The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014944	Colwellia sp. PAMC 20917 chromosome, complete genome	4683314	104283	162694	4683314	integrase,holin,transposase,tRNA	Vibrio_phage(22.22%)	49	99710:99724	116469:116483
99710:99724	attL	CTTCAATACCACAAC	NA	NA	NA	NA
WP_070373579.1|104283_105525_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083277842.1|105602_106433_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	38.3	1.3e-11
WP_070373580.1|106425_107304_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	27.0	6.0e-15
WP_070373581.1|107323_108370_-	dihydroorotase	NA	NA	NA	NA	NA
WP_070373582.1|108399_109476_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	37.2	1.1e-55
WP_070373583.1|109555_109768_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_070373584.1|109832_111530_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_070373585.1|112578_113733_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083278115.1|114136_114544_-	TonB family protein	NA	NA	NA	NA	NA
WP_070373587.1|114743_114983_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_070373588.1|114982_115276_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_070373589.1|115484_116003_-	gamma-glutamylcyclotransferase	NA	F2NYX8	Diadromus_pulchellus_ascovirus	29.7	3.9e-06
WP_070373590.1|116292_117165_-	hypothetical protein	NA	NA	NA	NA	NA
116469:116483	attR	CTTCAATACCACAAC	NA	NA	NA	NA
WP_070373591.1|117658_118960_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	40.6	2.4e-60
WP_070373592.1|118960_119902_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_157470703.1|120125_120725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070373594.1|121036_121591_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070373595.1|121974_123300_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_070373596.1|123599_124304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070373597.1|124349_125567_-|holin	choline transporter	holin	NA	NA	NA	NA
WP_070373598.1|125770_127411_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.5e-62
WP_070373599.1|127499_128963_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_070373600.1|128953_129559_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_070373601.1|130069_131176_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_070373602.1|131175_132207_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_070373603.1|132467_133694_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_070373604.1|133729_134506_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_070373605.1|134508_135780_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070373606.1|135785_136502_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070373607.1|136501_136963_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_070373608.1|137030_138410_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.8	1.3e-51
WP_070373609.1|138598_139558_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_070373610.1|139592_140279_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_070373611.1|140271_140889_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_070373612.1|140973_141543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070373613.1|142210_142441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070373614.1|142602_143499_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_070373615.1|143500_144058_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_083277843.1|144050_144611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070373616.1|144603_145098_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_070373617.1|145420_145786_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_070373618.1|146433_147225_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_070373619.1|147407_148784_-	insulinase family protein	NA	NA	NA	NA	NA
WP_070373620.1|148784_150119_-	insulinase family protein	NA	NA	NA	NA	NA
WP_070373621.1|150442_151402_-	DUF1186 domain-containing protein	NA	H9NBT7	Sphingomonas_phage	33.6	1.5e-06
WP_070376940.1|151553_155555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083277844.1|156250_159952_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_070373623.1|159981_161202_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.0	1.3e-15
WP_070373625.1|161713_162694_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP014944	Colwellia sp. PAMC 20917 chromosome, complete genome	4683314	540223	581303	4683314	integrase,protease,transposase	Hokovirus(33.33%)	28	568850:568866	583745:583761
WP_157471087.1|540223_541516_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_070373889.1|541614_541953_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	42.9	1.0e-15
WP_070373890.1|542017_542416_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_070373891.1|542468_544319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083277869.1|544310_545027_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_070373893.1|545026_546199_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_070373894.1|546358_547405_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.9	3.6e-75
WP_070376977.1|547424_548081_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	43.6	8.9e-32
WP_070373895.1|548108_548849_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_070373896.1|548845_549646_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_070373897.1|549803_552233_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_070373898.1|552458_553172_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070373899.1|553284_554652_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_070373900.1|555164_556601_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_070373901.1|557204_557771_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_070376978.1|557770_558580_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_083277871.1|558643_564547_-	response regulator	NA	A0A1V0SGX0	Hokovirus	35.5	3.4e-29
WP_083277872.1|564622_564874_-	response regulator	NA	NA	NA	NA	NA
WP_070373902.1|564864_565053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070373903.1|565088_568799_-	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	23.9	1.3e-13
WP_157470759.1|568788_569481_-	response regulator	NA	W8CYM9	Bacillus_phage	27.6	2.6e-05
568850:568866	attL	TTTAATAAGGTTTCTTT	NA	NA	NA	NA
WP_070373905.1|569676_571392_+	GGDEF domain-containing response regulator	NA	G3MA91	Bacillus_virus	34.7	2.3e-23
