The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	1173071	1196620	5466770	transposase,integrase,holin,tail	Stx2-converting_phage(35.29%)	29	1164717:1164731	1197491:1197505
1164717:1164731	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1173071_1174277_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1174278_1175592_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1175588_1177220_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1177220_1177619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1177716_1178130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150571.1|1178525_1179818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1179893_1180196_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1180231_1180987_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1181328_1181895_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1181869_1182481_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1182477_1183143_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1183139_1183763_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1184015_1184759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1184844_1185012_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1185419_1187273_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1187422_1187638_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1187642_1187987_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1188343_1188724_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1188720_1189068_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1189117_1189762_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1189568_1190459_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1190455_1190782_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1190999_1191269_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1191429_1191852_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1191981_1193040_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1193118_1193769_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1193951_1194542_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1195043_1195292_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1196137_1196620_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1197491:1197505	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	1474236	1479623	5466770	integrase	Enterobacteria_phage(50.0%)	6	1463185:1463201	1481819:1481835
1463185:1463201	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|1474236_1474767_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1474766_1475234_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1475220_1475901_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1475910_1477047_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1477221_1478379_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1478690_1479623_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1481819:1481835	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	1703493	1807600	5466770	integrase,protease,tail,lysis,tRNA	Enterobacteria_phage(66.67%)	109	1726397:1726417	1754067:1754087
WP_000968210.1|1703493_1704189_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1704185_1704584_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1704714_1705623_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1705749_1707108_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1707119_1708148_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1708162_1708864_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1708872_1709517_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1709531_1710725_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1710884_1711835_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1712222_1712306_-	protein YohP	NA	NA	NA	NA	NA
WP_115801856.1|1712439_1713966_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1714018_1714780_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1714909_1715488_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1715657_1716245_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1716418_1717351_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1717388_1719104_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1719299_1721597_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1721848_1722766_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1722772_1723930_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1723922_1724849_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1724853_1725585_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1725565_1725673_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1725732_1726434_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1726397:1726417	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1726454_1727741_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1727774_1728029_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1728047_1728182_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1728185_1728428_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1728515_1728878_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1728874_1729231_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1729564_1729741_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1729742_1730690_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1730686_1730908_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1731006_1731288_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1731298_1731490_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1731462_1731645_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1731644_1732322_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1732318_1733104_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1733109_1733406_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1733481_1733625_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1733593_1733758_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1733830_1734199_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1734459_1735041_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1735057_1735330_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1735842_1736394_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1736400_1736682_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1736804_1737452_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1737560_1737779_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001097065.1|1738985_1739312_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1739304_1739586_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1739588_1740212_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1740224_1740623_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1740630_1741383_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1741396_1741819_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1741845_1742154_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_070479909.1|1742197_1744843_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|1744839_1745169_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1745168_1745867_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|1745877_1746621_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|1746566_1747196_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_077890814.1|1747436_1748612_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	99.7	1.5e-234
WP_115801855.1|1748563_1750909_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1750976_1751576_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_024183355.1|1751640_1752954_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1752955_1753225_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1753592_1753841_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1754355_1756041_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1754067:1754087	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1756037_1756757_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1756803_1757274_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1757315_1757777_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1757901_1759905_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1759901_1761038_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1761030_1761762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1761780_1763310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1763320_1764409_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1765649_1765967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1766028_1769658_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1769667_1771209_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1771372_1772653_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1776615_1778649_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1778780_1779890_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1780151_1780433_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1780724_1781267_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1781354_1782029_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1782044_1784525_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1784535_1785570_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1785651_1785990_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134626.1|1786207_1787071_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1787191_1787464_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1787573_1787888_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1787897_1788245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1789295_1789535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1789868_1790657_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1790653_1791454_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1791518_1792337_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1792388_1793135_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1793108_1794074_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1794070_1795075_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1795071_1796349_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1796605_1797658_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1797956_1798811_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1798839_1800102_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1800111_1800564_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1800594_1800879_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1800882_1802238_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1802285_1803326_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1803425_1804205_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1804286_1805186_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1805591_1805909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1806238_1807600_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	1905610	2080666	5466770	transposase,integrase,terminase,holin,head,bacteriocin,protease,capsid,portal,tail,lysis	Escherichia_phage(35.11%)	183	1953906:1953965	2022149:2023458
