The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	1173030	1196579	5467107	holin,tail,integrase,transposase	Stx2-converting_phage(35.29%)	29	1164676:1164690	1197450:1197464
1164676:1164690	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1173030_1174236_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1174237_1175551_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1175547_1177179_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1177179_1177578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1177675_1178089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150571.1|1178484_1179777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1179852_1180155_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1180190_1180946_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1181287_1181854_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1181828_1182440_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1182436_1183102_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1183098_1183722_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1183974_1184718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1184803_1184971_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1185378_1187232_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1187381_1187597_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1187601_1187946_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1188302_1188683_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1188679_1189027_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1189076_1189721_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1189527_1190418_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1190414_1190741_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1190958_1191228_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1191388_1191811_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1191940_1192999_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1193077_1193728_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1193910_1194501_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1195002_1195251_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1196096_1196579_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1197450:1197464	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	1474194	1479581	5467107	integrase	Enterobacteria_phage(50.0%)	6	1463143:1463159	1481777:1481793
1463143:1463159	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|1474194_1474725_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1474724_1475192_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1475178_1475859_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1475868_1477005_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1477179_1478337_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1478648_1479581_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1481777:1481793	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	1703456	1807562	5467107	tail,protease,lysis,tRNA,integrase	Enterobacteria_phage(66.67%)	109	1726360:1726380	1754029:1754049
WP_000968210.1|1703456_1704152_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1704148_1704547_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1704677_1705586_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1705712_1707071_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1707082_1708111_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1708125_1708827_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1708835_1709480_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1709494_1710688_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1710847_1711798_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1712185_1712269_-	protein YohP	NA	NA	NA	NA	NA
WP_115801856.1|1712402_1713929_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1713981_1714743_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1714872_1715451_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1715620_1716208_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1716381_1717314_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1717351_1719067_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1719262_1721560_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1721811_1722729_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1722735_1723893_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1723885_1724812_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1724816_1725548_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1725528_1725636_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1725695_1726397_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1726360:1726380	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1726417_1727704_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1727737_1727992_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1728010_1728145_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1728148_1728391_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1728478_1728841_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1728837_1729194_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1729527_1729704_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1729705_1730653_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1730649_1730871_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1730969_1731251_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1731261_1731453_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1731425_1731608_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1731607_1732285_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1732281_1733067_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1733072_1733369_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1733444_1733588_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1733556_1733721_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1733793_1734162_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1734422_1735004_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1735020_1735293_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1735805_1736357_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1736363_1736645_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1736767_1737415_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1737523_1737742_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001097065.1|1738948_1739275_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1739267_1739549_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1739551_1740175_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1740187_1740586_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1740593_1741346_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1741359_1741782_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1741808_1742117_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_070479909.1|1742160_1744806_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|1744802_1745132_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1745131_1745830_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|1745840_1746584_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|1746529_1747159_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_077890814.1|1747398_1748574_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	99.7	1.5e-234
WP_115801855.1|1748525_1750871_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1750938_1751538_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_024183355.1|1751602_1752916_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1752917_1753187_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1753554_1753803_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1754317_1756003_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1754029:1754049	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1755999_1756719_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1756765_1757236_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1757277_1757739_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1757863_1759867_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1759863_1761000_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1760992_1761724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1761742_1763272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1763282_1764371_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1765611_1765929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1765990_1769620_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1769629_1771171_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1771334_1772615_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1776577_1778611_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1778742_1779852_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1780113_1780395_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1780686_1781229_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1781316_1781991_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1782006_1784487_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1784497_1785532_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1785613_1785952_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134626.1|1786169_1787033_