The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	632421	741991	6928736	plate,lysis,portal,tRNA,terminase,capsid,tail,transposase,head	Pseudomonas_phage(57.69%)	115	NA	NA
WP_076611796.1|632421_633798_+|transposase	IS30-like element ISPa37 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.7	1.1e-42
WP_019725766.1|636187_636370_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	54.2	2.2e-09
WP_019725767.1|636402_636825_+	transcriptional regulator	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.7	6.1e-26
WP_025982283.1|637070_638042_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	93.8	2.2e-172
WP_019725770.1|638026_638719_-	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	36.5	3.6e-39
WP_025982284.1|638715_639258_-	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	87.1	1.0e-81
WP_019725772.1|639254_640178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100199590.1|640174_640492_-|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	70.3	3.3e-32
WP_079386531.1|640647_643269_-	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	54.0	3.1e-160
WP_019725775.1|643278_643803_-	hypothetical protein	NA	A0A0U4JVX3	Pseudomonas_phage	93.7	1.2e-90
WP_034018116.1|643795_644968_-	phage protein	NA	A0A0U4JJ14	Pseudomonas_phage	91.3	4.0e-208
WP_019725777.1|644964_645282_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	94.2	1.2e-45
WP_034008995.1|645278_647648_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	74.7	1.4e-239
WP_019725780.1|647825_648122_-	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	77.7	1.4e-32
WP_019725781.1|648118_648634_-|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	73.2	5.9e-47
WP_019725782.1|648630_649092_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	95.4	7.8e-75
WP_100199591.1|649088_649343_-	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	38.0	2.9e-07
WP_019725784.1|649390_649603_-	hypothetical protein	NA	A0A0U4IIN4	Pseudomonas_phage	81.2	1.8e-26
WP_023122750.1|649602_650052_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	85.2	4.0e-68
WP_019725786.1|650055_651171_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	83.0	1.1e-175
WP_023126976.1|651183_651852_-	hypothetical protein	NA	A0A0U4ISN1	Pseudomonas_phage	92.6	6.4e-110
WP_019725788.1|651844_652282_-|tail	tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	91.0	3.8e-71
WP_019725789.1|652281_652743_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	95.4	3.8e-77
WP_019725790.1|652840_653575_-|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	100.0	7.7e-133
WP_012074147.1|653571_654594_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	100.0	1.1e-193
WP_019725791.1|654593_655547_-	hypothetical protein	NA	A0A0U4JVV6	Pseudomonas_phage	100.0	2.7e-146
WP_034084904.1|655704_657753_+|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	100.0	0.0e+00
WP_019725793.1|657592_658519_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	100.0	3.3e-133
WP_019725794.1|658563_658821_+	transcriptional regulator	NA	R9TNQ2	Vibrio_phage	42.9	3.6e-13
WP_019725795.1|659386_659665_-	hypothetical protein	NA	A0A0U4B0R1	Pseudomonas_phage	100.0	1.4e-47
WP_019725796.1|659661_659892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725797.1|659888_660134_-	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	100.0	1.0e-36
WP_019725798.1|660126_660393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725799.1|660463_660823_-	hypothetical protein	NA	A0A0U4JXA4	Pseudomonas_phage	100.0	3.5e-62
WP_100199592.1|660852_661176_-	hypothetical protein	NA	A0A0U4JP55	Pseudomonas_phage	100.0	4.4e-56
WP_019725801.1|661215_661617_-	hypothetical protein	NA	A0A0U4IIM6	Pseudomonas_phage	100.0	6.4e-73
WP_019725802.1|662058_664749_-	hypothetical protein	NA	A0A0U3TH43	Pseudomonas_phage	100.0	0.0e+00
WP_019725803.1|664758_664989_-	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	100.0	8.2e-33
WP_019725804.1|665086_665326_+	helix-turn-helix transcriptional regulator	NA	A0A0U4ISL7	Pseudomonas_phage	100.0	2.6e-37
WP_019725805.1|666550_670288_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
WP_003085035.1|670394_672248_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_019725806.1|672327_674322_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085042.1|674404_674854_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|674923_675139_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003129196.1|675339_676365_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|676443_677013_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|677096_677450_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|677440_677983_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_019725807.1|677955_679188_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	4.5e-77
WP_003085071.1|679231_679738_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|679831_681385_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|681381_682653_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|682753_684676_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|684954_685287_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|685330_686182_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|686181_686562_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_019725808.1|686598_687405_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003117956.1|687520_688507_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|688503_689796_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003113209.1|689776_692551_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010793494.1|692677_693694_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010793493.1|693690_694365_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_019725809.1|694366_695125_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_019725810.1|695125_696187_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_019725811.1|696338_698732_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|698777_699410_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|699538_700573_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|700806_701916_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|701971_703018_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|703132_704380_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|704485_705316_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|705439_706114_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003113205.1|706113_706932_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003113204.1|707004_708483_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|708801_709116_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|709215_709986_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|710443_710644_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|710691_711051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|711414_711864_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003113200.1|711885_712401_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003118909.1|712397_712955_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003085143.1|713107_713434_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003118910.1|713430_714318_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	1.2e-87
