The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014681	Kozakia baliensis strain NBRC 16680 chromosome, complete genome	2807246	168963	182747	2807246	integrase,transposase	Enterobacteria_phage(20.0%)	9	166827:166871	174616:174660
166827:166871	attL	CTCATAACCTGAAGGCCGTAGGTTCAAATCCTACCCCCGCAACCA	NA	NA	NA	NA
WP_070404442.1|168963_169896_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.9e-54
WP_070404443.1|171010_171946_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070404444.1|172110_173223_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.2	3.3e-10
WP_070404445.1|173273_174440_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	33.2	2.1e-44
WP_151199731.1|175535_176667_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	7.4e-50
174616:174660	attR	CTCATAACCTGAAGGCCGTAGGTTCAAATCCTACCCCCGCAACCA	NA	NA	NA	NA
WP_070404447.1|176868_177102_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_070404448.1|177098_177485_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_099045773.1|178957_179720_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.1	4.1e-12
WP_070405779.1|181916_182747_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP014681	Kozakia baliensis strain NBRC 16680 chromosome, complete genome	2807246	1493270	1529562	2807246	transposase	Enterobacteria_phage(16.67%)	31	NA	NA
WP_070405121.1|1493270_1494203_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.4	1.0e-57
WP_070405122.1|1494313_1495759_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_151199892.1|1495938_1497144_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_099045773.1|1497294_1498058_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.1	4.1e-12
WP_151199787.1|1498187_1500491_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070405125.1|1500496_1501903_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_029606349.1|1502182_1502641_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158513400.1|1503802_1504030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162493419.1|1504595_1504808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083301934.1|1504854_1506156_+	TolC family protein	NA	NA	NA	NA	NA
WP_083301839.1|1506173_1507349_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_070405128.1|1507356_1510434_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.6	4.8e-59
WP_070405129.1|1510430_1511099_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_029605903.1|1511095_1512439_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_070405130.1|1512719_1513946_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_070405131.1|1515070_1516066_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_083301840.1|1516483_1516702_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_070405133.1|1516910_1517888_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070405134.1|1517975_1518923_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_062109344.1|1518944_1519520_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070405135.1|1519596_1520034_+	carotenoid oxygenase family protein	NA	NA	NA	NA	NA
WP_011252867.1|1520112_1521408_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.4	1.3e-18
WP_083301841.1|1521649_1522618_+	carotenoid oxygenase family protein	NA	NA	NA	NA	NA
WP_070405137.1|1522662_1523478_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_070405138.1|1523722_1524469_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.8	5.1e-15
WP_070405139.1|1524518_1524998_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_070405140.1|1525400_1525958_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070405141.1|1526003_1526885_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_193403402.1|1526999_1527806_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070405143.1|1527982_1528357_+	VOC family protein	NA	NA	NA	NA	NA
WP_151199788.1|1528430_1529562_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	7.4e-50
>prophage 3
NZ_CP014681	Kozakia baliensis strain NBRC 16680 chromosome, complete genome	2807246	2177144	2248828	2807246	portal,tRNA,tail,transposase	uncultured_Mediterranean_phage(25.0%)	59	NA	NA
WP_070405459.1|2177144_2178629_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070405460.1|2178676_2179657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070405969.1|2179658_2180198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070405970.1|2180266_2180668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070405461.1|2180678_2182058_-	DUF4043 domain-containing protein	NA	NA	NA	NA	NA
WP_070405462.1|2182130_2182565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029604823.1|2182564_2183995_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_029604824.1|2184028_2185351_-	DNA packaging protein	NA	A0A0U4IJ26	Arthrobacter_phage	38.9	4.6e-27
WP_151199816.1|2185812_2186214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151199917.1|2186315_2186774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151199919.1|2186865_2187120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029604828.1|2187263_2187656_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070405463.1|2188135_2191312_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.7	4.3e-47
WP_070405464.1|2191311_2192499_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_070405465.1|2192495_2194106_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_162493420.1|2194124_2194265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029603605.1|2194482_2194956_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.1	5.6e-36
WP_081827711.1|2194999_2195539_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.2	1.3e-25
WP_029603602.1|2195495_2198354_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.4	6.7e-100
WP_029603601.1|2198412_2198931_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	59.3	4.6e-39
WP_070405466.1|2199099_2202090_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.5	0.0e+00
WP_070405467.1|2202092_2203037_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_083301953.1|2203060_2205211_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_070405468.1|2205220_2207740_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.8	1.9e-29
WP_151199920.1|2207820_2209005_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_029603593.1|2209099_2209780_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_070405469.1|2209800_2211267_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_029603589.1|2211287_2211632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070405470.1|2211735_2212281_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_083301875.1|2212296_2212995_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_029603584.1|2213057_2213579_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.7	6.0e-15
WP_029603582.1|2213765_2215703_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	3.7e-118
WP_070405471.1|2215753_2216656_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_070405472.1|2216727_2217669_+	ribokinase	NA	NA	NA	NA	NA
WP_070405974.1|2217665_2218391_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_083301876.1|2218449_2219181_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070405976.1|2219290_2220157_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_051625734.1|2220410_2221403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029603572.1|2221527_2221911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070405473.1|2221910_2224109_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_070405474.1|2224198_2225404_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_029603568.1|2225400_2225580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070405475.1|2225594_2225888_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_029603566.1|2225967_2226519_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	64.7	7.2e-59
WP_070405476.1|2226671_2227934_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_151199818.1|2227957_2228593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070405478.1|2228994_2230572_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_070405479.1|2230618_2232055_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_070405480.1|2232152_2233070_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_070405481.1|2233144_2234779_-	lactate permease LctP family transporter	NA	NA	NA	NA	NA
WP_083301877.1|2234850_2236332_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_158513417.1|2236953_2238240_-	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_070405484.1|2238717_2239674_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_070405485.1|2239750_2240215_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_158513418.1|2242231_2242519_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.5	1.1e-07
WP_070405488.1|2242667_2244602_+	dextranase	NA	NA	NA	NA	NA
WP_070405131.1|2244883_2245879_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_070405489.1|2246040_2246988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151199921.1|2247759_2248828_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP014686	Kozakia baliensis strain NBRC 16680 plasmid pKB16680_5	11848	253	8573	11848	transposase,integrase	Enterobacteria_phage(33.33%)	9	494:508	9506:9520
WP_070406255.1|253_1288_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	26.9	2.3e-05
494:508	attL	GCCAAAGCCTTCGTC	NA	NA	NA	NA
WP_083301992.1|1590_2172_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	48.1	1.8e-23
WP_019088963.1|2168_2492_-|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	50.5	1.2e-21
WP_070406256.1|2611_3028_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_010512391.1|3024_3363_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_070406257.1|3371_4010_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	32.5	9.3e-10
WP_070406259.1|4307_4991_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_070406260.1|4990_6253_-	sodium:proton antiporter	NA	A0A2H4J428	uncultured_Caudovirales_phage	31.0	4.3e-14
WP_070406261.1|6386_8573_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.6	9.8e-67
9506:9520	attR	GCCAAAGCCTTCGTC	NA	NA	NA	NA