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1787153_1787426_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1787535_1787850_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1787859_1788207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1789257_1789497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1789830_1790619_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1790615_1791416_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1791480_1792299_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1792350_1793097_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1793070_1794036_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1794032_1795037_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1795033_1796311_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1796567_1797620_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1797918_1798773_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1798801_1800064_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1800073_1800526_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1800556_1800841_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1800844_1802200_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1802247_1803288_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1803387_1804167_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1804248_1805148_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1805553_1805871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1806200_1807562_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	1905575	2080638	5467107	tail,protease,bacteriocin,head,portal,holin,lysis,terminase,integrase,transposase,capsid	Escherichia_phage(35.56%)	187	1953875:1953934	2022121:2023430
WP_085952406.1|1905575_1906789_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|1907160_1909308_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1910755_1912294_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1912343_1912691_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1912687_1913068_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1913429_1913975_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1913971_1914715_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1914726_1915806_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1915867_1916803_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1917259_1918177_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1918278_1919229_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1921615_1922332_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1922674_1924129_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1924230_1925547_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1925860_1926913_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|1927174_1935157_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|1935646_1936444_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|1936679_1937702_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|1937701_1937905_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|1937963_1940435_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|1940530_1940719_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|1940715_1940904_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|1941384_1941537_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|1941811_1942456_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1942553_1942781_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1942777_1943203_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|1943271_1944309_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|1944220_1944763_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|1944797_1945496_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|1945517_1945742_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1945738_1946095_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|1946127_1946280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|1946276_1946588_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|1946714_1947278_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|1947387_1947492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1947678_1947891_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|1948058_1948337_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|1948338_1949388_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|1949400_1949760_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|1949756_1950446_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|1951079_1951508_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
1953875:1953934	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085948178.1|1953916_1955130_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|1955449_1955656_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|1955660_1956005_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|1956055_1956589_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|1956744_1956927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1956939_1957071_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1957298_1957484_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|1958010_1958325_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1958406_1958631_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|1959025_1959535_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_072143381.1|1959536_1959851_+|terminase	terminase	terminase	K7PGW7	Enterobacteria_phage	65.4	1.4e-22
WP_000259002.1|1961415_1961622_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001434487.1|1963199_1963499_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	54.3	3.1e-16
WP_000256723.1|1964739_1965087_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1965144_1965411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1965392_1966133_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1966146_1966578_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1966604_1967018_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_032166528.1|1966998_1969578_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.0	0.0e+00
WP_000847304.1|1969574_1969904_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|1969903_1970602_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|1970612_1971356_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1971301_1971934_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649830.1|1972124_1972652_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_000515108.1|1972785_1976259_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_001230444.1|1976326_1976926_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_001023352.1|1978304_1978574_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1980988_1982107_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1982103_1983897_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1983915_1984623_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1984619_1985207_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063969.1|1985203_1985602_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004940.1|1985598_1986456_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263572.1|1986589_1988134_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460778.1|1988145_1989282_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1989294_1989387_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001301957.1|1989466_1990771_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208668.1|1990890_1993071_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1993090_1993537_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1993524_1994664_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742329.1|1994709_1996806_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038071.1|1996805_1997552_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001301846.1|1997548_1998193_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001299283.1|1998299_1998605_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1999046_1999259_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1999544_1999757_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1999767_1999956_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001303885.1|1999930_2000161_+	protein YmcE	NA	NA	NA	NA	NA
