The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	427002	435330	3788814		Tupanvirus(33.33%)	7	NA	NA
WP_070525969.1|427002_428319_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.5	1.1e-78
WP_083301021.1|428318_429275_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.4	1.0e-15
WP_070525973.1|429321_431088_-	GGDEF domain-containing protein	NA	I6XM43	Pseudomonas_phage	30.4	2.7e-06
WP_070525975.1|431203_432247_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	A0A2K9KZK0	Tupanvirus	28.2	2.2e-24
WP_070525977.1|432274_433192_-	formyltransferase	NA	NA	NA	NA	NA
WP_070525978.1|433188_434133_-	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	31.5	2.5e-35
WP_070525980.1|434205_435330_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L0G1	Tupanvirus	28.9	7.4e-34
>prophage 2
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	1057146	1063952	3788814		Acidithiobacillus_phage(83.33%)	10	NA	NA
WP_070527214.1|1057146_1058214_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	2.1e-22
WP_070527217.1|1058215_1058893_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_070527219.1|1058902_1059706_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_070527221.1|1059716_1060487_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070527224.1|1060645_1060972_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070527226.1|1061091_1061556_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	53.6	7.0e-39
WP_070527228.1|1061552_1061924_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	67.5	3.5e-41
WP_070527230.1|1061923_1063312_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	84.5	3.9e-226
WP_070527233.1|1063308_1063761_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	78.9	1.1e-62
WP_070527235.1|1063760_1063952_-	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	74.6	2.9e-15
>prophage 3
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	1067763	1103453	3788814	terminase,portal,head,tail,capsid	Acidithiobacillus_phage(45.45%)	49	NA	NA
WP_070527249.1|1067763_1068027_+	hypothetical protein	NA	K4I3X3	Acidithiobacillus_phage	62.1	2.3e-23
WP_070527252.1|1068038_1068515_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	65.2	6.7e-53
WP_070532311.1|1068520_1069282_+	antirepressor	NA	K4I1D2	Acidithiobacillus_phage	68.2	7.1e-89
WP_145927106.1|1069278_1070121_+	AAA family ATPase	NA	K4HZX9	Acidithiobacillus_phage	70.7	2.5e-111
WP_070527258.1|1070126_1070759_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.8	1.5e-76
WP_070527261.1|1070768_1071269_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	78.5	5.2e-72
WP_070527263.1|1071265_1072003_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	74.2	2.5e-107
WP_070527266.1|1071999_1072254_+	hypothetical protein	NA	K4I1D6	Acidithiobacillus_phage	71.9	1.5e-19
WP_070527269.1|1072250_1074542_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	65.1	4.8e-290
WP_070527272.1|1074667_1075132_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	70.5	2.5e-57
WP_070527274.1|1075133_1075343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527277.1|1075335_1075749_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_070527280.1|1076125_1077547_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	59.4	1.4e-159
WP_070527283.1|1077543_1078785_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	89.1	1.1e-216
WP_083300710.1|1078744_1078969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527286.1|1078968_1079331_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	87.5	4.0e-58
WP_070527289.1|1079431_1079791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527292.1|1079884_1080103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527295.1|1080195_1080717_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	81.3	1.3e-38
WP_070527297.1|1080811_1081018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070532313.1|1081110_1081377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527300.1|1081495_1082032_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	88.2	3.2e-80
WP_070527303.1|1082031_1083993_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	90.1	0.0e+00
WP_070527306.1|1084010_1084502_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	50.0	2.9e-27
WP_070527309.1|1084501_1084894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009521720.1|1084893_1085115_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	4.1e-13
WP_070527312.1|1085117_1086638_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.3	2.4e-152
WP_070527314.1|1086639_1087956_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	51.8	1.9e-65
WP_070527316.1|1087959_1088337_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	55.2	6.9e-29
WP_070527319.1|1088412_1089417_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	66.5	2.4e-129
WP_070527322.1|1089416_1089695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527325.1|1089705_1090131_+	hypothetical protein	NA	F4YCS3	Synechococcus_phage	30.2	2.0e-08
WP_070527327.1|1090135_1090339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527331.1|1090341_1091094_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.2	2.7e-56