WP_003118911.1|714310_714844_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_003123931.1|714845_716921_+	bacteriophage protein	NA	Q9ZXK6	Pseudomonas_virus	50.5	1.3e-198
WP_003118913.1|716917_717376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118914.1|717418_718579_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.7	1.2e-188
WP_003085175.1|718591_719095_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|719109_719454_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003118915.1|719623_721861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118916.1|721870_722743_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.4	1.1e-74
WP_003101635.1|722717_722924_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003109053.1|722981_723971_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.3e-106
WP_003118917.1|724003_724633_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003118918.1|724629_724992_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003118919.1|724988_725246_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|725561_726056_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|726067_726415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|726444_726699_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003113187.1|726745_728581_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	36.2	1.2e-28
WP_003113186.1|728573_728915_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_010793484.1|728922_729618_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	49.8	7.4e-69
WP_003113184.1|729620_730391_+	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_003113183.1|730445_731048_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.8	2.2e-53
WP_019725813.1|731106_734721_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	54.6	0.0e+00
WP_003118927.1|734956_735745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115342.1|735768_736860_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
WP_003113180.1|736859_737195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010895513.1|737175_737406_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	62.7	3.3e-18
WP_003113178.1|737501_738554_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.2	4.6e-62
WP_003113177.1|738553_738856_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003113176.1|738852_739083_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	8.2e-25
WP_003113175.1|739501_740107_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	4.6e-75
WP_003085203.1|740108_741158_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|741154_741991_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	1486916	1495944	6928736		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1486916_1487552_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1487597_1488491_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1488595_1489600_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003119354.1|1490025_1490349_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1490415_1492983_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003117491.1|1493108_1494116_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1494263_1494770_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1494903_1495944_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	2341825	2393851	6928736	portal,tRNA,terminase,transposase,head,protease	uncultured_Caudovirales_phage(23.81%)	60	NA	NA
WP_003090915.1|2341825_2342701_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003115276.1|2342834_2343287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090913.1|2343338_2344550_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003090911.1|2344734_2345133_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003090910.1|2345244_2345730_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	8.1e-22
WP_003114767.1|2345726_2346218_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003158678.1|2346236_2348597_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.3	1.8e-45
WP_003143737.1|2348679_2349570_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003090905.1|2349566_2350049_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003114770.1|2350058_2350721_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003090903.1|2350782_2351556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143739.1|2352511_2354089_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003090890.1|2354155_2354566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003119883.1|2354624_2355005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003108955.1|2355133_2357581_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003098789.1|2357733_2358405_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_003108953.1|2358519_2359140_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003090885.1|2359215_2360148_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	2.4e-22
WP_003090884.1|2360144_2360924_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003090883.1|2360973_2362305_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-12
WP_003098784.1|2362301_2362982_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.4e-27
WP_003090881.1|2363107_2363299_+	repressor PtrA	NA	NA	NA	NA	NA
WP_003119888.1|2363470_2364088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098780.1|2364205_2365036_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.0	1.3e-32