WP_070373906.1|571402_572455_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.6	6.1e-06
WP_070373907.1|572695_575512_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.2	5.5e-54
WP_070373909.1|575998_577207_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.3	4.2e-51
WP_070373910.1|577565_578579_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070373912.1|579605_580229_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	34.1	2.8e-11
WP_070373913.1|580403_581303_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.0	1.7e-25
583745:583761	attR	TTTAATAAGGTTTCTTT	NA	NA	NA	NA
>prophage 3
NZ_CP014944	Colwellia sp. PAMC 20917 chromosome, complete genome	4683314	1351766	1365043	4683314		uncultured_Mediterranean_phage(28.57%)	9	NA	NA
WP_070374494.1|1351766_1355465_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.5	1.3e-18
WP_070374495.1|1355524_1356472_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_070374496.1|1356921_1357959_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	3.0e-114
WP_070374497.1|1358296_1360876_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.0	8.4e-33
WP_070374498.1|1360938_1361862_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.5	8.4e-36
WP_070377022.1|1361945_1362803_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	31.0	2.6e-07
WP_070374499.1|1362835_1363414_-	DedA family protein	NA	NA	NA	NA	NA
WP_070374500.1|1363556_1364219_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.4	2.7e-36
WP_070374501.1|1364296_1365043_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	2.0e-67
>prophage 4
NZ_CP014944	Colwellia sp. PAMC 20917 chromosome, complete genome	4683314	1968117	2043897	4683314	integrase,protease,transposase,tRNA	Virus_Rctr41k(23.08%)	72	1980007:1980066	2002760:2002781
WP_070374960.1|1968117_1969230_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	40.9	8.8e-72
WP_070374961.1|1969336_1970539_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1D9C9R5	Salinivibrio_phage	25.1	4.6e-18
WP_070374962.1|1970657_1971047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070374963.1|1971171_1972392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374964.1|1972419_1972863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374965.1|1973586_1974354_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070374966.1|1974981_1975749_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_070374967.1|1975825_1976380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070374968.1|1977590_1978274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070374969.1|1978646_1979153_-	hypothetical protein	NA	NA	NA	NA	NA
1979442:1979463	attL	TAAAATAAGCGACGAAGGAGCA	NA	NA	NA	NA
WP_157470913.1|1979503_1980058_-	hypothetical protein	NA	NA	NA	NA	NA
1980007:1980066	attL	CTTGTTGAACGAAGCCGCTCTGCGGCAGAGTAGCTTTGTAACTACCTTCCATACTCAATA	NA	NA	NA	NA
WP_070374971.1|1980109_1980997_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.7	1.8e-19
WP_070374972.1|1980993_1982052_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157470916.1|1982320_1982860_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_070374974.1|1982962_1983199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374975.1|1983313_1984468_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070374976.1|1984866_1985121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374975.1|1985250_1986405_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070374971.1|1986901_1987789_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.7	1.8e-19
1986799:1986900	attR	CTTGTTGAACGAAGCCGCTCTGCGGCAGAGTAGCTTTGTAACTACCTTCCATACTCAATAATAGCATTGTCACTTCGATGATGCGTTATTGGAGTATAACCC	NA	NA	NA	NA
WP_070374972.1|1987785_1988844_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1986799:1986900	attR	CTTGTTGAACGAAGCCGCTCTGCGGCAGAGTAGCTTTGTAACTACCTTCCATACTCAATAATAGCATTGTCACTTCGATGATGCGTTATTGGAGTATAACCC	NA	NA	NA	NA
WP_070373630.1|1989518_1990673_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070374971.1|1991168_1992056_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.7	1.8e-19
WP_070374972.1|1992052_1993111_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157470918.1|1993367_1993910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374979.1|1994202_1995336_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_070374980.1|1995332_1996184_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	29.5	6.0e-12
WP_070374981.1|1996891_1998646_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	38.6	6.7e-74
WP_070374982.1|1998638_1998938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374983.1|1998930_1999176_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_070374984.1|1999273_2000185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083277950.1|2000442_2001153_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070374986.1|2001415_2002561_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	28.3	2.9e-25
WP_070374987.1|2002828_2003158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374988.1|2003302_2003656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374989.1|2004468_2004831_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_070377074.1|2005009_2005801_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070374990.1|2006200_2007421_-	alkaline phosphatase family protein	NA	A0A0M3PB47	Turkeypox_virus	31.8	2.2e-52
WP_070374991.1|2007730_2008009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157470921.1|2008099_2008255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157470923.1|2008579_2008729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070374992.1|2009144_2009582_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_070374993.1|2009743_2012095_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_070374994.1|2012094_2012610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070374995.1|2012685_2013150_+	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_070374996.1|2013360_2014539_-	alanine racemase	NA	NA	NA	NA	NA
WP_070374997.1|2014538_2015957_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	71.5	1.1e-178