WP_070527334.1|1091093_1091495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009521710.1|1091524_1091680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527337.1|1091683_1092325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527340.1|1092324_1095021_+|tail	phage tail protein	tail	A0A0U2BXT9	Paracoccus_phage	33.7	7.9e-26
WP_070527342.1|1095026_1096085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527345.1|1096081_1097644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527347.1|1097649_1098438_+	DUF2163 domain-containing protein	NA	A0A2D2W238	Stenotrophomonas_phage	32.8	3.6e-27
WP_009521704.1|1098456_1098684_+	hypothetical protein	NA	A0A2D0W9G1	Bordetella_phage	71.1	1.5e-10
WP_070527349.1|1098680_1098896_+	hypothetical protein	NA	A0A2D0W982	Bordetella_phage	47.7	2.7e-09
WP_070527352.1|1098895_1101169_+|tail	phage tail protein	tail	A0A0S0MX47	Pseudomonas_phage	38.9	1.8e-132
WP_070527355.1|1101192_1101789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527358.1|1101792_1102143_+	DUF2793 domain-containing protein	NA	A0A1X9IAR6	Xanthomonas_phage	57.8	3.2e-36
WP_070527361.1|1102210_1102516_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	68.5	1.9e-24
WP_070527364.1|1102512_1102989_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	86.7	6.8e-74
WP_070527367.1|1102985_1103453_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	76.8	9.1e-63
>prophage 4
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	1122567	1175275	3788814	plate,transposase,integrase	Stenotrophomonas_phage(22.22%)	44	1127877:1127894	1147766:1147783
WP_070527397.1|1122567_1122999_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	30.0	3.3e-11
WP_070527400.1|1125243_1125714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527403.1|1125836_1126925_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_070527405.1|1126917_1127514_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
1127877:1127894	attL	GGGGTACATTTAGGGGTA	NA	NA	NA	NA
WP_070527408.1|1127950_1129189_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	51.0	2.5e-107
WP_083300712.1|1130138_1130615_-	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_145927109.1|1130621_1133579_-	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	39.1	3.6e-11
WP_083300713.1|1133614_1135999_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_168163795.1|1136032_1138006_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_168163796.1|1138347_1140105_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_083300716.1|1140531_1140768_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_070527429.1|1141128_1141962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527432.1|1142028_1142235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527435.1|1142231_1142480_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	46.2	2.1e-10
WP_145927110.1|1142466_1142679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168163797.1|1142981_1143137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527438.1|1143129_1143375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527441.1|1143367_1143595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168163798.1|1143587_1143731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083300717.1|1143750_1144803_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	33.8	5.8e-33
WP_083300718.1|1144799_1146677_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_145927111.1|1146666_1147230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527450.1|1148066_1149503_+	hypothetical protein	NA	NA	NA	NA	NA
1147766:1147783	attR	GGGGTACATTTAGGGGTA	NA	NA	NA	NA
WP_070527453.1|1149499_1149763_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	47.3	7.2e-09
WP_070527456.1|1149770_1150871_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_070527459.1|1150937_1153571_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	33.6	3.2e-88
WP_070527462.1|1153611_1154631_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_070527465.1|1154594_1156454_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_083300719.1|1156469_1158503_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_083300720.1|1158493_1159060_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_168163799.1|1159121_1159697_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_070527471.1|1159775_1160567_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_070527475.1|1160567_1163198_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.9	4.5e-82
WP_083300722.1|1163202_1163706_-	OmpA family protein	NA	NA	NA	NA	NA
WP_070527481.1|1163729_1164227_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_070527484.1|1164273_1165752_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_070527487.1|1165768_1166278_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_070527490.1|1166332_1167349_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_083300723.1|1167357_1171095_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_083301031.1|1171141_1171846_-	M15 family metallopeptidase	NA	A0A0S2SY37	Bacillus_phage	38.9	2.3e-09