WP_014602745.1|2365102_2365366_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_003090877.1|2365439_2366021_-	HD domain-containing protein	NA	A0A2K9L4U0	Tupanvirus	37.1	7.7e-19
WP_003114775.1|2366017_2366761_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003104061.1|2366894_2367614_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_004350269.1|2367615_2368020_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003114777.1|2368122_2368827_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_003104055.1|2368884_2369184_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_003119890.1|2369430_2370615_+	SpoIIE family protein phosphatase	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	7.3e-08
WP_003104052.1|2370611_2371094_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003090868.1|2371181_2372105_-	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	30.0	6.5e-12
WP_019726496.1|2372184_2373165_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_086005540.1|2374344_2375507_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
WP_003130859.1|2375676_2375952_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	65.5	3.4e-25
WP_019726493.1|2376055_2376268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130861.1|2376264_2378145_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	43.2	1.2e-132
WP_019726492.1|2378141_2378621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726491.1|2378630_2378870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726490.1|2378866_2379493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726489.1|2379543_2379861_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_019726488.1|2379857_2380088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019727252.1|2380238_2380532_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_019726486.1|2380541_2380853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726485.1|2381135_2381849_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	35.8	1.4e-22
WP_019726484.1|2381955_2382210_+	hypothetical protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	45.6	1.5e-06
WP_019726483.1|2382527_2383082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003130865.1|2383074_2383284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726482.1|2383280_2385494_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	46.8	1.5e-187
WP_019396873.1|2385490_2385862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726481.1|2386434_2386785_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	48.6	2.8e-16
WP_019726480.1|2386781_2387519_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	47.1	8.8e-44
WP_019726479.1|2387773_2388349_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	56.4	1.2e-45
WP_019726478.1|2388351_2390361_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	71.4	7.7e-268
WP_004353026.1|2390372_2390597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726477.1|2390596_2392063_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	66.0	1.1e-175
WP_019726476.1|2392046_2393219_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	6.6e-86
WP_019726475.1|2393215_2393851_+|head	head decoration protein	head	NA	NA	NA	NA
>prophage 4
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	2645056	2747763	6928736	integrase,tRNA,transposase,protease	uncultured_Caudovirales_phage(27.27%)	97	2695540:2695561	2747916:2747941
WP_003097649.1|2645056_2645425_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_019726384.1|2645452_2647729_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	4.5e-163
WP_002553999.1|2647810_2648029_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003097644.1|2648133_2648841_-	arginyltransferase	NA	NA	NA	NA	NA
WP_003160442.1|2648895_2649576_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003090421.1|2649613_2650564_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	9.2e-62
WP_003119977.1|2650791_2653227_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
WP_003090414.1|2653252_2653879_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003097632.1|2653888_2655214_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_003097631.1|2655335_2656616_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003113366.1|2656617_2658015_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2658019_2658994_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2659081_2660065_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003090393.1|2660061_2660397_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2660393_2660699_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2660698_2661058_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003097619.1|2661054_2661450_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2661560_2662229_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_017001968.1|2662582_2664166_-	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
WP_017149109.1|2664162_2664768_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_019726383.1|2664880_2665777_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003130938.1|2666116_2667184_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003097609.1|2667193_2668138_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003097607.1|2668147_2669230_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003162150.1|2669234_2670386_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_019726382.1|2670493_2671480_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019726381.1|2671491_2672448_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003097598.1|2672583_2673543_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003090369.1|2673609_2674182_-	quorum threshold expression protein QteE	NA	NA	NA	NA	NA
WP_003090368.1|2674388_2675492_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003097562.1|2675644_2676451_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017001947.1|2676570_2679225_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.4	6.4e-12
WP_019726380.1|2679235_2680450_+	MFS transporter	NA	NA	NA	NA	NA
WP_003097554.1|2680465_2681494_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016562005.1|2682111_2683260_+	2-heptyl-3-hydroxy-4(1H)-quinolone synthase	NA	NA	NA	NA	NA
