The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017715	Marinobacter salinus strain Hb8 chromosome, complete genome	4121005	522536	530472	4121005		Catovirus(33.33%)	7	NA	NA
WP_070965571.1|522536_523664_+	GDP-mannose 4,6-dehydratase	NA	M1IBD7	Acanthocystis_turfacea_Chlorella_virus	66.4	6.7e-136
WP_070965573.1|523660_524632_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	53.2	6.7e-92
WP_070965575.1|524679_526086_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.3	1.3e-56
WP_070973521.1|526093_526867_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.6	4.8e-08
WP_070965578.1|526879_527824_+	SDR family oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	24.1	1.5e-11
WP_070973522.1|527875_528433_+	sugar transferase	NA	NA	NA	NA	NA
WP_070965581.1|528528_530472_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	26.7	2.8e-17
>prophage 2
NZ_CP017715	Marinobacter salinus strain Hb8 chromosome, complete genome	4121005	2258903	2268555	4121005	tRNA	Paramecium_bursaria_Chlorella_virus(16.67%)	9	NA	NA
WP_070969424.1|2258903_2260529_+	L-aspartate oxidase	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	28.3	4.5e-24
WP_070969426.1|2260578_2260851_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_070969428.1|2260834_2261296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969431.1|2261317_2262322_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_070969434.1|2262438_2263272_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	35.8	3.0e-24
WP_070969437.1|2263275_2264007_-	uracil-DNA glycosylase	NA	A0A2D0TCL0	Cercopithecine_herpesvirus	43.8	8.4e-47
WP_070969441.1|2264010_2265552_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	36.1	1.1e-83
WP_099092552.1|2265604_2266700_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.1	8.2e-06
WP_070969443.1|2266821_2268555_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	7.5e-62
>prophage 3
NZ_CP017715	Marinobacter salinus strain Hb8 chromosome, complete genome	4121005	2333060	2375336	4121005	tRNA,integrase,capsid,terminase,head,portal,tail	Pseudomonas_phage(41.94%)	68	2334942:2334992	2375619:2375669
WP_070969615.1|2333060_2333651_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_070969618.1|2333732_2334824_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
2334942:2334992	attL	ACAGCACTCATAATGCTGGGGTCGGCGGTTCGACTCCGCCCCTTGCTACCA	NA	NA	NA	NA
WP_070969621.1|2335013_2336129_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	43.3	3.7e-78
WP_070969623.1|2336349_2336745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969626.1|2336747_2337152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969629.1|2337164_2337527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969632.1|2337528_2337978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969635.1|2338029_2338692_+	SOS response-associated peptidase	NA	A0A2D1GMM4	Marinobacter_phage	71.5	8.3e-94
WP_070969638.1|2338694_2339075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969641.1|2339071_2340160_-	hypothetical protein	NA	A0A291L9Z9	Bordetella_phage	56.1	5.2e-101
WP_083329204.1|2340156_2340483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969644.1|2340430_2340730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969646.1|2340729_2341380_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	41.3	2.5e-34
WP_070969649.1|2341376_2341604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969652.1|2341597_2341789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969655.1|2341769_2342030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969657.1|2342026_2342215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969660.1|2342257_2342872_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_070969663.1|2342875_2343097_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	60.3	2.5e-15
WP_070969666.1|2343077_2343284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969669.1|2343276_2343465_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_070969672.1|2343436_2343934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969676.1|2344176_2344566_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070969678.1|2344726_2345461_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_070969680.1|2345515_2346124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969688.1|2346125_2346656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083329306.1|2346689_2347466_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	52.7	4.4e-46
WP_070969702.1|2347578_2348016_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	37.3	1.4e-09
WP_070969704.1|2348050_2348452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157755420.1|2348545_2348995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070969714.1|2348988_2349318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969716.1|2349599_2350007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083329307.1|2350114_2350816_+	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	43.5	4.6e-34
WP_070969722.1|2350812_2351829_+	replication protein O	NA	A0A067ZIA1	Vibrio_phage	44.5	8.1e-24
WP_070969728.1|2351818_2352493_+	hypothetical protein	NA	I3PUZ9	Vibrio_phage	38.9	6.3e-41
WP_070969731.1|2352489_2352801_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	40.6	3.7e-12
WP_070969733.1|2352813_2353125_+	recombinase	NA	NA	NA	NA	NA
WP_070969736.1|2353124_2353637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969739.1|2353769_2353985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969742.1|2354055_2354364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157755421.1|2354360_2354642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969748.1|2354628_2354877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969751.1|2354873_2355239_+	hypothetical protein	NA	A0A1Y0SUD7	Pseudomonas_phage	50.0	9.7e-20
WP_157755422.1|2355356_2355527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969755.1|2355526_2355934_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	57.0	3.0e-38
WP_070969758.1|2356010_2356475_+|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	63.2	2.3e-34
WP_070969761.1|2356478_2358179_+|terminase	terminase large subunit	terminase	A0A1J0GUY5	Halomonas_phage	87.4	4.0e-302
WP_157755423.1|2358175_2358325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969764.1|2358321_2359887_+|portal	phage portal protein	portal	M1PLL1	Streptococcus_phage	40.9	2.3e-78
WP_070969766.1|2360004_2360874_+	S49 family peptidase	NA	A0A2I6UH21	Salinibacter_virus	30.8	1.7e-25
WP_070969769.1|2360929_2362243_+|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	34.9	1.6e-40
WP_070969771.1|2362311_2362740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969774.1|2362740_2362977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969777.1|2363019_2363619_+	hypothetical protein	NA	A0A0F7L420	uncultured_marine_virus	42.1	1.3e-34
WP_099092588.1|2363624_2363960_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	65.5	6.8e-36
WP_070969782.1|2363949_2364489_+	hypothetical protein	NA	K7PM60	Enterobacteria_phage	55.6	1.0e-49
WP_070969785.1|2364485_2364770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969788.1|2364766_2365132_+	DUF3168 domain-containing protein	NA	A0A1J0GUW9	Halomonas_phage	72.7	1.3e-48
WP_083329308.1|2365285_2365936_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	30.8	1.3e-19
WP_070969793.1|2365935_2366283_+|tail	phage tail protein	tail	Q9MCA4	Pseudomonas_phage	61.9	1.2e-30
WP_070969796.1|2366315_2366579_+	hypothetical protein	NA	A0A0U4J8S9	Pseudomonas_phage	51.2	7.7e-19
WP_070969799.1|2366619_2366928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070969802.1|2366989_2369149_+	hypothetical protein	NA	A0A0U4JEA4	Pseudomonas_phage	33.8	9.4e-70
WP_070969805.1|2369148_2369613_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	45.8	4.7e-35
WP_070969808.1|2369623_2370103_+	DUF1833 domain-containing protein	NA	A0A2H4PI86	Pseudomonas_phage	34.2	1.8e-18
WP_070969810.1|2370102_2370501_+	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	40.9	9.0e-19
WP_070969813.1|2370490_2373148_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	38.7	2.0e-162
WP_070969816.1|2373209_2375336_+	hypothetical protein	NA	A0A127KNR5	Pseudomonas_phage	38.5	1.3e-18
2375619:2375669	attR	ACAGCACTCATAATGCTGGGGTCGGCGGTTCGACTCCGCCCCTTGCTACCA	NA	NA	NA	NA