WP_070527494.1|1172115_1172679_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_070527497.1|1172725_1174075_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_070527500.1|1174097_1174793_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_070527502.1|1174789_1175275_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	1349584	1391865	3788814	plate,transposase,protease,terminase,head,portal,tail,holin,integrase,capsid	Pseudomonas_phage(29.41%)	68	1344702:1344719	1392754:1392771
1344702:1344719	attL	GCTCGACGCCGGCCGCGA	NA	NA	NA	NA
WP_070527892.1|1349584_1350559_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_145927127.1|1350594_1350783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527895.1|1351065_1352106_-	lactonase family protein	NA	NA	NA	NA	NA
WP_070527898.1|1352270_1353035_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_070527901.1|1353019_1353466_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070527903.1|1353477_1353663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070527906.1|1353675_1355409_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_083300749.1|1355564_1355822_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_070527911.1|1355882_1356116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145927128.1|1356112_1356475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527917.1|1356467_1356950_-	M23 family metallopeptidase	NA	A0A1B0XUH3	Freshwater_phage	45.9	2.0e-12
WP_070527920.1|1356946_1357258_-|holin	phage holin family protein	holin	E5E3R8	Burkholderia_phage	48.8	1.1e-11
WP_070527923.1|1357254_1357632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527926.1|1357628_1358159_-	hypothetical protein	NA	G4KKK1	Yersinia_phage	39.5	1.0e-30
WP_070527929.1|1358224_1358752_-	DUF4376 domain-containing protein	NA	B0VK51	Azospirillum_phage	38.3	1.7e-12
WP_145927129.1|1358763_1359345_-	hypothetical protein	NA	B5TK79	Pseudomonas_phage	54.5	7.7e-11
WP_070527931.1|1359344_1359941_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	41.2	1.0e-34
WP_070527934.1|1359928_1360972_-|plate	baseplate J/gp47 family protein	plate	A0A2H4JC98	uncultured_Caudovirales_phage	28.3	1.5e-17
WP_070527937.1|1360952_1361396_-	hypothetical protein	NA	Q8W616	Enterobacteria_phage	49.3	1.4e-25
WP_070527939.1|1361392_1361971_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	55.7	4.0e-28
WP_070527942.1|1361991_1363173_-	hypothetical protein	NA	B5TK72	Pseudomonas_phage	45.7	8.4e-73
WP_070527945.1|1363169_1364396_-	hypothetical protein	NA	Q8W619	Enterobacteria_phage	32.2	2.5e-35
WP_070527948.1|1364398_1366252_-	hypothetical protein	NA	R9U4C6	Rhizobium_phage	40.5	4.1e-58
WP_070527950.1|1366375_1366669_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	43.5	1.7e-11
WP_070527953.1|1366665_1367034_-	hypothetical protein	NA	A0A192Y8K0	Salmonella_phage	49.6	6.3e-27
WP_070527956.1|1367043_1368525_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	50.2	6.1e-121
WP_070527959.1|1368521_1368701_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	57.1	3.9e-06
WP_070527962.1|1368767_1369361_-	hypothetical protein	NA	S5FM61	Shigella_phage	40.9	4.1e-36
WP_070527964.1|1369357_1369843_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	34.8	1.6e-14
WP_070527966.1|1369839_1370175_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	41.0	1.7e-15
WP_070527969.1|1370171_1370519_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	42.7	3.8e-13
WP_070527972.1|1370518_1370719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527975.1|1370783_1371989_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	57.4	1.8e-123
WP_070527978.1|1371991_1372636_-|head,protease	HK97 family phage prohead protease	head,protease	B0VK32	Azospirillum_phage	50.5	7.4e-47
WP_070527981.1|1372622_1373855_-|portal	phage portal protein	portal	B0VK31	Azospirillum_phage	47.9	1.2e-93
WP_083300750.1|1373856_1375614_-|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	48.5	6.8e-135
WP_070527984.1|1375523_1376348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083300751.1|1376489_1376888_-	HNH endonuclease	NA	Q38456	Bacillus_phage	59.5	6.8e-35
WP_145927130.1|1377009_1377549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527989.1|1377632_1378058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527992.1|1378209_1378881_-	hypothetical protein	NA	I3PUZ9	Vibrio_phage	38.7	1.7e-33
WP_070527995.1|1378877_1379714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527997.1|1379710_1380019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070527999.1|1380198_1380675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145927131.1|1380763_1381243_-	hypothetical protein	NA	H2BD67	Pseudomonas_phage	42.3	5.9e-17
WP_083301036.1|1381376_1381613_-	hypothetical protein	NA	D0UIL8	Aggregatibacter_phage	50.0	3.9e-06
WP_070528005.1|1381698_1382409_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	29.3	1.8e-22
WP_070528008.1|1382453_1382867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083300753.1|1382808_1383273_+	helix-turn-helix transcriptional regulator	NA	A0A0U4JVR0	Pseudomonas_phage	33.3	1.9e-12