WP_003090351.1|2683601_2684246_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_003097551.1|2684246_2686073_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003090349.1|2686106_2686667_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_019726379.1|2687037_2688981_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	48.0	4.7e-97
WP_009459580.1|2689018_2689987_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_019726377.1|2690105_2690759_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009459591.1|2690878_2691172_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019726376.1|2691194_2692085_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009459598.1|2692588_2693803_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_124136468.1|2694211_2695048_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	3.4e-28
WP_071535812.1|2695128_2695416_-|transposase	transposase	transposase	NA	NA	NA	NA
2695540:2695561	attL	AACAACGTCCCTGGACATCACA	NA	NA	NA	NA
WP_019726375.1|2695753_2696035_+	hypothetical protein	NA	NA	NA	NA	NA
2695540:2695561	attL	AACAACGTCCCTGGACATCACA	NA	NA	NA	NA
WP_019726374.1|2696031_2696760_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_019726373.1|2696756_2697098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726372.1|2697207_2697630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726371.1|2697610_2698429_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_019726370.1|2698431_2699016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726369.1|2699022_2699940_-	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_019726368.1|2699936_2701565_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_133422412.1|2701596_2702181_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	56.7	2.5e-49
WP_019726366.1|2703005_2703914_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.6e-47
WP_014454105.1|2704074_2704629_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_063864264.1|2704709_2705510_+	OXA-10 family oxacillin-hydrolyzing class D beta-lactamase OXA-56	NA	NA	NA	NA	NA
WP_010794258.1|2705571_2706369_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA7	NA	NA	NA	NA	NA
WP_079263039.1|2706641_2707685_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000679427.1|2707907_2708255_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_019727244.1|2708248_2709130_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_019726358.1|2709210_2710743_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016805816.1|2711024_2711342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|2711335_2712175_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_005297378.1|2713309_2714485_-	chloramphenicol efflux MFS transporter Cmx	NA	NA	NA	NA	NA
2712326:2712347	attR	TGTGATGTCCAGGGACGTTGTT	NA	NA	NA	NA
WP_011113070.1|2714506_2714560_-	chloramphenicol resistance leader peptide	NA	NA	NA	NA	NA
2712326:2712347	attR	TGTGATGTCCAGGGACGTTGTT	NA	NA	NA	NA
WP_124136468.1|2714724_2715561_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	3.4e-28
WP_071535812.1|2715641_2715929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009459599.1|2716191_2717133_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009459601.1|2717625_2718057_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_009459603.1|2718431_2720408_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_009459605.1|2720558_2721464_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009459611.1|2721618_2722026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009459619.1|2722027_2722636_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_009459621.1|2722632_2723523_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_007182548.1|2723805_2724081_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_011871467.1|2724140_2725250_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	2.9e-35
WP_009459624.1|2725293_2725692_+	VOC family protein	NA	NA	NA	NA	NA
WP_019726353.1|2725874_2727209_+	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_007182551.1|2727267_2728098_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_019726352.1|2728116_2729424_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009459628.1|2729475_2730789_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	9.7e-78
WP_019726351.1|2730849_2732715_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	37.1	2.0e-52
WP_019726350.1|2732740_2735392_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.8	9.8e-154
WP_019726349.1|2735472_2737311_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009459635.1|2737628_2738255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726347.1|2738267_2738900_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_009459638.1|2738984_2739350_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_019726345.1|2739361_2740882_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_022983350.1|2740897_2741245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009459646.1|2741250_2742645_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_019726343.1|2742654_2743602_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_009459649.1|2743598_2744045_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012248433.1|2744507_2745767_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012248434.1|2745763_2746756_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012248435.1|2746752_2747763_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.0	2.8e-24
2747916:2747941	attR	GGCACATAAGAAAACAGGGCACAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	2791029	2844520	6928736	integrase,terminase,tail,head,holin	Pseudomonas_phage(61.54%)	61	2794855:2794914	2844748:2844839
WP_023123608.1|2791029_2793915_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	1.4e-33
WP_019726330.1|2794005_2794539_+	hypothetical protein	NA	NA	NA	NA	NA
2794855:2794914	attL	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCC	NA	NA	NA	NA
WP_003099003.1|2795000_2796038_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.3	1.1e-111
WP_003158549.1|2796066_2796300_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_031639984.1|2796356_2796743_-	hypothetical protein	NA	L7TJJ9	Pseudomonas_virus	98.4	4.0e-64
WP_019727237.1|2796854_2797697_-	hypothetical protein	NA	L7TKP8	Pseudomonas_virus	49.1	6.4e-75
WP_019727236.1|2797895_2798657_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	96.8	3.1e-145
WP_019727235.1|2798653_2799295_-	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	95.3	1.7e-120