WP_085952406.1|1905610_1906824_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|1907195_1909343_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1910790_1912329_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1912378_1912726_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1912722_1913103_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1913464_1914010_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1914006_1914750_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1914761_1915841_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1915902_1916838_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1917294_1918212_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1918313_1919264_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1921650_1922367_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1922709_1924164_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1924265_1925582_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1925895_1926948_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|1927209_1935192_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|1935681_1936479_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|1936714_1937737_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|1937736_1937940_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000199485.1|1940563_1940752_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|1940748_1940937_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|1941417_1941570_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|1941844_1942489_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1942586_1942814_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1942810_1943236_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|1943304_1944342_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|1944253_1944796_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|1944830_1945529_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|1945550_1945775_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1945771_1946128_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|1946160_1946313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|1946309_1946621_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|1946747_1947311_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|1947420_1947525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1947711_1947924_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|1948091_1948370_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|1948371_1949421_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|1949433_1949793_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|1949789_1950479_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|1951112_1951541_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
1953906:1953965	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085948178.1|1953947_1955161_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|1955480_1955687_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|1955691_1956036_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|1956086_1956620_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|1956775_1956958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1956970_1957102_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1957329_1957515_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|1958041_1958356_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1958437_1958662_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|1959056_1959566_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_102136538.1|1961447_1961645_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	54.5	2.3e-07
WP_000256723.1|1964770_1965118_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1965175_1965442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1965423_1966164_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1966177_1966609_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000847304.1|1969602_1969932_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|1969931_1970630_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|1970640_1971384_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1971329_1971962_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649830.1|1972152_1972680_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_000515108.1|1972813_1976287_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_001230444.1|1976354_1976954_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268862.1|1977018_1978332_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001023352.1|1978333_1978603_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1981016_1982135_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1982131_1983925_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1983943_1984651_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1984647_1985235_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063969.1|1985231_1985630_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004940.1|1985626_1986484_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263572.1|1986617_1988162_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460778.1|1988173_1989310_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1989322_1989415_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001301957.1|1989494_1990799_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208668.1|1990918_1993099_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1993118_1993565_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1993552_1994692_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742329.1|1994737_1996834_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038071.1|1996833_1997580_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001301846.1|1997576_1998221_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001299283.1|1998327_1998633_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1999074_1999287_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1999572_1999785_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1999795_1999984_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001303885.1|1999958_2000189_+	protein YmcE	NA	NA	NA	NA	NA
WP_050554528.1|2000216_2000351_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818441.1|2000399_2001473_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054754.1|2001544_2004289_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_001264927.1|2004371_2005400_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120119.1|2005372_2006065_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230236.1|2006194_2007367_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063176.1|2007366_2009913_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000209883.1|2009909_2010509_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|2010662_2010968_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420639.1|2010967_2011888_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_001044286.1|2013695_2014937_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|2014974_2015202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607020.1|2015222_2015801_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013654.1|2015797_2017108_-|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_001208773.1|2017160_2017445_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_001303965.1|2017530_2017830_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000212746.1|2018805_2019093_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|2019094_2019313_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|2019314_2019530_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|2019531_2019720_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289936.1|2019871_2020645_-	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000774248.1|2020641_2020863_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001444000.1|2020961_2021243_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|2021253_2021445_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|2021417_2021600_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_085948178.1|2022190_2023404_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000186751.1|2023455_2023590_-	hypothetical protein	NA	A0A0N6WET1	Escherichia_phage	100.0	3.3e-18
2022149:2023458	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCA	NA	NA	NA	NA
WP_015971133.1|2023586_2024372_-	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	100.0	4.8e-149