WP_070528011.1|1383265_1383715_+	hypothetical protein	NA	A0A1B0YZY0	Pseudomonas_phage	33.3	9.8e-14
WP_070528013.1|1383806_1384439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528016.1|1384460_1384886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528019.1|1385084_1385510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528021.1|1385502_1385682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528024.1|1385678_1385894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528027.1|1385890_1386118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168163808.1|1386162_1386330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528030.1|1386334_1386619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528033.1|1386775_1387051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528036.1|1387047_1387659_+	DUF1566 domain-containing protein	NA	A0A2I6PHV0	Pseudomonas_phage	34.0	3.3e-20
WP_168163809.1|1387868_1388030_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_070528038.1|1388049_1388457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528040.1|1388461_1389412_+	hypothetical protein	NA	H2BD37	Pseudomonas_phage	60.2	3.8e-23
WP_070528043.1|1389408_1389681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145927133.1|1389853_1390336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528048.1|1390332_1390572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070528051.1|1390668_1390878_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_070528054.1|1390878_1391865_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	30.6	4.8e-29
1392754:1392771	attR	GCTCGACGCCGGCCGCGA	NA	NA	NA	NA
>prophage 6
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	3063980	3123614	3788814	tRNA,protease,transposase,integrase	Enterobacteria_phage(15.38%)	59	3109442:3109465	3123642:3123665
WP_070530715.1|3063980_3064751_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_070530717.1|3064780_3065161_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_070530718.1|3065255_3065747_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_070530720.1|3065743_3066649_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.5e-26
WP_070530722.1|3066716_3067559_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_070530724.1|3067619_3069887_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.5e-166
WP_070530726.1|3069883_3070195_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	40.9	6.3e-12
WP_070530728.1|3070449_3070653_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	77.3	4.4e-22
WP_070530730.1|3070762_3071986_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	61.1	3.6e-10
WP_070530731.1|3072108_3072732_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_070530733.1|3072781_3073261_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_070530735.1|3073257_3074328_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_070530737.1|3074459_3075401_-	DegV family EDD domain-containing protein	NA	NA	NA	NA	NA
WP_070530738.1|3075564_3077019_-	YdgA family protein	NA	NA	NA	NA	NA
WP_070530740.1|3077102_3078473_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	1.6e-107
WP_145927215.1|3078737_3079601_+	2-oxoglutarate-dependent dioxygenase	NA	E5ER39	Bathycoccus_sp._RCC1105_virus	31.9	2.6e-23
WP_070530746.1|3079791_3080211_-	VOC family protein	NA	NA	NA	NA	NA
WP_070530748.1|3080264_3081617_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	38.6	1.7e-40
WP_070530750.1|3081995_3082604_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_070530753.1|3082614_3083031_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_070530755.1|3083283_3084300_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_070530757.1|3084280_3084466_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_070530760.1|3084473_3085241_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_070530762.1|3085261_3085915_+	adenylate kinase	NA	NA	NA	NA	NA
WP_070530763.1|3086251_3087229_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_145927216.1|3087318_3087702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070530767.1|3088000_3089248_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_070530769.1|3089263_3089941_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_070530770.1|3089983_3090640_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_070530772.1|3090641_3091343_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_070530774.1|3091576_3092353_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_070530776.1|3092540_3093932_-	GntP family permease	NA	NA	NA	NA	NA
WP_083300936.1|3094286_3095717_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_070530777.1|3095760_3096693_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_070530779.1|3096689_3097463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070530781.1|3097462_3099382_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.9	3.4e-87
WP_070530783.1|3099499_3099886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168163841.1|3100133_3103811_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_070530788.1|3103978_3104929_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_083300938.1|3105041_3106169_+	DUF3999 family protein	NA	NA	NA	NA	NA