WP_019727234.1|2799291_2799936_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	82.2	2.3e-93
WP_031639982.1|2800061_2800757_+	DUF4145 domain-containing protein	NA	A0A1S5S8Y9	Streptococcus_phage	50.6	1.3e-41
WP_019727232.1|2800753_2802451_-	DNA methyltransferase	NA	L7TH64	Pseudomonas_virus	95.9	1.4e-302
WP_019727231.1|2802832_2803699_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	97.5	4.6e-161
WP_019727230.1|2803842_2804556_-	DNA exonuclease	NA	A0A059VJT9	Pseudomonas_phage	48.1	1.1e-51
WP_019727229.1|2804605_2806351_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	75.9	1.4e-233
WP_019727228.1|2806354_2807335_-	cell division protein FtsK	NA	H2BD47	Pseudomonas_phage	63.8	5.3e-97
WP_009314053.1|2807347_2807548_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	100.0	1.9e-30
WP_019727227.1|2807554_2808454_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.2	2.0e-103
WP_019727226.1|2808466_2809375_-	endonuclease	NA	Q858E0	Salmonella_phage	72.0	9.5e-125
WP_019727225.1|2809385_2809595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|2809591_2809813_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_019727224.1|2810337_2810586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019727223.1|2810599_2810968_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	98.4	1.2e-62
WP_019727222.1|2811000_2811264_-	hypothetical protein	NA	H2BD57	Pseudomonas_phage	97.7	8.2e-45
WP_019727221.1|2811823_2812075_-	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	44.6	5.8e-08
WP_100199349.1|2812208_2812904_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTC8	Pseudomonas_phage	60.8	4.1e-51
WP_019727219.1|2812971_2813202_+	helix-turn-helix transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	70.6	7.4e-18
WP_009314063.1|2813242_2813839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025981548.1|2813842_2814727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727218.1|2814776_2815385_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	51.3	1.0e-42
WP_019727217.1|2815377_2815821_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.0	6.1e-77
WP_003116756.1|2815849_2816536_+	hypothetical protein	NA	H2BD72	Pseudomonas_phage	100.0	9.7e-130
WP_004349441.1|2816650_2817040_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_019727216.1|2817032_2817317_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	98.9	2.7e-41
WP_019727215.1|2817325_2817922_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	59.9	1.3e-45
WP_019727214.1|2817908_2819210_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.3	1.1e-145
WP_019727213.1|2819218_2820643_+	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	36.0	3.0e-72
WP_019727212.1|2820632_2821676_+|head	head morphogenesis protein	head	A0A1B0VMF3	Pseudomonas_phage	34.1	2.5e-44
WP_019727210.1|2822073_2822784_+	hypothetical protein	NA	A0A2H4J0Y0	uncultured_Caudovirales_phage	62.4	6.3e-39
WP_019727209.1|2822796_2823765_+	hypothetical protein	NA	R9TJ64	Synechococcus_phage	66.0	2.1e-114
WP_019727208.1|2823813_2824032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727207.1|2824071_2824464_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	34.6	7.7e-07
WP_019727206.1|2824466_2824847_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	54.4	4.0e-32
WP_019727205.1|2824849_2825410_+	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	37.7	7.6e-24
WP_019727204.1|2825406_2825814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727203.1|2825875_2827045_+	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	39.1	2.2e-57
WP_019727202.1|2827103_2827592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071535787.1|2827711_2827987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727201.1|2827937_2831219_+|tail	tail length tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.5	1.2e-95
WP_019727200.1|2831218_2831689_+	hypothetical protein	NA	A0A125RNN3	Pseudomonas_phage	41.1	3.9e-29
WP_019727199.1|2831690_2832176_+	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	47.8	3.2e-34
WP_019727198.1|2832179_2832593_+	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	60.4	4.3e-40
WP_025981546.1|2832558_2835306_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	47.7	3.9e-238
WP_019727196.1|2835372_2837625_+	hypothetical protein	NA	H2BDD0	Pseudomonas_virus	94.6	0.0e+00
WP_025981544.1|2838027_2840091_+	acyltransferase	NA	Q9MC93	Pseudomonas_phage	96.8	0.0e+00
WP_019727195.1|2840164_2841325_-	polymerase	NA	H2BD97	Pseudomonas_phage	96.9	8.0e-201
WP_019727194.1|2841409_2842039_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	96.2	3.8e-112
WP_019727193.1|2842035_2842404_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	66.4	7.7e-33
WP_025981543.1|2842472_2842739_+	hypothetical protein	NA	J7I0U5	Pseudomonas_phage	93.2	2.6e-38
WP_019727191.1|2842774_2843041_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	97.7	1.8e-44
WP_019727190.1|2843022_2843709_-	DUF159 family protein	NA	A0A2K8I970	Pseudomonas_phage	89.9	9.7e-122
WP_019727188.1|2844004_2844520_-	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	94.2	3.8e-94
2844748:2844839	attR	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCCCGTAGCTCAGTGAGTTACGGGGCTTTTTTCTT	NA	NA	NA	NA
>prophage 6
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	2956150	2991437	6928736	integrase,transposase	Salmonella_phage(28.57%)	32	2990249:2990274	2993795:2993820
WP_019726295.1|2956150_2957674_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_063864747.1|2958093_2958924_+	subclass B1 metallo-beta-lactamase SPM-1	NA	NA	NA	NA	NA
WP_019726295.1|2959524_2961048_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_019726294.1|2961190_2961679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726293.1|2961914_2962181_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_019726292.1|2962177_2963122_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031633255.1|2963131_2964319_-	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.4	3.9e-25
WP_019726295.1|2966450_2967974_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_063864747.1|2968393_2969224_+	subclass B1 metallo-beta-lactamase SPM-1	NA	NA	NA	NA	NA
WP_019726295.1|2969824_2971348_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_019726294.1|2971490_2971979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726293.1|2972214_2972481_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_019726292.1|2972477_2973422_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031633255.1|2973431_2974619_-	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.4	3.9e-25