WP_050554528.1|2000188_2000323_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818441.1|2000371_2001445_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054754.1|2001516_2004261_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_001264927.1|2004343_2005372_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120119.1|2005344_2006037_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230236.1|2006166_2007339_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063176.1|2007338_2009885_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000209883.1|2009881_2010481_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|2010634_2010940_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420639.1|2010939_2011860_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_001044286.1|2013667_2014909_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|2014946_2015174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607020.1|2015194_2015773_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013654.1|2015769_2017080_-|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_001208773.1|2017132_2017417_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_001303965.1|2017502_2017802_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000212746.1|2018777_2019065_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|2019066_2019285_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|2019286_2019502_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|2019503_2019692_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289936.1|2019843_2020617_-	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000774248.1|2020613_2020835_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001444000.1|2020933_2021215_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|2021225_2021417_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|2021389_2021572_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_085948178.1|2022162_2023376_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000186751.1|2023427_2023562_-	hypothetical protein	NA	A0A0N6WET1	Escherichia_phage	100.0	3.3e-18
2022121:2023430	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCA	NA	NA	NA	NA
WP_015971133.1|2023558_2024344_-	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	100.0	4.8e-149
WP_000995439.1|2024349_2024646_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|2024721_2024865_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|2024833_2024998_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|2025070_2025439_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|2025589_2026060_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001479835.1|2026118_2026502_-	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_000687675.1|2026973_2027378_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|2027374_2028031_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|2028027_2028315_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|2028451_2029156_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|2029269_2029503_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|2029641_2029938_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_032314820.1|2029970_2030909_+	replication protein	NA	A0A0P0ZCK0	Stx2-converting_phage	100.0	1.4e-171
WP_024257512.1|2030905_2031607_+	hypothetical protein	NA	A0A0P0ZC87	Stx2-converting_phage	100.0	3.4e-130
WP_000145931.1|2031603_2031894_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|2031964_2032243_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|2032374_2032590_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001281772.1|2032600_2032837_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814575.1|2032793_2033240_+	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	100.0	1.4e-81
WP_000153288.1|2033236_2033764_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_000335902.1|2033945_2034995_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_001004020.1|2035146_2035869_+	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_001107955.1|2035868_2036474_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_000144764.1|2036470_2036665_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|2036657_2037092_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649753.1|2037875_2038835_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|2038846_2039116_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|2039602_2041540_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|2041674_2041854_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|2041894_2042167_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|2042243_2042459_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|2042463_2042997_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|2043271_2043841_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|2043840_2043990_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|2043997_2044462_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|2044493_2044787_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|2044936_2045140_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|2045195_2046002_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143992.1|2045982_2047689_+|terminase	bacteriophage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|2047688_2049833_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|2049990_2050998_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|2051021_2052236_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|2052291_2052681_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|2052730_2053192_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|2053175_2053739_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|2053738_2054389_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_024183271.1|2054385_2056422_+|tail	tail fiber protein	tail	A0A0P0ZD90	Stx2-converting_phage	100.0	9.4e-88
WP_001024006.1|2056423_2056693_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|2056832_2057021_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|2057315_2058941_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|2058937_2060206_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|2060220_2060499_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|2060504_2061122_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|2061212_2061947_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|2062179_2062320_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|2062376_2062778_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|2062871_2063528_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|2063530_2063977_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|2063986_2064238_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|2064248_2065514_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_029783923.1|2065583_2073965_+	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	100.0	0.0e+00
WP_000756595.1|2074515_2074860_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|2074979_2075192_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|2075425_2075821_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001289938.1|2075820_2076720_-	DUF551 domain-containing protein	NA	A0A0P0ZBW5	Stx2-converting_phage	100.0	4.5e-175
WP_000763352.1|2076716_2076938_-	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	100.0	2.2e-35
WP_000203859.1|2076985_2077615_-	phage antirepressor Ant	NA	A0A1I9LJV2	Stx_converting_phage	100.0	1.5e-113
WP_001273654.1|2078604_2078712_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_001301708.1|2078794_2080123_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001028088.1|2080143_2080638_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 5
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	2308099	2436442	5467107	tail,protease,head,portal,holin,lysis,terminase,tRNA,integrase,transposase,capsid	Enterobacteria_phage(34.26%)	151	2298759:2298774	2440418:2440433
2298759:2298774	attL	CGACGTTATATTTTTT	NA	NA	NA	NA
WP_000952736.1|2308099_2308921_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2309076_2310123_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2310119_2310914_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2311080_2312199_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2312167_2312437_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2312498_2312888_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2313020_2313536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2313650_2313803_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2314118_2314595_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2314719_2315043_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|2315026_2315452_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2315520_2316558_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|2316469_2317012_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|2317045_2317762_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|2317758_2318076_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2318072_2318375_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2318364_2318682_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2318635_2318953_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2318939_2319377_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2319378_2319570_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2319572_2320160_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2320275_2320380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2320568_2320781_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2320948_2321227_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|2321228_2322278_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|2322290_2322665_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2322661_2323483_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2324079_2324247_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|2324561_2326499_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2326646_2326829_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2326866_2327136_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2327211_2327427_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2327431_2327776_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2327826_2328360_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