WP_083277951.1|2016095_2017046_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_070374998.1|2017070_2017607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083278149.1|2017603_2018140_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_070374999.1|2018381_2018594_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_070375000.1|2018849_2021066_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_070375001.1|2021169_2021724_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_070375002.1|2021856_2022375_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_070375003.1|2022436_2023765_+	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.2	1.1e-44
WP_070375004.1|2023824_2024190_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_070375005.1|2024315_2026175_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	3.5e-33
WP_070375006.1|2026282_2028283_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_070375007.1|2028531_2029017_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_083277952.1|2029068_2031168_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_070375009.1|2031408_2032641_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_070375010.1|2032877_2033600_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_070375011.1|2033643_2035347_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_157471107.1|2035444_2036980_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.4	3.5e-87
WP_083277953.1|2037619_2038093_+	NfeD family protein	NA	NA	NA	NA	NA
WP_070375014.1|2038137_2039055_+	paraslipin	NA	NA	NA	NA	NA
WP_070375015.1|2039054_2039999_+	paraslipin	NA	NA	NA	NA	NA
WP_070375016.1|2040089_2040395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070375017.1|2040396_2041230_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_083278151.1|2041247_2041733_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_070375018.1|2041755_2042646_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070375019.1|2042696_2043449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375020.1|2043459_2043897_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP014944	Colwellia sp. PAMC 20917 chromosome, complete genome	4683314	2918137	2982135	4683314	integrase,transposase	Bacillus_phage(28.57%)	48	2953392:2953407	2992174:2992189
WP_070375678.1|2918137_2919337_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_070374361.1|2921021_2921486_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_070377146.1|2921617_2922022_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_070373900.1|2922413_2923850_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_157470978.1|2924115_2924532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083278003.1|2924982_2925429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083278004.1|2925398_2926646_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_070375682.1|2926731_2928225_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_070373500.1|2928217_2928985_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.6	1.0e-34
WP_070375683.1|2929044_2929845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157470980.1|2929838_2930783_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_070375684.1|2930792_2932067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375686.1|2933777_2934797_-	hypothetical protein	NA	H7BVE9	unidentified_phage	20.9	2.0e-06
WP_157470982.1|2935687_2935840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375687.1|2936527_2938240_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_070375688.1|2938249_2938759_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_070375689.1|2938980_2939622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375690.1|2940672_2941200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070377148.1|2941459_2941942_+	CIA30 family protein	NA	NA	NA	NA	NA
WP_070375691.1|2941961_2942177_+	TIGR02450 family Trp-rich protein	NA	NA	NA	NA	NA
WP_083278005.1|2942261_2943134_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070375692.1|2943228_2943729_+	lactoylglutathione lyase family protein	NA	NA	NA	NA	NA
WP_070377150.1|2944033_2945275_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.8	3.2e-22
WP_070375693.1|2945307_2945661_-	DUF3802 family protein	NA	NA	NA	NA	NA
WP_070375694.1|2946557_2949551_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_070375695.1|2950307_2953160_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.6	6.4e-42
WP_070375696.1|2953260_2954901_+	sulfotransferase family protein	NA	NA	NA	NA	NA
2953392:2953407	attL	TAAACTTGGATTTATT	NA	NA	NA	NA
WP_070375697.1|2955051_2955870_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_070375698.1|2956074_2957544_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_070375699.1|2957669_2958686_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_070375700.1|2958791_2960006_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.6	5.3e-22
WP_070375701.1|2960341_2961487_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_070375702.1|2961602_2962187_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.4	2.7e-64
WP_070375703.1|2962382_2963618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070375704.1|2964118_2965297_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_070375705.1|2965464_2966856_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_070375706.1|2966858_2967476_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_070375707.1|2967447_2967657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070375708.1|2967752_2968556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375709.1|2968687_2969230_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_070375710.1|2970230_2970770_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_070375711.1|2971453_2973148_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	5.2e-23
WP_070375713.1|2975158_2976667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375714.1|2977088_2978051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375715.1|2978152_2978947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070375716.1|2979447_2980122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375717.1|2980144_2980324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070375718.1|2980311_2982135_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2992174:2992189	attR	TAAACTTGGATTTATT	NA	NA	NA	NA
>prophage 6
NZ_CP014944	Colwellia sp. PAMC 20917 chromosome, complete genome	4683314	4210817	4312478	4683314	integrase,protease,transposase,tRNA	Leptospira_phage(15.38%)	77	4231923:4231939	4272425:4272440
WP_083278085.1|4210817_4211213_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	43.2	3.4e-26
WP_070376595.1|4211250_4212477_+|transposase	transposase	transposase	A0A191SB13	Nostoc_phage	26.8	2.5e-19