WP_019726290.1|2974926_2976900_-	relaxase/mobilization nuclease and DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_019726289.1|2977348_2977924_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_025981541.1|2977920_2978454_-	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_025981540.1|2978450_2978735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726286.1|2978731_2979370_-	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	40.1	5.1e-32
WP_019726285.1|2979623_2980481_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_019726284.1|2980507_2980789_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019726283.1|2980872_2981652_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_094948649.1|2982048_2982814_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_019726280.1|2982821_2983169_-	DUF2958 domain-containing protein	NA	NA	NA	NA	NA
WP_019726279.1|2983392_2983686_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019726278.1|2984020_2984335_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_019726277.1|2985189_2985399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726276.1|2985460_2987518_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.4e-21
WP_025981539.1|2987582_2988407_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.8	3.6e-46
WP_019726273.1|2989107_2989386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726272.1|2989451_2989802_-	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	58.6	2.7e-27
2990249:2990274	attL	TTTTGTGCCCTGTTTTCTTATGTGCC	NA	NA	NA	NA
WP_012248435.1|2990426_2991437_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.0	2.8e-24
WP_012248435.1|2990426_2991437_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.0	2.8e-24
2993795:2993820	attR	GGCACATAAGAAAACAGGGCACAAAA	NA	NA	NA	NA
>prophage 7
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	3303920	3358626	6928736	plate,integrase,tail,transposase,head,protease	Pseudomonas_phage(36.17%)	72	3315205:3315221	3341162:3341178
WP_019726198.1|3303920_3305465_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003089328.1|3305465_3306128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726197.1|3306124_3306796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726196.1|3306792_3308250_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003089323.1|3308256_3308685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122741.1|3308972_3309827_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003117819.1|3309839_3310532_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	78.5	1.0e-102
WP_003112098.1|3310543_3311014_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	69.2	1.3e-53
WP_003124660.1|3312328_3312679_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	62.5	5.1e-34
WP_003113750.1|3312757_3313648_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003160271.1|3313856_3314918_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	44.7	1.8e-82
WP_003089304.1|3314942_3315320_-	hypothetical protein	NA	NA	NA	NA	NA
3315205:3315221	attL	GACAACTGGCTGGCGGG	NA	NA	NA	NA
WP_003089301.1|3315397_3315868_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003110751.1|3315875_3317573_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003089295.1|3317694_3318210_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003113746.1|3318217_3318808_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003158930.1|3318954_3320160_+	MFS transporter	NA	NA	NA	NA	NA
WP_003089287.1|3320123_3321194_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_003117815.1|3321280_3322177_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019726690.1|3322335_3322716_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_019396420.1|3322700_3323123_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	52.6	7.8e-29
WP_019726691.1|3323122_3323566_-	hypothetical protein	NA	A0A076FX15	Pseudomonas_phage	72.4	4.3e-62
WP_025981565.1|3323568_3323964_-	hypothetical protein	NA	J9SNQ5	Pseudomonas_phage	92.3	2.0e-63
WP_019726693.1|3323965_3324589_-	DUF3164 family protein	NA	A0A0S4L2U9	Pseudomonas_phage	97.6	8.0e-107
WP_019726694.1|3324581_3325226_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	84.0	8.8e-16
WP_023434357.1|3325225_3325531_-	hypothetical protein	NA	A0A0S4L2V0	Pseudomonas_phage	99.0	2.4e-48
WP_019726696.1|3325527_3325866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726697.1|3325867_3327100_-	AAA family ATPase	NA	J9SNL1	Pseudomonas_phage	47.2	5.9e-85
WP_019726698.1|3327109_3328885_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	32.8	1.4e-74
WP_019726699.1|3328908_3329871_-	hypothetical protein	NA	J9RW58	Pseudomonas_phage	74.6	7.3e-75
WP_019726700.1|3329916_3330231_-	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	80.8	2.8e-39
WP_019726701.1|3330227_3330488_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	88.4	9.0e-36
WP_019726702.1|3330480_3330966_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	54.1	1.2e-44
WP_019396407.1|3331300_3331525_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	87.3	2.0e-28
WP_019726703.1|3331644_3332058_+	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	58.6	1.4e-27
WP_124089521.1|3332070_3332670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726704.1|3332820_3333288_+	structural protein	NA	J9Q7Y7	Salmonella_phage	53.4	1.7e-37
WP_019726705.1|3333284_3333506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726706.1|3333680_3334292_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	52.7	4.5e-46
WP_019726707.1|3334298_3334526_+	hypothetical protein	NA	Q9ZXI6	Pseudomonas_virus	43.7	3.1e-08
WP_019683422.1|3334531_3334810_+	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	43.6	5.3e-10
WP_019726708.1|3334806_3335100_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	67.7	7.8e-28
WP_025981567.1|3335101_3335653_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	45.3	3.9e-28
WP_019396461.1|3335649_3337269_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	45.3	4.3e-112
WP_019726710.1|3337265_3338762_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	59.2	8.0e-161
WP_019726711.1|3338782_3339577_+|head	phage head morphogenesis protein	head	A0A1C6ZDL9	Pseudomonas_phage	61.8	5.8e-86