2328630_2329200_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2329199_2329346_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2329573_2329780_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2329844_2330069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2330425_2330566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|2330695_2330881_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|2330922_2331288_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2331577_2332141_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001063099.1|2335838_2336060_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001007901.1|2338920_2339271_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2339267_2339714_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2339710_2340055_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001030063.1|2340832_2341207_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_000807950.1|2344797_2345139_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|2345138_2345837_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|2345853_2346108_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2346217_2346328_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2346630_2347509_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2347562_2348300_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2348245_2348482_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2348494_2348584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2348603_2350952_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2351542_2354944_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2357047_2357173_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2357252_2357528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2357588_2358950_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2359313_2360177_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2360160_2361297_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2361546_2362773_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2362821_2363943_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085257.1|2364191_2365421_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953272.1|2365785_2365974_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|2366031_2366775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|2366800_2366998_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|2366990_2367176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|2367175_2367367_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|2367356_2367599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|2367604_2367904_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|2367900_2370033_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|2370403_2370655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|2370651_2371062_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|2371072_2371345_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|2371469_2371694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|2371986_2373144_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|2373183_2373756_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000267612.1|2373757_2374969_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_001020660.1|2374965_2375304_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|2375300_2375597_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|2375596_2376037_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000174068.1|2376020_2376203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2376326_2376683_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127893.1|2376666_2378328_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000133425.1|2378341_2378623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2379479_2380940_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2380939_2381611_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2381779_2383150_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2383153_2383795_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2383830_2384937_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2384990_2385452_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2385461_2386115_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2386286_2387537_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2387650_2388793_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2388782_2389019_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2389122_2389947_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2389943_2390645_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2390641_2390944_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2391011_2391344_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2391408_2391531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2391588_2393115_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2393616_2394072_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2394071_2394242_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2394234_2394525_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2394521_2394884_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2394880_2395021_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2395017_2395707_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2396028_2396334_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2396320_2396797_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2397013_2397196_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2397286_2397580_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2397871_2398282_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2398567_2398774_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2398938_2399133_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2399521_2400067_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2400041_2401967_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2401963_2402170_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2402166_2403768_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_001295978.1|2405076_2405409_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2405464_2406490_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2406531_2406930_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2406941_2407295_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2407306_2407885_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683109.1|2407881_2408211_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	96.1	2.1e-50
WP_000138832.1|2408243_2409968_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
WP_001143002.1|2410690_2411431_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2411446_2411869_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2411850_2412285_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2412277_2414827_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2414823_2415153_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2415152_2415851_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2415856_2416600_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2416536_2417169_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2417229_2420628_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|2420694_2421294_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|2421358_2424274_+	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885629.1|2424273_2424855_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000488340.1|2424974_2425865_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2425883_2426390_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2426426_2426927_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2427005_2427188_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2427685_2428354_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2428410_2428659_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2428734_2429115_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2429111_2429459_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001226373.1|2431348_2432833_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2433019_2433973_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|2434471_2435056_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|2435229_2436442_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
2440418:2440433	attR	CGACGTTATATTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	2528073	2625975	5467107	tail,head,portal,holin,terminase,integrase,capsid	Escherichia_phage(31.58%)	114	2520799:2520812	2537535:2537548
2520799:2520812	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|2528073_2529204_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2529181_2529430_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|2529494_2531966_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|2532058_2532250_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2532246_2532435_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122994727.1|2532771_2532915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2532908_2533142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2533119_2533527_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2533549_2533768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2533840_2534140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2534403_2534811_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2534887_2535115_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2535098_2535650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2535621_2536662_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2536573_2537116_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2537302_2537884_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