WP_070376596.1|4212574_4212814_+	EamA family transporter	NA	NA	NA	NA	NA
WP_070376597.1|4212880_4213372_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_070376598.1|4213461_4214193_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_070376599.1|4214192_4214609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070376600.1|4214626_4216753_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_070377247.1|4216880_4218998_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	23.7	1.5e-24
WP_070376601.1|4219103_4220201_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_070376602.1|4220252_4220849_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.9	3.2e-28
WP_070376603.1|4220936_4221845_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-25
WP_070376604.1|4223677_4225252_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_070376605.1|4225253_4225892_-	arylesterase	NA	NA	NA	NA	NA
WP_070376606.1|4225890_4226625_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	2.5e-30
WP_070376607.1|4226627_4229201_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_070377248.1|4229306_4230356_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_070376608.1|4230384_4230858_-	DUF2947 domain-containing protein	NA	NA	NA	NA	NA
WP_070376609.1|4231237_4232704_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.4	4.8e-17
4231923:4231939	attL	ATAGAACCAAAGAAGAA	NA	NA	NA	NA
WP_157471040.1|4232708_4233215_+	hypothetical protein	NA	NA	NA	NA	NA
4231923:4231939	attL	ATAGAACCAAAGAAGAA	NA	NA	NA	NA
WP_070376611.1|4233346_4233994_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_070376612.1|4234196_4234970_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_070376613.1|4235395_4236583_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_070376614.1|4237162_4238359_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_070376615.1|4238366_4239266_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.1	2.9e-25
WP_070376616.1|4239682_4240108_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_070376617.1|4240352_4241243_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070376618.1|4241368_4242355_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_157471042.1|4242450_4243440_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_070376619.1|4243466_4244270_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070376620.1|4244724_4245348_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	31.0	7.7e-09
WP_070376621.1|4246526_4246994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083278086.1|4247009_4247678_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_083278211.1|4247847_4248618_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	31.1	1.7e-18
4247772:4247788	attR	ATAGAACCAAAGAAGAA	NA	NA	NA	NA
WP_070376624.1|4248787_4249255_-	hypothetical protein	NA	NA	NA	NA	NA
4247772:4247788	attR	ATAGAACCAAAGAAGAA	NA	NA	NA	NA
WP_070376625.1|4249247_4250036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070376626.1|4250028_4251648_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_070376627.1|4251825_4252101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157471044.1|4252538_4253420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376629.1|4253797_4253995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070377250.1|4254160_4256776_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_070376630.1|4256980_4257505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083278087.1|4257501_4258071_-	DUF882 domain-containing protein	NA	NA	NA	NA	NA
WP_070376632.1|4258281_4258653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070376633.1|4258813_4259530_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_070376635.1|4260070_4263877_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_070376636.1|4263873_4264065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157471046.1|4264133_4264598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070376638.1|4265339_4266299_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	37.9	7.1e-54
WP_070374980.1|4266724_4267576_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	29.5	6.0e-12
WP_070374979.1|4267572_4268706_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_070376639.1|4268995_4269496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070373630.1|4269894_4271049_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070376640.1|4271148_4271466_-	CcdB family protein	NA	NA	NA	NA	NA
WP_070376641.1|4271465_4271711_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_070376642.1|4271882_4272248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376643.1|4272375_4272861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376644.1|4272985_4273450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157471048.1|4273920_4274496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376646.1|4276546_4277056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376647.1|4277182_4277560_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070376648.1|4277624_4278014_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_070376649.1|4278001_4278217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376650.1|4278389_4279172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376651.1|4279936_4280209_+	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_070376652.1|4280522_4281149_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_070376653.1|4282020_4282449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376655.1|4284691_4299595_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_070376656.1|4299628_4300171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376657.1|4300859_4301951_-	acyltransferase	NA	NA	NA	NA	NA
WP_157471050.1|4301986_4302151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083278088.1|4303055_4303298_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	49.3	4.5e-13
WP_070376658.1|4303832_4307108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083278089.1|4307225_4307354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070376659.1|4307708_4309343_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_070376660.1|4309430_4310321_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_070376661.1|4310689_4311187_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_070376662.1|4311398_4312478_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