WP_000995439.1|2024377_2024674_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|2024749_2024893_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|2024861_2025026_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|2025098_2025467_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|2025617_2026088_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001479835.1|2026146_2026530_-	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_000687675.1|2027001_2027406_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|2027402_2028059_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|2028055_2028343_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|2028479_2029184_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|2029297_2029531_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|2029669_2029966_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_032314820.1|2029998_2030937_+	replication protein	NA	A0A0P0ZCK0	Stx2-converting_phage	100.0	1.4e-171
WP_024257512.1|2030933_2031635_+	hypothetical protein	NA	A0A0P0ZC87	Stx2-converting_phage	100.0	3.4e-130
WP_000145931.1|2031631_2031922_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|2031992_2032271_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|2032402_2032618_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001281772.1|2032628_2032865_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814575.1|2032821_2033268_+	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	100.0	1.4e-81
WP_000153288.1|2033264_2033792_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_000335902.1|2033973_2035023_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_001004020.1|2035174_2035897_+	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_001107955.1|2035896_2036502_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_000144764.1|2036498_2036693_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|2036685_2037120_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649753.1|2037903_2038863_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|2038874_2039144_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|2039630_2041568_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|2041702_2041882_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|2041922_2042195_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|2042271_2042487_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|2042491_2043025_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|2043299_2043869_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|2043868_2044018_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|2044025_2044490_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|2044521_2044815_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|2044964_2045168_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|2045223_2046030_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143992.1|2046010_2047717_+|terminase	bacteriophage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|2047716_2049861_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|2050018_2051026_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|2051049_2052264_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|2052319_2052709_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|2052758_2053220_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|2053203_2053767_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|2053766_2054417_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_024183271.1|2054413_2056450_+|tail	tail fiber protein	tail	A0A0P0ZD90	Stx2-converting_phage	100.0	9.4e-88
WP_001024006.1|2056451_2056721_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|2056860_2057049_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|2057343_2058969_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|2058965_2060234_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|2060248_2060527_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|2060532_2061150_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|2061240_2061975_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|2062207_2062348_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|2062404_2062806_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|2062899_2063556_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|2063558_2064005_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|2064014_2064266_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|2064276_2065542_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_029783923.1|2065611_2073993_+	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	100.0	0.0e+00
WP_000756595.1|2074543_2074888_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|2075007_2075220_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|2075453_2075849_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001289938.1|2075848_2076748_-	DUF551 domain-containing protein	NA	A0A0P0ZBW5	Stx2-converting_phage	100.0	4.5e-175
WP_000763352.1|2076744_2076966_-	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	100.0	2.2e-35
WP_000203859.1|2077013_2077643_-	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_001273654.1|2078632_2078740_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_001301708.1|2078822_2080151_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001028088.1|2080171_2080666_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 5
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	2140122	2202645	5466770	transposase,protease,integrase	Stx2-converting_phage(27.78%)	60	2134292:2134307	2152192:2152207
2134292:2134307	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000279869.1|2140122_2141325_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|2141511_2143329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|2144440_2144737_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|2144963_2145161_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335698.1|2145379_2146765_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|2147585_2148149_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|2148303_2150664_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998081.1|2151420_2152959_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
2152192:2152207	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
WP_000612591.1|2153008_2153356_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2153352_2153733_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_032210650.1|2154223_2155078_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_028913479.1|2155124_2155730_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|2155777_2156029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|2156052_2156343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|2157028_2157388_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591997.1|2157480_2159100_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|2159324_2159600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010904558.1|2159980_2160679_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|2160769_2161072_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|2161080_2161401_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|2161393_2163097_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|2163106_2163571_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|2163571_2164246_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021389.1|2164257_2164875_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|2166086_2166350_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|2166651_2166792_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397129.1|2167663_2168335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|2170672_2171098_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|2171094_2171445_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|2171475_2173089_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957248.1|2174031_2174373_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|2174359_2174689_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|2174949_2175417_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|2175434_2176643_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|2176653_2177610_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|2177609_2178689_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|2178690_2179464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|2179456_2180599_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|2180608_2181667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|2181989_2182571_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|2182570_2183728_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|2183750_2184206_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|2184228_2185269_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|2185317_2185896_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|2185964_2186540_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001223350.1|2187861_2189952_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|2191404_2191623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|2192255_2192591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|2193371_2193566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|2193617_2193797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|2193885_2194158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340489.1|2194441_2194657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958487.1|2194722_2194920_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001231525.1|2195649_2196774_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001301456.1|2198127_2198586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|2199043_2199553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|2199641_2200265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|2200360_2200594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|2200646_2200838_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_085952771.1|2201431_2202645_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.1e-168