WP_070530793.1|3106374_3106815_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_070530794.1|3106820_3107357_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_070530796.1|3107432_3108887_-	hypothetical protein	NA	NA	NA	NA	NA
3109442:3109465	attL	CGTATCCCTAAACGTATACCTAAA	NA	NA	NA	NA
WP_145927111.1|3109995_3110559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070530798.1|3110548_3112387_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_070532790.1|3112383_3113382_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	34.1	1.4e-31
WP_168163842.1|3113456_3113600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070530800.1|3113592_3114303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070530802.1|3114762_3114975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070530804.1|3114961_3115231_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	46.3	2.8e-08
WP_083300942.1|3115227_3115431_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070530805.1|3115586_3116405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145927217.1|3117283_3118105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083300943.1|3118105_3118675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070530809.1|3118821_3119925_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_145927218.1|3119927_3120698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083300944.1|3121254_3122277_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	38.2	2.7e-51
WP_070529791.1|3122267_3123218_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_083300945.1|3123179_3123614_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	44.7	4.7e-21
3123642:3123665	attR	CGTATCCCTAAACGTATACCTAAA	NA	NA	NA	NA
>prophage 7
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	3346711	3417837	3788814	tRNA,plate,transposase	Pseudomonas_phage(15.38%)	57	NA	NA
WP_070531171.1|3346711_3347713_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.8	1.1e-33
WP_070531174.1|3347792_3350147_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_070531176.1|3350167_3350485_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.5e-11
WP_070531178.1|3350450_3350810_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070529791.1|3350905_3351856_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_070531180.1|3352319_3353300_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_083300963.1|3353373_3353529_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	64.6	8.0e-08
WP_070531182.1|3353529_3354186_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	78.4	4.1e-77
WP_083300964.1|3354165_3354633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083300965.1|3354670_3355858_-	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_070531186.1|3355883_3357119_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_070531188.1|3357124_3359995_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.6	3.5e-88
WP_070529791.1|3360133_3361084_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_145927233.1|3361619_3365084_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_070531192.1|3365080_3368680_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	29.7	2.1e-05
WP_070531194.1|3368676_3370656_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.4	3.5e-23
WP_070531195.1|3370740_3372126_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	29.8	1.6e-43
WP_070531197.1|3372138_3373659_-	MFS transporter	NA	NA	NA	NA	NA
WP_083300966.1|3373653_3374622_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070531201.1|3374707_3375808_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.9	7.1e-82
WP_070531203.1|3375821_3376460_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_070531205.1|3376470_3377307_+	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_070532842.1|3377435_3377816_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_070531207.1|3378018_3379305_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_070531209.1|3379301_3380054_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070531212.1|3380275_3380596_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070531216.1|3380680_3382624_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.5	2.4e-96
WP_168163865.1|3382658_3383627_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_070531220.1|3383608_3384172_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_070531223.1|3384588_3384774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070532848.1|3384914_3385667_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_070531226.1|3385793_3386558_-	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083300968.1|3386834_3389795_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_070531230.1|3390340_3391288_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_070531233.1|3391284_3391941_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_070531241.1|3391933_3392293_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_070531245.1|3392315_3393257_+	S49 family peptidase	NA	A0A1C9LW82	Vibrio_phage	27.6	8.9e-09
