phage(62.86%)	54	NA	NA
WP_003483788.1|4494981_4496268_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
WP_002806026.1|4496393_4497020_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_016851282.1|4497112_4498405_-	trigger factor	NA	NA	NA	NA	NA
WP_016851283.1|4500419_4500617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033482901.1|4500802_4501132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016851285.1|4502139_4503261_+	hypothetical protein	NA	A0A1B0VBT5	Salmonella_phage	29.4	1.9e-29
WP_026007262.1|4504402_4505302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078585598.1|4506229_4506646_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_029828252.1|4506818_4507520_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.5	2.1e-103
WP_078585599.1|4507437_4507683_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	7.0e-14
WP_016850658.1|4507708_4508722_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.9	5.8e-139
WP_029828248.1|4508721_4510485_-|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	76.8	1.2e-269
WP_029828246.1|4510627_4511470_+|capsid	phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	3.4e-68
WP_029828245.1|4511516_4512530_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	9.3e-137
WP_016851153.1|4512533_4513253_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.8	5.3e-70
WP_029828243.1|4513351_4513819_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	4.6e-30
WP_005917735.1|4513818_4514028_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005929454.1|4514032_4514389_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_005922189.1|4514381_4514657_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
WP_078585789.1|4514653_4515295_+	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.4	2.7e-49
WP_016851162.1|4515294_4515783_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.6	1.2e-28
WP_016851161.1|4515779_4516199_+|tail	tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.1e-40
WP_016851160.1|4516186_4516636_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.5	6.3e-37
WP_078585788.1|4516817_4518356_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016851159.1|4518451_4519342_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	2.6e-82
WP_029828239.1|4519334_4519877_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.1e-51
WP_016850456.1|4519889_4521689_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	37.6	8.9e-82
WP_016850455.1|4521762_4522056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850454.1|4522058_4522733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850453.1|4522875_4523439_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	8.2e-26
WP_016850452.1|4523435_4523795_+|plate	phage baseplate protein	plate	V9IQW0	Stenotrophomonas_phage	62.7	2.1e-35
WP_029828235.1|4523806_4524973_+|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	1.1e-133
WP_016850450.1|4525002_4525512_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	81.1	2.1e-73
WP_029828232.1|4525557_4525860_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	2.2e-25
WP_005922203.1|4525868_4525982_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_029828231.1|4526011_4528882_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.1	8.9e-193
WP_016851032.1|4528894_4529296_+|tail	tail assembly protein	tail	V9IQX3	Stenotrophomonas_phage	61.4	3.5e-39
WP_016851031.1|4529292_4530279_+	phage late control protein	NA	V9IQM7	Stenotrophomonas_phage	55.7	2.8e-93
WP_029828228.1|4530885_4531317_-	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	38.2	1.4e-09
WP_078537260.1|4531402_4531651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572766.1|4531653_4531974_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	58.7	2.0e-24
WP_016851009.1|4531984_4532263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851008.1|4532259_4532472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078585791.1|4532504_4535177_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_015472861.1|4535497_4535716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849269.1|4535712_4536000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849270.1|4535999_4536272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851003.1|4536401_4536776_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.8	1.7e-19
WP_014091203.1|4536768_4536951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851002.1|4536943_4537216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851001.1|4537212_4537437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851000.1|4537502_4537706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016850999.1|4537702_4537912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078585787.1|4537908_4538130_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.3	1.6e-14