>prophage 6
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	2308129	2436471	5466770	transposase,integrase,terminase,holin,head,protease,capsid,portal,tail,lysis,tRNA	Enterobacteria_phage(34.55%)	153	2298789:2298804	2440447:2440462
2298789:2298804	attL	CGACGTTATATTTTTT	NA	NA	NA	NA
WP_000952736.1|2308129_2308951_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2309106_2310153_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2310149_2310944_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2311110_2312229_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2312197_2312467_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2312528_2312918_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2313050_2313566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2313680_2313833_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2314148_2314625_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2314749_2315073_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|2315056_2315482_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2315550_2316588_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|2316499_2317042_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|2317075_2317792_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|2317788_2318106_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2318102_2318405_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2318394_2318712_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2318665_2318983_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2318969_2319407_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2319408_2319600_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2319602_2320190_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2320305_2320410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2320598_2320811_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2320978_2321257_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|2321258_2322308_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|2322320_2322695_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2322691_2323513_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2324109_2324277_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|2324591_2326529_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2326676_2326859_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2326896_2327166_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2327241_2327457_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2327461_2327806_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2327856_2328390_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2328660_2329230_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2329229_2329376_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2329603_2329810_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2329874_2330099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2330455_2330596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|2330725_2330911_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|2330952_2331318_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2331607_2332171_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_070502344.1|2333891_2335829_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|2335873_2336095_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2336040_2338542_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2338621_2338948_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2338957_2339308_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_102136539.1|2339255_2339750_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	1.0e-72
WP_071587642.1|2339817_2340090_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.9	3.9e-42
WP_001275506.1|2340148_2340865_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_001030063.1|2340870_2341245_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_000807950.1|2344834_2345176_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|2345175_2345874_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|2345890_2346145_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2346254_2346365_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2346667_2347546_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2347599_2348337_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2348282_2348519_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2348531_2348621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2348640_2350989_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2351579_2354981_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2357084_2357210_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2357289_2357565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2357625_2358987_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2359350_2360214_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2360197_2361334_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2361583_2362810_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2362858_2363980_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085257.1|2364228_2365458_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953272.1|2365822_2366011_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|2366068_2366812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|2366837_2367035_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|2367027_2367213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|2367212_2367404_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|2367393_2367636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|2367641_2367941_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|2367937_2370070_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|2370440_2370692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|2370688_2371099_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|2371109_2371382_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|2371506_2371731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|2372023_2373181_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|2373220_2373793_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000267612.1|2373794_2375006_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_001020660.1|2375002_2375341_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|2375337_2375634_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|2375633_2376074_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000174068.1|2376057_2376240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2376363_2376720_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127893.1|2376703_2378365_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000133425.1|2378378_2378660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2379516_2380977_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2380976_2381648_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2381816_2383187_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2383190_2383832_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2383867_2384974_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2385027_2385489_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2385498_2386152_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2386323_2387574_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2387687_2388830_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2388819_2389056_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2389159_2389984_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2389980_2390682_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2390678_2390981_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2391048_2391381_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2391445_2391568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2391625_2393152_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2393653_2394109_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2394108_2394279_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2394271_2394562_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2394558_2394921_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2394917_2395058_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2395054_2395744_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2396065_2396371_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2396357_2396834_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2397050_2397233_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2397323_2397617_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2397908_2398319_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2398604_2398811_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2398975_2399170_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2399558_2400104_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2400078_2402004_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2402000_2402207_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2402203_2403805_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_001295978.1|2405113_2405446_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2405501_2406527_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2406568_2406967_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2406978_2407332_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2407343_2407922_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683109.1|2407918_2408248_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	96.1	2.1e-50