2537535:2537548	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|2537880_2538045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2538743_2539502_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2539780_2539993_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2540213_2540471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2540540_2540819_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2540820_2541867_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2541879_2542239_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2542247_2542778_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2543019_2543217_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2543367_2544426_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000284517.1|2547224_2547440_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2547444_2547789_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2547839_2548373_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2548643_2549213_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2549212_2549359_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2549586_2549772_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2550196_2550424_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2550465_2550831_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_070479939.1|2551687_2553406_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_001063099.1|2555383_2555605_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2558130_2558457_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2558465_2558816_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000133388.1|2559254_2559599_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_074388938.1|2559657_2559897_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.0e-29
WP_001030063.1|2560377_2560752_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_158649446.1|2561106_2561811_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	97.9	1.1e-112
WP_077890834.1|2562044_2564186_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.0	0.0e+00
WP_000807954.1|2564178_2564520_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|2564519_2564957_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_038425866.1|2565144_2568405_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001304111.1|2568407_2568623_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2568690_2569290_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001023362.1|2570576_2570846_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2572245_2572896_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000612591.1|2575065_2575413_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2575409_2575790_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2576752_2577067_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2577705_2578950_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2579042_2579231_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2579227_2579416_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2579980_2580190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2580190_2580829_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2580840_2580993_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2581285_2581624_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2582015_2582258_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2582241_2582667_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2582735_2583779_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2583771_2584233_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2584266_2584983_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2585015_2585297_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2585293_2585521_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2585513_2585825_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2585952_2586171_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2586172_2586730_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2586963_2587176_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2587295_2587640_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2587761_2588034_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2588035_2589085_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2589097_2589403_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2589465_2590020_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2590244_2590442_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2590578_2591292_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2591742_2592174_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2592651_2594502_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|2594949_2595156_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|2595160_2595505_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2595555_2596089_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2596360_2596930_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2596929_2597076_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2597298_2597484_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2598009_2598324_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2598405_2598630_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2599016_2599562_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2599536_2601462_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2601458_2601665_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2601661_2603263_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_001295978.1|2604571_2604904_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2604959_2605985_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2606026_2606425_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2606436_2606790_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2606804_2607338_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2607334_2607730_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2607737_2608490_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2608503_2608926_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2608952_2609366_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2609346_2611959_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2611955_2612285_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2612284_2612983_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000514945.1|2614550_2618030_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|2618097_2618697_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001023362.1|2619984_2620254_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2620367_2620943_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2621015_2621645_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2621726_2622368_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_016241229.1|2622529_2622844_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2622903_2624187_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2624275_2625736_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2625771_2625975_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	2807943	2872471	5467107	tail,head,portal,holin,terminase,tRNA,integrase,transposase	Escherichia_phage(40.62%)	73	2804401:2804416	2864807:2864822
2804401:2804416	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_001295593.1|2807943_2808378_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2808958_2809600_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2809681_2810311_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2810383_2810959_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2811071_2811341_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2811342_2812656_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2812720_2813320_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2813390_2816888_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2817021_2817549_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2817739_2818372_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2818317_2819061_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2819071_2819770_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2819769_2820111_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_158649447.1|2822350_2823181_-	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	97.9	9.7e-116
WP_001030063.1|2823537_2823912_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|2823917_2824634_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|2824691_2825036_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2825032_2825479_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2825475_2825826_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2825835_2826162_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_070479920.1|2826241_2828743_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.9	0.0e+00