WP_019726712.1|3339573_3340056_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	36.6	6.0e-17
WP_019726713.1|3340290_3341394_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	47.2	8.7e-88
3341162:3341178	attR	CCCGCCAGCCAGTTGTC	NA	NA	NA	NA
WP_019396458.1|3341409_3342333_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	50.8	3.2e-83
WP_019726714.1|3342340_3342670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726715.1|3342673_3343006_+	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	58.2	9.1e-25
WP_019681673.1|3343008_3343440_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	56.2	1.4e-38
WP_019396454.1|3343439_3343919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396453.1|3343915_3344152_+	hypothetical protein	NA	A4JWK4	Burkholderia_virus	44.6	3.3e-05
WP_019396452.1|3344148_3345576_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	65.3	1.5e-180
WP_019396451.1|3345576_3346101_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	56.6	4.2e-48
WP_019726716.1|3346101_3346545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726717.1|3346591_3346771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726718.1|3346938_3347253_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_019726719.1|3347312_3347570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726720.1|3347589_3350277_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	35.8	1.3e-97
WP_019726721.1|3350276_3351146_+|tail	phage tail protein	tail	A0A067ZI88	Vibrio_phage	32.5	7.7e-07
WP_019396445.1|3351145_3351361_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	54.4	1.0e-16
WP_019727261.1|3351360_3352455_+	regulatory protein	NA	Q6QIA2	Burkholderia_phage	40.7	2.3e-64
WP_019726723.1|3352451_3352982_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	33.2	5.5e-16
WP_019726724.1|3353045_3353429_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.2	7.3e-34
WP_019726725.1|3353406_3354528_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	49.5	2.7e-89
WP_019726726.1|3354520_3355075_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	52.6	7.8e-45
WP_033940591.1|3355074_3357078_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	39.7	4.9e-105
WP_019726728.1|3357230_3357533_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	68.8	6.5e-30
WP_071535791.1|3357667_3357862_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	58.7	2.3e-12
WP_019726729.1|3357831_3358626_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	87.5	1.1e-137
>prophage 8
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	5152304	5211820	6928736	integrase,transposase	Pseudomonas_phage(57.14%)	51	5146409:5146423	5207554:5207568
5146409:5146423	attL	CCAGCAGCAGGCGGC	NA	NA	NA	NA
WP_012248435.1|5152304_5153315_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.0	2.8e-24
WP_012248434.1|5153311_5154304_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012248433.1|5154300_5155560_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008266034.1|5156025_5156472_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012205991.1|5156468_5157416_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_008266424.1|5157426_5158833_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_008264618.1|5158829_5159201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266205.1|5159216_5160740_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_008264713.1|5160746_5161106_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_008267277.1|5161133_5161592_-	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_008265574.1|5161591_5161909_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008264901.1|5162206_5164063_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008267353.1|5164093_5167429_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_008265595.1|5167425_5170062_-	chromosome segregation ATPase	NA	NA	NA	NA	NA
WP_008266911.1|5170064_5172032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008266894.1|5171998_5175355_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014603592.1|5175351_5176695_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_023124773.1|5176687_5177404_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_023124774.1|5177400_5177889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008266170.1|5177885_5179682_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_008268248.1|5179645_5182321_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_031757235.1|5182317_5182548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033940875.1|5182540_5182885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012206005.1|5182881_5184192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012206006.1|5184208_5184478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012206007.1|5184477_5185212_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_008266576.1|5185292_5188298_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	41.3	2.5e-193
WP_033940889.1|5188309_5190295_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	46.0	3.9e-123
WP_014603588.1|5190321_5191116_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_008266060.1|5191112_5192900_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_014603587.1|5192914_5196148_-	helicase	NA	A0A2K5B253	Erysipelothrix_phage	42.8	3.3e-236
WP_008267281.1|5196160_5197069_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_033940876.1|5197347_5197710_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033940877.1|5197773_5199294_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.7	4.6e-47
WP_033940878.1|5199368_5200166_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.6	2.4e-31
WP_033940880.1|5200155_5201682_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033940882.1|5202366_5202672_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033940883.1|5202793_5203435_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016263850.1|5203722_5204070_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003114155.1|5204079_5204331_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_019725833.1|5204544_5205528_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.3	1.8e-92
WP_003115206.1|5205527_5206820_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_019725831.1|5207078_5208341_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	57.0	2.2e-119
5207554:5207568	attR	CCAGCAGCAGGCGGC	NA	NA	NA	NA