WP_001143002.1|2410722_2411463_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2411478_2411901_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2411882_2412317_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2412309_2414859_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2414855_2415185_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2415184_2415883_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000090920.1|2416567_2417200_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2417260_2420659_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|2420725_2421325_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|2421389_2424305_+	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885629.1|2424304_2424886_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000488340.1|2425005_2425896_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2425914_2426421_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2426457_2426958_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2427036_2427219_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2427716_2428385_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2428441_2428690_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2428765_2429146_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2429142_2429490_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001226373.1|2431377_2432862_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2433048_2434002_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|2434500_2435085_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|2435258_2436471_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
2440447:2440462	attR	CGACGTTATATTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	2528102	2625984	5466770	integrase,terminase,holin,head,tail	Escherichia_phage(33.33%)	109	2520828:2520841	2537564:2537577
2520828:2520841	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|2528102_2529233_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2529210_2529459_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|2529523_2531995_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|2532087_2532279_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2532275_2532464_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122994727.1|2532800_2532944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2532937_2533171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2533148_2533556_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2533578_2533797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2533869_2534169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2534432_2534840_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2534916_2535144_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2535127_2535679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2535650_2536691_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2536602_2537145_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2537331_2537913_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
2537564:2537577	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|2537909_2538074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2538772_2539531_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2539809_2540022_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2540242_2540500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2540569_2540848_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2540849_2541896_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2541908_2542268_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2542276_2542807_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2543048_2543246_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2543396_2544455_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_102136540.1|2545251_2547063_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000284517.1|2547253_2547469_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2547473_2547818_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000539792.1|2549236_2549383_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2549610_2549796_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2550220_2550448_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2550489_2550855_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_102136541.1|2551701_2553378_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	98.2	0.0e+00
WP_001063099.1|2555405_2555627_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001007901.1|2558482_2558833_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2558829_2559276_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2559272_2559617_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001030063.1|2560396_2560771_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_158649446.1|2561127_2561832_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	97.9	1.1e-112
WP_000807954.1|2564198_2564540_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2564539_2564977_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|2565164_2568425_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2568427_2568643_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2568710_2569310_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001023362.1|2570595_2570865_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2572264_2572915_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001171554.1|2575427_2575808_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2576770_2577085_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2577723_2578968_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2579060_2579249_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2579245_2579434_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2579998_2580208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2580208_2580847_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2580858_2581011_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2581303_2581642_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2582033_2582276_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2582259_2582685_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2582753_2583797_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2583789_2584251_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2584284_2585001_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2585033_2585315_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2585311_2585539_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2585531_2585843_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2585970_2586189_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2586190_2586748_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2586981_2587194_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2587313_2587658_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2587779_2588052_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2588053_2589103_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2589115_2589421_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2589483_2590038_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2590262_2590460_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2590596_2591310_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2591760_2592192_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000411805.1|2594966_2595173_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2595177_2595522_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2595572_2596106_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2596377_2596947_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2596946_2597093_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2597315_2597501_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2598026_2598341_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2598422_2598647_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2599033_2599579_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_158653838.1|2599616_2600819_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.7	9.7e-242
WP_000123254.1|2603252_2604572_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2604581_2604914_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000158906.1|2606034_2606433_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2606444_2606798_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2606812_2607346_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2607342_2607738_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2607745_2608498_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2608511_2608934_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2608960_2609374_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2609354_2611967_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2611963_2612293_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2612292_2612991_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2613001_2613745_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_097454001.1|2613690_2614320_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_001230508.1|2618105_2618705_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2618768_2619992_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2619993_2620263_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2620376_2620952_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2621024_2621654_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2621735_2622377_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_016241229.1|2622538_2622853_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2622912_2624196_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2624284_2625745_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2625780_2625984_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	2807952	2865658	5466770	integrase,holin,terminase,head,capsid,tail,tRNA	Escherichia_phage(41.27%)	68	2804410:2804425	2864819:2864834
