The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	1066931	1125976	9673108	bacteriocin,transposase	Clostridium_botulinum_C_phage(18.18%)	46	NA	NA
WP_070396485.1|1066931_1068029_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	45.8	2.4e-82
WP_158516998.1|1068781_1069309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391263.1|1070031_1070805_-	ABC transporter	NA	NA	NA	NA	NA
WP_070391264.1|1070812_1071721_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	5.2e-22
WP_070391265.1|1071923_1073840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391266.1|1073858_1074587_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_158516999.1|1075046_1075196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391267.1|1075594_1075816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391268.1|1076588_1078058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149030783.1|1078302_1080438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391270.1|1081689_1082205_-	DUF29 family protein	NA	NA	NA	NA	NA
WP_070391271.1|1082326_1082689_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_070391272.1|1082688_1083042_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_070391273.1|1083805_1085185_+	IS200/IS605 family accessory protein TnpB-related protein	NA	A0A1L2BWW3	Bacteriophage	44.8	1.0e-85
WP_083305543.1|1085247_1085544_+	XisI protein	NA	NA	NA	NA	NA
WP_158517000.1|1085574_1085727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391274.1|1085952_1087227_-	glycosyltransferase family 1 protein	NA	G1DTN4	Bell_pepper_alphaendornavirus	25.1	3.9e-15
WP_070391275.1|1087556_1089278_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.0	1.1e-49
WP_070391276.1|1089255_1090629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517001.1|1090688_1090853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391277.1|1090893_1092615_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_070391278.1|1092637_1093591_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_070391279.1|1093622_1094627_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_158517002.1|1094801_1095878_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_070391281.1|1096115_1096508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517003.1|1096700_1097576_-	CinA family protein	NA	A0A1V0SHK4	Klosneuvirus	33.3	3.3e-13
WP_070391283.1|1098023_1098272_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_070391284.1|1098768_1099953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391285.1|1099921_1103428_-	virulence factor SrfB	NA	NA	NA	NA	NA
WP_070391286.1|1103385_1105980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391287.1|1106080_1106707_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_070391288.1|1107908_1108343_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070391289.1|1108569_1110039_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_158517004.1|1110402_1110579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391290.1|1110916_1111636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391291.1|1111756_1112386_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	42.0	1.8e-37
WP_070391292.1|1112372_1113464_+|transposase	transposase	transposase	A0A1V0CNK0	Kaumoebavirus	32.3	2.4e-37
WP_070391293.1|1114024_1115710_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	40.6	1.1e-97
WP_070391294.1|1115830_1119289_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.7	1.2e-103
WP_070391295.1|1119806_1120703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149030785.1|1120847_1122380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158517005.1|1122549_1122708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391297.1|1122799_1123009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391298.1|1123124_1123712_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	42.7	1.2e-35
WP_083304996.1|1124229_1124448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391300.1|1125766_1125976_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	1311769	1402035	9673108	protease,transposase	Clostridium_botulinum_C_phage(14.29%)	59	NA	NA
WP_070391409.1|1311769_1312399_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	41.6	1.8e-37
WP_168166546.1|1312791_1313415_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	52.2	7.4e-52
WP_083305007.1|1313598_1314915_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_070391411.1|1314983_1316306_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070396494.1|1317660_1318020_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_070391412.1|1318221_1319481_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_070391413.1|1319483_1321301_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070391414.1|1321986_1322220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391416.1|1322826_1323294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149030806.1|1323817_1325014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517017.1|1324985_1325198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391418.1|1325228_1325522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391419.1|1325568_1326072_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_070391420.1|1328441_1332434_+	magnesium chelatase subunit H	NA	NA	NA	NA	NA
WP_070391421.1|1333064_1333319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149030807.1|1333315_1333606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391423.1|1334359_1335229_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_070391424.1|1335559_1336408_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_070391425.1|1337063_1337936_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_158517018.1|1337994_1338213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517019.1|1338481_1338643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391426.1|1338639_1339212_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_149030808.1|1339258_1339465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391427.1|1339708_1341544_+	aspartate kinase	NA	NA	NA	NA	NA
WP_070391428.1|1341855_1342449_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_070391429.1|1342464_1343103_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_070391430.1|1343880_1344177_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_149030809.1|1344173_1344428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391431.1|1344748_1345135_+	DUF4359 domain-containing protein	NA	NA	NA	NA	NA
WP_070391432.1|1345148_1346018_+	sugar kinase	NA	NA	NA	NA	NA
WP_070391433.1|1346104_1347154_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_070391434.1|1347201_1348104_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_070391435.1|1348120_1348942_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_070396496.1|1349235_1349664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391436.1|1349775_1350066_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_158517020.1|1350086_1350242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391437.1|1350314_1350932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083305009.1|1352515_1360297_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	34.3	2.4e-38
WP_083305010.1|1360293_1368138_+	type I polyketide synthase	NA	NA	NA	NA	NA
WP_070391439.1|1368141_1378563_+	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	23.5	1.6e-50