WP_070531248.1|3393260_3394049_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_070531250.1|3394237_3394672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070531252.1|3394715_3395174_-	cupredoxin family protein	NA	NA	NA	NA	NA
WP_070531254.1|3395312_3395648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070531257.1|3395770_3397537_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.3	3.7e-48
WP_070531259.1|3397611_3398910_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_083300970.1|3398964_3400605_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070531262.1|3400605_3401892_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_070531271.1|3402063_3402693_+	DedA family protein	NA	NA	NA	NA	NA
WP_070531273.1|3402717_3403788_+	alanine racemase	NA	NA	NA	NA	NA
WP_070531277.1|3403935_3405159_+	aspartate kinase	NA	NA	NA	NA	NA
WP_070532856.1|3406211_3406607_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_070525743.1|3406603_3407554_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_070531280.1|3407649_3408600_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_070531284.1|3408776_3409328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070531287.1|3409327_3411346_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.7	4.7e-39
WP_070531290.1|3411391_3413173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145927234.1|3413473_3414031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168163846.1|3414156_3414300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070531293.1|3416805_3417837_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 8
NZ_CP017668	Jeongeupia sp. USM3 chromosome, complete genome	3788814	3660546	3699529	3788814	tRNA,protease,transposase,coat	Bacillus_phage(22.22%)	39	NA	NA
WP_070531801.1|3660546_3662025_+|protease	DegQ family serine endoprotease	protease	W5SAB9	Pithovirus	32.0	3.6e-12
WP_070531804.1|3662287_3662806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070531806.1|3662858_3664871_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_070531808.1|3665193_3666147_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_070531811.1|3666275_3666881_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_070531814.1|3667137_3668289_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_070531817.1|3668465_3669440_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_145927243.1|3669514_3669838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070531821.1|3669857_3670424_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	4.4e-27
WP_070531824.1|3670437_3670938_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	53.9	2.8e-33
WP_070531825.1|3671197_3671779_+	MFS transporter	NA	NA	NA	NA	NA
WP_070531828.1|3671793_3672270_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_070531831.1|3672447_3673320_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_070531834.1|3673444_3674470_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070531837.1|3674731_3675091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070531840.1|3675087_3675318_-	DUF1653 domain-containing protein	NA	M5ABZ3	Bacillus_phage	41.9	1.1e-05
WP_070531842.1|3675386_3678020_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.1	6.3e-76
WP_083301001.1|3678134_3679289_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	7.8e-23
WP_070531847.1|3679441_3680080_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070531850.1|3680096_3680612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070531853.1|3680707_3681610_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070531856.1|3681606_3682065_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_070531858.1|3682121_3683174_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.8	2.8e-112
WP_070531861.1|3683390_3684650_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_070531863.1|3684661_3684877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070531866.1|3684876_3685317_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_070531868.1|3685445_3685922_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_070531871.1|3685918_3686641_+	molecular chaperone	NA	NA	NA	NA	NA
WP_168163853.1|3686664_3688917_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_070531876.1|3688919_3689375_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_070531879.1|3689476_3690709_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_070531882.1|3690877_3691597_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_145927244.1|3691593_3692670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083301003.1|3692751_3694953_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_070531887.1|3694977_3695871_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070531889.1|3696009_3697065_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	43.2	3.5e-78
WP_070531892.1|3697279_3697675_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_070531895.1|3697753_3698158_-	ribonucleotide reductase subunit alpha	NA	NA	NA	NA	NA
WP_070531897.1|3698503_3699529_+|transposase	IS481 family transposase	transposase	Q08HX1	Simian_immunodeficiency_virus	30.2	2.4e-07