2804410:2804425	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_001295593.1|2807952_2808387_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2808967_2809609_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2809690_2810320_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2810392_2810968_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2811080_2811350_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2811351_2812665_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2812729_2813329_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2813399_2816897_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2817030_2817558_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2817748_2818381_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2818326_2819070_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2819080_2819779_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2819778_2820120_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_070502347.1|2820112_2823193_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	93.8	0.0e+00
WP_001030063.1|2823549_2823924_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|2823929_2824646_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|2824704_2825049_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2825045_2825492_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2825488_2825839_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2825847_2826174_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063025.1|2828699_2828921_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173036.1|2828965_2830903_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001411753.1|2830966_2832628_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2832624_2833188_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2833476_2833842_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2833883_2834084_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2834215_2834542_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2834942_2835128_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2835350_2835482_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2835576_2836272_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2836545_2837079_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2837129_2837474_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2837478_2837694_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143079.1|2837843_2839697_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2840271_2840703_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2841264_2841819_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2841815_2842106_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2842105_2842705_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2843204_2844596_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|2844595_2845585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2845552_2846704_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2847135_2847381_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2847459_2847621_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2847631_2847895_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2848146_2848359_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2848464_2848887_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2848902_2849664_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2849686_2850433_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2850439_2851228_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2851305_2851728_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2851724_2851979_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2852058_2852478_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2852720_2852900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2852910_2853066_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2853062_2853551_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2853992_2854214_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2854213_2854384_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2854458_2854734_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2854835_2857436_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2857428_2858238_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2858293_2858443_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2858480_2858669_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2858768_2858984_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2858985_2860221_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2860272_2861208_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2861336_2862710_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2863187_2864171_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2864425_2865658_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2864819:2864834	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 9
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	2950603	3018208	5466770	holin,terminase,head,protease,tail	Stx2-converting_phage(39.58%)	67	NA	NA
WP_000422055.1|2950603_2951653_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2951872_2952631_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2952627_2953218_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2953257_2954130_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2954342_2955926_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2955953_2956574_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2956570_2957452_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2957589_2957634_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2957725_2959288_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2959287_2960883_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|2960886_2962245_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2962256_2963450_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2963449_2964256_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2964636_2964816_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2964901_2965402_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2965447_2965954_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|2966455_2966674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2969424_2970015_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2970198_2970846_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2970982_2971129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2971556_2971835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2972174_2972555_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2972551_2972899_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000938103.1|2975451_2976021_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2976086_2976998_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2977104_2977227_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2978824_2980150_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2981176_2981446_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2981447_2982761_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2982912_2983512_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_001304109.1|2985874_2987050_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2987392_2988025_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2987970_2988714_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|2988724_2989423_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2989422_2989764_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212822.1|2989756_2992999_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|2993046_2993256_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_001030060.1|2993351_2993726_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2993731_2994448_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2994516_2994861_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2994857_2995304_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2995300_2995651_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2995660_2995987_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2998513_2998735_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000958416.1|3002435_3002999_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3003288_3003654_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3003695_3003923_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3004346_3004532_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3004759_3004906_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3004905_3005475_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3005745_3006279_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3006329_3006674_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|3006678_3006885_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|3007333_3009184_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|3009662_3010091_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|3010728_3011418_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|3011414_3011774_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|3011786_3012836_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|3012837_3013116_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3013283_3013496_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3013684_3013789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|3013904_3014489_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|3014545_3014941_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|3015751_3016492_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|3016498_3017461_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|3017483_3017909_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|3017905_3018208_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 10