WP_019725830.1|5208342_5208693_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	42.0	2.4e-20
WP_019725829.1|5208702_5209659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725828.1|5209975_5210194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|5210207_5210459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5210470_5210563_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_019725827.1|5210579_5211014_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.2	6.5e-63
WP_033072802.1|5211148_5211526_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	94.4	2.4e-58
WP_023123415.1|5211529_5211820_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	96.9	5.6e-55
>prophage 9
NZ_CP015002	Pseudomonas aeruginosa strain PA8281, complete genome	6928736	5627024	5665956	6928736	integrase,transposase,terminase	Pseudomonas_phage(96.23%)	55	5628966:5628981	5652770:5652785
WP_015975359.1|5627024_5627387_-	transcriptional regulator	NA	Q5ZR15	Pseudomonas_phage	100.0	2.3e-61
WP_023089283.1|5627389_5627953_-	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	98.4	2.8e-98
WP_015975360.1|5627939_5628407_-	hypothetical protein	NA	Q5ZR13	Pseudomonas_phage	100.0	8.2e-80
WP_003148480.1|5628408_5628627_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_003094188.1|5628628_5629318_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
5628966:5628981	attL	CGCTCCAGCACCTGGT	NA	NA	NA	NA
WP_023089286.1|5629319_5629937_-	DUF3164 family protein	NA	A0A0A1IVF8	Pseudomonas_phage	45.9	9.2e-47
WP_015975362.1|5629929_5630130_-	hypothetical protein	NA	Q5ZR09	Pseudomonas_phage	100.0	1.3e-31
WP_052155851.1|5630122_5630497_-	hypothetical protein	NA	Q5ZR08	Pseudomonas_phage	98.4	8.3e-67
WP_015975364.1|5630496_5630778_-	hypothetical protein	NA	Q5ZR07	Pseudomonas_phage	100.0	8.7e-45
WP_033940199.1|5630774_5631116_-	hypothetical protein	NA	Q5ZR06	Pseudomonas_phage	99.1	6.4e-58
WP_023089289.1|5631117_5632290_-	AAA family ATPase	NA	Q5ZR05	Pseudomonas_phage	85.9	1.8e-184
WP_079382934.1|5632289_5634071_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	99.7	0.0e+00
WP_033938114.1|5634073_5635000_-	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	91.2	1.1e-149
WP_015649409.1|5635010_5635319_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	100.0	5.4e-48
WP_003127832.1|5635311_5635797_-	hypothetical protein	NA	Q5ZR01	Pseudomonas_phage	100.0	7.4e-92
WP_021204956.1|5635920_5636145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025921029.1|5636429_5636660_-	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	90.8	1.4e-32
WP_033940200.1|5636773_5637133_+	helix-turn-helix domain-containing protein	NA	E5E3P4	Burkholderia_phage	49.5	5.8e-17
WP_031630694.1|5637149_5637653_+	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	92.8	5.2e-80
WP_124084312.1|5637657_5638101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003138152.1|5638436_5638694_+	membrane protein	NA	J9STQ9	Pseudomonas_phage	100.0	5.6e-38
WP_033940198.1|5638851_5639481_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	98.6	1.4e-119
WP_033940196.1|5639676_5640288_+	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	98.0	3.8e-101
WP_015975380.1|5640291_5640681_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	100.0	7.6e-63
WP_015975381.1|5640670_5640979_+	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	100.0	2.3e-54
WP_033940215.1|5640984_5641557_+	DUF3486 family protein	NA	Q5ZQY6	Pseudomonas_phage	98.9	3.0e-92
WP_015975383.1|5641556_5643017_+|terminase	large terminase subunit	terminase	Q5ZQY5	Pseudomonas_phage	100.0	1.8e-290
WP_033940194.1|5643016_5644495_+	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	99.0	3.7e-283
WP_023089300.1|5644494_5645751_+	hypothetical protein	NA	Q5ZQY3	Pseudomonas_phage	99.0	7.2e-240
WP_015975387.1|5645874_5646447_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	100.0	4.8e-106
WP_079382933.1|5646736_5647915_+	peptidase	NA	Q5ZQY0	Pseudomonas_phage	97.2	1.8e-168
WP_023089303.1|5647918_5648296_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	98.4	6.0e-57
WP_021204947.1|5648307_5649237_+	hypothetical protein	NA	Q5ZQX7	Pseudomonas_phage	98.4	4.2e-176
WP_021204946.1|5649249_5649885_+	hypothetical protein	NA	Q5ZQX6	Pseudomonas_phage	90.0	2.2e-96
WP_021204945.1|5649884_5650172_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	64.8	1.2e-25
WP_021204944.1|5650173_5650692_+	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	98.8	6.5e-94
WP_021204943.1|5650693_5651158_+	hypothetical protein	NA	Q5ZQX4	Pseudomonas_phage	89.6	4.5e-78
WP_021204942.1|5651154_5651349_+	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	54.4	1.1e-06
WP_021204941.1|5651353_5652094_+	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	68.3	4.6e-93
WP_021204940.1|5652096_5652612_+	hypothetical protein	NA	Q5ZQX1	Pseudomonas_phage	72.4	7.9e-60
WP_021204939.1|5652608_5652761_+	hypothetical protein	NA	Q5ZQX0	Pseudomonas_phage	90.7	9.6e-14
WP_015975400.1|5652896_5653082_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	100.0	2.6e-29
5652770:5652785	attR	ACCAGGTGCTGGAGCG	NA	NA	NA	NA
WP_033940189.1|5653051_5653846_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	99.2	3.8e-154
WP_033940187.1|5653926_5657235_+	tape measure protein	NA	Q5ZQW6	Pseudomonas_phage	95.5	0.0e+00
WP_019395761.1|5657234_5658191_+	hypothetical protein	NA	J9RWA0	Pseudomonas_phage	95.6	1.1e-182
WP_033940186.1|5658192_5659116_+	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	96.1	8.4e-177
WP_033940183.1|5659118_5660825_+	hypothetical protein	NA	J9STL4	Pseudomonas_phage	97.2	0.0e+00
WP_033940181.1|5660811_5661630_+	DUF2163 domain-containing protein	NA	J9SP65	Pseudomonas_phage	99.6	1.0e-165
WP_003094285.1|5661639_5661870_+	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_031674674.1|5661866_5662097_+	hypothetical protein	NA	J9RWP7	Pseudomonas_phage	96.1	4.6e-36
WP_033940179.1|5662083_5664294_+	bacteriophage protein	NA	Q5ZQV9	Pseudomonas_phage	97.7	0.0e+00
WP_023126637.1|5664290_5665136_+	DUF2793 domain-containing protein	NA	I6P8E4	Pseudomonas_phage	99.6	9.4e-159
WP_016050138.1|5665135_5665438_+	hypothetical protein	NA	I6PBW9	Pseudomonas_phage	100.0	2.3e-51
WP_016050139.1|5665434_5665653_+	hypothetical protein	NA	I6PBD6	Pseudomonas_phage	100.0	4.6e-33
WP_019395757.1|5665731_5665956_+	hypothetical protein	NA	H1ZZG9	Pseudomonas_virus	98.6	1.6e-33