WP_149030810.1|1378842_1379028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305011.1|1379127_1380459_+	lipase family protein	NA	NA	NA	NA	NA
WP_070391441.1|1380740_1381622_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_149030811.1|1381618_1381804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391442.1|1382260_1382992_-	FkbM family methyltransferase	NA	E4WLN6	Ostreococcus_tauri_virus	32.8	1.1e-11
WP_083305012.1|1382996_1385108_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_158517021.1|1385140_1385281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391443.1|1385352_1386195_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_149030812.1|1386382_1388482_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_070391444.1|1388711_1392971_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070391445.1|1393406_1393859_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_070391446.1|1394060_1394975_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	29.4	1.2e-21
WP_149030814.1|1394984_1395188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391448.1|1396326_1397538_+|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	61.8	9.7e-141
WP_070391451.1|1398428_1399259_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_070391452.1|1399456_1400230_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_158517022.1|1400778_1400931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391453.1|1400877_1401648_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_070391454.1|1401753_1402035_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
>prophage 3
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	1958659	2033705	9673108	protease,tRNA,transposase	Catovirus(18.18%)	57	NA	NA
WP_070391809.1|1958659_1960030_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_070391810.1|1960206_1960986_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_149030851.1|1966482_1966701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075900737.1|1967294_1968173_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_070391811.1|1968231_1969203_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A249XZT7	Enterococcus_phage	27.5	5.8e-11
WP_070391812.1|1969427_1970081_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_070391813.1|1970206_1971082_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070391814.1|1971146_1971755_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_070391815.1|1971973_1972552_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070391816.1|1972713_1973316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391817.1|1973588_1973927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391818.1|1974268_1974583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149030852.1|1974855_1975098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517075.1|1975114_1975261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391819.1|1975245_1976964_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_070391821.1|1977172_1977490_-	urease subunit beta	NA	NA	NA	NA	NA
WP_070391822.1|1978194_1978482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008179425.1|1978534_1978837_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_070391823.1|1978870_1979863_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_070390905.1|1981346_1983038_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.3	1.1e-94
WP_070391825.1|1983921_1984320_+|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	57.9	3.7e-41
WP_070391826.1|1984509_1986081_-	OmpA family protein	NA	NA	NA	NA	NA
WP_168166465.1|1986114_1986330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391828.1|1986649_1987135_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070391829.1|1987637_1987946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391830.1|1988503_1989538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391831.1|1990438_1992826_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	23.3	1.2e-12
WP_070391832.1|1992837_1999569_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	37.5	6.6e-37
WP_149030853.1|1999654_2000674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517076.1|2000877_2001354_-	VOC family protein	NA	NA	NA	NA	NA
WP_070391835.1|2002041_2003559_-	response regulator	NA	W8CYM9	Bacillus_phage	37.7	9.3e-16
WP_070396538.1|2003600_2004851_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	41.0	8.1e-66
WP_158517077.1|2004923_2005079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391836.1|2006108_2007083_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_143727664.1|2007444_2007720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193431314.1|2007719_2008445_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_070391838.1|2008569_2009292_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	54.5	8.9e-49
WP_081431101.1|2009914_2010112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517078.1|2010731_2010902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391839.1|2011058_2011289_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070391840.1|2011535_2012729_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_070391841.1|2013099_2014161_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_083305043.1|2014299_2014809_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_083305563.1|2015611_2016784_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_158517079.1|2017093_2017318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391846.1|2017896_2019201_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_070391847.1|2019448_2020339_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_070391848.1|2020629_2021724_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.6	1.8e-08
WP_070391849.1|2021720_2022968_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_070391850.1|2023567_2025040_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_070391851.1|2025212_2026889_-	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_158517080.1|2029908_2030076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193431338.1|2030262_2030880_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_070391853.1|2030876_2031212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517081.1|2031493_2031931_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_070391855.1|2032000_2033185_-|transposase	transposase	transposase	A0A1V0SAM8	Catovirus	25.7	3.4e-21
WP_070391856.1|2033105_2033705_-|transposase	IS607 family transposase	transposase	Q331Z3	Clostridium_botulinum_C_phage	39.2	2.8e-32
>prophage 4
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	2174518	2219816	9673108	tail,plate,transposase	Streptomyces_phage(20.0%)	53	NA	NA
WP_070391951.1|2174518_2175661_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_070391952.1|2177049_2177355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149030865.1|2177372_2177576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391953.1|2177510_2177966_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_070391954.1|2178307_2178817_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_070391955.1|2179867_2180770_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_158517088.1|2180871_2181231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391956.1|2181370_2181853_-	polyketide cyclase/dehydrase and lipid transport protein	NA	NA	NA	NA	NA