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	3331776	3382895	5466770	tail,integrase,transposase,tRNA	Enterobacteria_phage(60.0%)	59	3325000:3325015	3382974:3382989
3325000:3325015	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3331776_3333510_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3333686_3334175_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3334294_3334687_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3334686_3336765_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3336757_3337906_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3338107_3338752_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3338762_3339152_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3339166_3340216_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3340218_3341079_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3341097_3342699_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3342744_3344406_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3344548_3345052_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3345072_3347037_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3347041_3347968_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3347964_3348852_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3348978_3349557_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3349559_3349910_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3350689_3351118_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089030.1|3351124_3352549_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3352523_3353324_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987892.1|3353490_3354480_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3354491_3356006_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3356075_3357065_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3357861_3358365_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3358444_3358696_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3358810_3358897_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3359158_3359482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3359652_3360150_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3360186_3360426_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3360617_3361829_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3361890_3362556_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|3362912_3363914_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|3363919_3364267_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3364296_3364947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3364962_3365367_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3365456_3365594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3365665_3365869_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3365890_3366241_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3366251_3366530_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3366541_3366784_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3366780_3366894_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3366986_3367403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3367426_3367630_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3367626_3367893_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3367889_3368189_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001413181.1|3368200_3368818_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000599379.1|3368814_3369180_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3369186_3372009_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686531.1|3372085_3373045_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000211280.1|3373049_3373364_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3374569_3374986_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3375029_3375602_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3375758_3376247_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3379049_3379178_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3379213_3379579_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3379633_3380146_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3380145_3381330_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3381487_3381811_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161728.1|3381761_3382895_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
3382974:3382989	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	3440474	3488752	5466770	transposase,integrase,holin,head,protease,tail	Escherichia_phage(28.21%)	55	3430449:3430465	3490561:3490577
3430449:3430465	attL	TTCCGGTCTGATGACCA	NA	NA	NA	NA
WP_001023407.1|3440474_3440744_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001230508.1|3442121_3442721_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_158653839.1|3442788_3445164_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_070502352.1|3446506_3447118_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.6	3.3e-97
WP_001151105.1|3447833_3448532_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3448531_3448861_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_010904726.1|3448857_3449622_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_001455418.1|3449573_3451436_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_000533402.1|3451416_3451830_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3451856_3452288_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3452301_3453042_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3453023_3453290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254002.1|3453729_3455235_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000259002.1|3456812_3457019_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3458901_3459144_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3459193_3460732_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3460781_3461129_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3461125_3461506_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3461581_3461857_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3462607_3462814_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3463069_3463342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3463501_3464035_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3464255_3464369_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3464590_3464776_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3465303_3465618_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3466974_3468825_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3469592_3470306_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3470400_3470640_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3470926_3471745_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3471896_3472268_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3472257_3472629_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3472641_3473691_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3473692_3473971_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3474138_3474351_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3474395_3474533_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3474898_3475672_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3476023_3476437_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3476452_3477223_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3477244_3477991_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3477997_3479089_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3479167_3479623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3479829_3480255_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3480238_3480511_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3480619_3481021_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3481048_3481240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3481239_3481527_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3481804_3481960_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3482101_3482491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3482677_3482863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3483436_3483625_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3483621_3483813_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3483906_3486378_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3486445_3486688_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3486665_3487685_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3488092_3488752_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3490561:3490577	attR	TTCCGGTCTGATGACCA	NA	NA	NA	NA
>prophage 12
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	3719689	3757796	5466770	integrase,terminase,holin,protease,portal,tail,lysis	Enterobacteria_phage(52.38%)	49	3719274:3719288	3757870:3757884