WP_001063025.1|2828688_2828910_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_001411753.1|2830954_2832616_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2832612_2833176_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2833464_2833830_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2833871_2834072_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2834203_2834530_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2834930_2835116_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2835338_2835470_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|2835564_2836260_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|2836533_2837067_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2837117_2837462_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2837466_2837682_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143079.1|2837831_2839685_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2840259_2840691_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2841252_2841807_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2841803_2842094_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2842093_2842693_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2843192_2844584_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|2844583_2845573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2845540_2846692_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2847123_2847369_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2847447_2847609_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2847619_2847883_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2848134_2848347_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2848452_2848875_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2848890_2849652_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2849674_2850421_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2850427_2851216_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2851293_2851716_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2851712_2851967_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2852046_2852466_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2852708_2852888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2852898_2853054_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2853050_2853539_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2853980_2854202_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2854201_2854372_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2854446_2854722_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2854823_2857424_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2857416_2858226_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2858281_2858431_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2858468_2858657_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2858756_2858972_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2858973_2860209_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2860260_2861196_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2861324_2862698_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2863175_2864159_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2864413_2865646_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2864807:2864822	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
WP_001046821.1|2865666_2866230_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000885454.1|2866559_2867468_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000444937.1|2867643_2868954_+	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_001156434.1|2868953_2870399_+	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_085948178.1|2871258_2872471_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 8
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	2950592	3018198	5467107	tail,protease,head,holin,terminase,transposase,capsid	Stx2-converting_phage(39.22%)	70	NA	NA
WP_000422055.1|2950592_2951642_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2951861_2952620_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2952616_2953207_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2953246_2954119_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2954331_2955915_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2955942_2956563_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2956559_2957441_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2957578_2957623_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2957714_2959277_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2959276_2960872_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001302292.1|2960875_2962234_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2962245_2963439_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2963438_2964245_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2964625_2964805_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2964890_2965391_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2965436_2965943_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|2966444_2966663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2969413_2970004_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2970187_2970835_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2970971_2971118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2971545_2971824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2972163_2972544_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2972540_2972888_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2972937_2974476_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2975441_2976011_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2976076_2976988_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2977094_2977217_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2978814_2980140_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2981166_2981436_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2981437_2982751_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2982902_2983502_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_115801855.1|2983569_2985915_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001304109.1|2985866_2987042_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2987384_2988017_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2987962_2988706_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|2988716_2989415_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|2989414_2989756_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212822.1|2989748_2992991_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|2993038_2993248_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_001030060.1|2993343_2993718_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2993723_2994440_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2994508_2994853_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2994849_2995296_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2995292_2995643_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2995652_2995979_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2998505_2998727_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173036.1|2998771_3000709_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_000958416.1|3002425_3002989_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3003278_3003644_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3003685_3003913_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3004336_3004522_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3004749_3004896_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3004895_3005465_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3005735_3006269_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3006319_3006664_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|3006668_3006875_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|3007323_3009174_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_070479924.1|3009652_3010084_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.9	3.0e-68
WP_001059381.1|3010718_3011408_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|3011404_3011764_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|3011776_3012826_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|3012827_3013106_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3013273_3013486_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3013674_3013779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|3013894_3014479_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|3014535_3014931_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|3015741_3016482_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|3016488_3017451_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|3017473_3017899_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|3017895_3018198_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	3331765	3382884	5467107	tRNA,tail,integrase,transposase	Enterobacteria_phage(60.0%)	59	3324989:3325004	3382963:3382978