3719274:3719288	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3719689_3720388_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3720618_3721500_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3721669_3721831_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3722327_3723347_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3723380_3724361_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3724537_3724807_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3724808_3726125_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3726184_3726784_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3726854_3730268_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3730328_3730937_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3730873_3731617_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3731622_3732321_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3732330_3732660_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3732659_3735725_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3735696_3736026_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3736034_3736421_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3736481_3737225_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3737235_3737637_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3737633_3738212_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3738223_3738499_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3738491_3738815_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3738901_3740929_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3740873_3741209_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3741330_3742455_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3742382_3742595_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3742591_3744694_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3744693_3745185_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3745859_3746012_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3745999_3746467_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3746463_3746961_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3746960_3747176_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000499454.1|3747798_3747957_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3748042_3748786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3748969_3749659_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3749673_3749796_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3750133_3751093_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3751304_3751970_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108061.1|3751966_3752596_-	recombination protein NinG	NA	Q716C3	Shigella_phage	92.8	4.6e-94
WP_000567001.1|3752588_3752759_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3752755_3752938_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3753635_3754316_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3754312_3754495_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3754467_3754659_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3754669_3754951_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3755049_3755271_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3755481_3756084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3756326_3756494_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3756533_3756752_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3756914_3757796_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3757870:3757884	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP017251	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type chromosome, complete genome	5466770	4336696	4390566	5466770	transposase,integrase,plate	Enterobacteria_phage(23.53%)	49	4336267:4336281	4372197:4372211
4336267:4336281	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4336696_4337878_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4338840_4339584_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4340407_4341181_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4341238_4341793_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000788819.1|4343750_4344062_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4345013_4345307_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4345425_4345626_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4345726_4346440_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4346567_4346957_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4347196_4347442_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4348511_4349765_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4349776_4350880_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4351167_4352223_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4352261_4352663_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4352720_4353965_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4354056_4354515_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4354775_4356233_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4356289_4356826_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4356758_4357025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4357331_4357784_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4357793_4358192_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4358194_4358488_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|4358539_4359595_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4359665_4360451_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4360395_4362135_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4362952_4363726_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4363911_4364172_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4364190_4364451_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4364606_4365347_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4365317_4366085_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4366189_4366768_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4367007_4369452_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4369494_4369968_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4370121_4370892_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4371009_4372182_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4372262_4372448_+	protein YncO	NA	NA	NA	NA	NA
4372197:4372211	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4372362_4372626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4372827_4374588_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4374590_4375727_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001451053.1|4376472_4377036_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4377104_4381319_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4381394_4383536_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4383745_4384264_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4384960_4385461_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4385495_4385720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4385770_4387162_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4387252_4387666_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4387669_4389520_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4389483_4390566_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP017252	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type plasmid pO157, complete sequence	92691	0	6515	92691	integrase	Macacine_betaherpesvirus(50.0%)	6	806:818	10643:10655
806:818	attL	CTGGAAAAACTCT	NA	NA	NA	NA
WP_001066920.1|1116_1857_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_010891288.1|1977_2208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|2376_2661_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303402.1|2690_2885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001213545.1|2951_4391_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987091.1|4394_6515_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
10643:10655	attR	AGAGTTTTTCCAG	NA	NA	NA	NA
>prophage 2
NZ_CP017252	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type plasmid pO157, complete sequence	92691	34236	38354	92691	protease	Enterobacterial_phage(50.0%)	2	NA	NA
WP_001034100.1|34236_38139_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_085950648.1|38258_38354_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
>prophage 3
NZ_CP017252	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type plasmid pO157, complete sequence	92691	47768	51148	92691		Moraxella_phage(33.33%)	5	NA	NA
WP_001233853.1|47768_48230_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302189.1|48474_48687_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|48819_49380_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|49482_50343_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|50401_51148_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
>prophage 4
NZ_CP017252	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type plasmid pO157, complete sequence	92691	68972	73139	92691		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_000117168.1|68972_70931_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000005995.1|70996_71230_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290823.1|71286_71739_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_001451816.1|72040_72490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302171.1|72575_73139_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
>prophage 5
NZ_CP017252	Escherichia coli strain NADC 5570/86-24/6564 isolate wild type plasmid pO157, complete sequence	92691	78816	89656	92691	integrase,transposase	Macacine_betaherpesvirus(50.0%)	10	76999:77012	91846:91859
76999:77012	attL	GCAAGGGAAGCCGC	NA	NA	NA	NA
WP_000085945.1|78816_79500_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_010891292.1|79576_79882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|79885_80788_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000138832.1|80864_82589_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
WP_000817031.1|83888_84860_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|84859_86026_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_071525396.1|86613_86952_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_085948178.1|86913_88126_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|88092_88173_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|88849_89656_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
91846:91859	attR	GCAAGGGAAGCCGC	NA	NA	NA	NA