3324989:3325004	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3331765_3333499_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3333675_3334164_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3334283_3334676_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3334675_3336754_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3336746_3337895_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3338096_3338741_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3338751_3339141_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3339155_3340205_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3340207_3341068_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3341086_3342688_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3342733_3344395_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3344537_3345041_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3345061_3347026_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3347030_3347957_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3347953_3348841_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3348967_3349546_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3349548_3349899_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3350678_3351107_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089030.1|3351113_3352538_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3352512_3353313_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987892.1|3353479_3354469_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3354480_3355995_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3356064_3357054_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3357850_3358354_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3358433_3358685_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3358799_3358886_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3359147_3359471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3359641_3360139_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3360175_3360415_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3360606_3361818_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3361879_3362545_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|3362901_3363903_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|3363908_3364256_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3364285_3364936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3364951_3365356_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3365445_3365583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3365654_3365858_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3365879_3366230_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3366240_3366519_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3366530_3366773_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3366769_3366883_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3366975_3367392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3367415_3367619_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3367615_3367882_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3367878_3368178_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001413181.1|3368189_3368807_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000599379.1|3368803_3369169_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3369175_3371998_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686531.1|3372074_3373034_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000211280.1|3373038_3373353_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3374558_3374975_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3375018_3375591_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3375747_3376236_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3379038_3379167_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3379202_3379568_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3379622_3380135_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3380134_3381319_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3381476_3381800_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161728.1|3381750_3382884_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
3382963:3382978	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	3440463	3488740	5467107	tail,protease,head,portal,holin,terminase,integrase,transposase	Enterobacteria_phage(30.77%)	55	3430438:3430454	3490549:3490565
3430438:3430454	attL	TTCCGGTCTGATGACCA	NA	NA	NA	NA
WP_001023407.1|3440463_3440733_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_070479928.1|3440734_3442048_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001151105.1|3447818_3448517_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3448516_3448846_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_010904726.1|3448842_3449607_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_000533402.1|3451400_3451814_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3451840_3452272_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3452285_3453026_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3453007_3453274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3453331_3453679_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3453715_3455221_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3455210_3456803_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3456799_3457006_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3456989_3458918_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|3458889_3459132_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3459181_3460720_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3460769_3461117_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3461113_3461494_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3461569_3461845_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3462595_3462802_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3463057_3463330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3463489_3464023_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3464243_3464357_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3464578_3464764_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3465291_3465606_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3466962_3468813_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3469580_3470294_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3470388_3470628_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3470914_3471733_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3471884_3472256_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3472245_3472617_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3472629_3473679_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3473680_3473959_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3474126_3474339_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3474383_3474521_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3474886_3475660_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3476011_3476425_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3476440_3477211_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3477232_3477979_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3477985_3479077_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3479155_3479611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3479817_3480243_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3480226_3480499_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3480607_3481009_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3481036_3481228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3481227_3481515_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3481792_3481948_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3482089_3482479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3482665_3482851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3483424_3483613_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3483609_3483801_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3483894_3486366_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3486433_3486676_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3486653_3487673_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3488080_3488740_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3490549:3490565	attR	TTCCGGTCTGATGACCA	NA	NA	NA	NA
>prophage 11
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	3719677	3757784	5467107	tail,protease,portal,lysis,holin,terminase,integrase	Enterobacteria_phage(52.38%)	49	3719262:3719276	3757858:3757872
3719262:3719276	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3719677_3720376_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3720606_3721488_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3721657_3721819_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3722315_3723335_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3723368_3724349_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3724525_3724795_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3724796_3726113_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3726172_3726772_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3726842_3730256_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3730316_3730925_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3730861_3731605_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3731610_3732309_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3732318_3732648_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3732647_3735713_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3735684_3736014_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3736022_3736409_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3736469_3737213_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3737223_3737625_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3737621_3738200_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3738211_3738487_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3738479_3738803_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3738889_3740917_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3740861_3741197_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3741318_3742443_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3742370_3742583_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3742579_3744682_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3744681_3745173_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3745847_3746000_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3745987_3746455_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3746451_3746949_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3746948_3747164_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000499454.1|3747786_3747945_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3748030_3748774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3748957_3749647_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3749661_3749784_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3750121_3751081_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3751292_3751958_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108061.1|3751954_3752584_-	recombination protein NinG	NA	Q716C3	Shigella_phage	92.8	4.6e-94
WP_000567001.1|3752576_3752747_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3752743_3752926_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3753623_3754304_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3754300_3754483_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3754455_3754647_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3754657_3754939_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3755037_3755259_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3755469_3756072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3756314_3756482_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3756521_3756740_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|3756902_3757784_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
3757858:3757872	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP017249	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant chromosome, complete genome	5467107	4336683	4387952	5467107	tail,integrase,plate,transposase	Escherichia_phage(26.32%)	49	4336254:4336268	4372483:4372497
4336254:4336268	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4336683_4337865_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4338827_4339571_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4340394_4341168_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4341225_4341780_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_070479937.1|4342301_4342895_+|tail	phage tail protein	tail	M1SV83	Escherichia_phage	58.7	9.8e-54
WP_000344820.1|4342866_4343310_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000788819.1|4344036_4344348_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4345299_4345593_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4345711_4345912_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4346012_4346726_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4346853_4347243_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4347482_4347728_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4348797_4350051_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4350062_4351166_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4351453_4352509_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4352547_4352949_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4353006_4354251_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4354342_4354801_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4355061_4356519_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4356575_4357112_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4357044_4357311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4357617_4358070_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4358079_4358478_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4358480_4358774_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|4358825_4359881_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4359951_4360737_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4360681_4362421_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4363238_4364012_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4364197_4364458_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4364476_4364737_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4364892_4365633_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4365603_4366371_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4366475_4367054_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4367293_4369738_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4369780_4370254_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4370407_4371178_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4371295_4372468_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4372548_4372734_+	protein YncO	NA	NA	NA	NA	NA
4372483:4372497	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4372648_4372912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4373113_4374874_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4374876_4376013_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001451053.1|4376758_4377322_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4377390_4381605_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|4381680_4383822_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4384031_4384550_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4385246_4385747_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4385781_4386006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4386056_4387448_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4387538_4387952_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP017250	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence	92690	0	6589	92690	integrase	Macacine_betaherpesvirus(50.0%)	6	880:892	10717:10729
880:892	attL	CTGGAAAAACTCT	NA	NA	NA	NA
WP_001066920.1|1190_1931_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_010891288.1|2051_2282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|2450_2735_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303402.1|2764_2959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001213545.1|3025_4465_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987091.1|4468_6589_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
10717:10729	attR	AGAGTTTTTCCAG	NA	NA	NA	NA
>prophage 2
NZ_CP017250	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence	92690	34310	38428	92690	protease	Enterobacterial_phage(50.0%)	2	NA	NA
WP_001034100.1|34310_38213_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_085950648.1|38332_38428_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
>prophage 3
NZ_CP017250	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence	92690	47842	51222	92690		Moraxella_phage(33.33%)	5	NA	NA
WP_001233853.1|47842_48304_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302189.1|48548_48761_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|48893_49454_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|49556_50417_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|50475_51222_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
>prophage 4
NZ_CP017250	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence	92690	69046	73213	92690		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_000117168.1|69046_71005_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000005995.1|71070_71304_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290823.1|71360_71813_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_001451816.1|72114_72564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302171.1|72649_73213_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
>prophage 5
NZ_CP017250	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence	92690	78890	79574	92690		Vibrio_phage(100.0%)	1	NA	NA
WP_000085945.1|78890_79574_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
>prophage 6
NZ_CP017250	Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence	92690	83961	89729	92690	integrase,transposase	Macacine_betaherpesvirus(66.67%)	6	77073:77086	91919:91932
77073:77086	attL	GCAAGGGAAGCCGC	NA	NA	NA	NA
WP_000817031.1|83961_84933_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|84932_86099_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_071525396.1|86686_87025_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_085948178.1|86986_88199_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|88165_88246_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|88922_89729_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
91919:91932	attR	GCAAGGGAAGCCGC	NA	NA	NA	NA