WP_070391957.1|2182119_2183154_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_070396558.1|2183610_2183979_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_070391958.1|2184099_2184894_+	photosystem II biogenesis protein Psp29	NA	NA	NA	NA	NA
WP_070391959.1|2185093_2185411_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.3	1.5e-16
WP_070391960.1|2185563_2186340_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	2.1e-19
WP_070396559.1|2186460_2188131_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	55.3	1.9e-155
WP_070391961.1|2188358_2188973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391962.1|2189002_2190115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391963.1|2190646_2192716_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	28.7	1.8e-57
WP_070396560.1|2192946_2193552_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_075905897.1|2193937_2194126_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_070391965.1|2194112_2194331_+	type II toxin-antitoxin system HicB family antitoxin	NA	G9BWD3	Planktothrix_phage	45.7	8.6e-08
WP_070391966.1|2194331_2194697_-	XisI protein	NA	NA	NA	NA	NA
WP_070391967.1|2194798_2195149_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_070391968.1|2195132_2195420_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_070391969.1|2195539_2195842_-	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	42.9	1.4e-11
WP_070391970.1|2196027_2196405_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_070391971.1|2196394_2196619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391973.1|2197341_2197575_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_158517089.1|2197590_2197737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391974.1|2197842_2198211_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_070391975.1|2198207_2198438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396561.1|2198491_2198845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149030866.1|2198925_2199366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391977.1|2199446_2199794_-	XisI protein	NA	NA	NA	NA	NA
WP_070391979.1|2199969_2200311_-	XisI protein	NA	NA	NA	NA	NA
WP_070391980.1|2200402_2200612_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_070396562.1|2200611_2200809_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	52.5	4.1e-09
WP_149030867.1|2201600_2201933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305058.1|2202003_2202492_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158517090.1|2202688_2202841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396563.1|2203130_2204003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070391982.1|2204370_2205243_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_070391983.1|2205271_2206480_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	35.2	7.9e-42
WP_070391984.1|2206678_2207104_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070396564.1|2207140_2207506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305059.1|2207499_2207679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149030868.1|2207958_2211225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070391986.1|2211215_2211899_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070391987.1|2212152_2213226_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_070391988.1|2213222_2213870_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070391989.1|2213882_2214278_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_070391990.1|2214444_2214837_+	GPW/gp25 family protein	NA	Q5GQU1	Synechococcus_phage	34.3	8.8e-11
WP_070391991.1|2214836_2218790_+|plate	putative baseplate assembly protein	plate	A0A1J0GW37	Streptomyces_phage	29.8	5.3e-10
WP_070391992.1|2218802_2219816_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
>prophage 5
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	3401824	3477111	9673108	protease,bacteriocin,transposase	Pseudomonas_phage(20.0%)	57	NA	NA
WP_149030948.1|3401824_3402654_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070392680.1|3402736_3402916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070392681.1|3403694_3405449_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_070395357.1|3405454_3406597_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_158517171.1|3406670_3407237_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_158517172.1|3407858_3408008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305138.1|3407982_3409149_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_070390905.1|3409684_3411376_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.3	1.1e-94
WP_070392685.1|3411388_3413644_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070392686.1|3413805_3418035_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070392687.1|3418196_3421358_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070392688.1|3421423_3422224_-	DUF928 domain-containing protein	NA	NA	NA	NA	NA
WP_070392689.1|3422519_3424877_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_070392691.1|3425357_3426272_-	DUF1822 family protein	NA	NA	NA	NA	NA
WP_158517173.1|3426297_3426444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070392692.1|3426521_3427187_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_070392694.1|3427624_3427810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149030949.1|3427834_3428029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392695.1|3428071_3429064_+	ATPase	NA	NA	NA	NA	NA
WP_070392697.1|3430480_3430702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517174.1|3430809_3430980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517175.1|3431029_3431170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392698.1|3431447_3432275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070392699.1|3432720_3433320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070392701.1|3433639_3434476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517176.1|3434907_3435051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392702.1|3435083_3435536_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_070392704.1|3436105_3438307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149030951.1|3439149_3439710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392706.1|3439706_3439943_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_149031407.1|3440045_3442982_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.4	6.8e-71
WP_008178810.1|3443961_3444138_+	NblA/ycf18 family protein	NA	NA	NA	NA	NA
WP_070392709.1|3444491_3445370_+	universal stress protein	NA	NA	NA	NA	NA
WP_070392710.1|3445451_3446693_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_070392711.1|3446836_3447823_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_083305141.1|3448000_3448693_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_070392714.1|3449128_3451354_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.3	4.4e-30
WP_070392715.1|3451426_3453040_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
WP_158517177.1|3453280_3453436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392716.1|3453447_3454269_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070392717.1|3454408_3454813_-|transposase	IS200/IS605 family transposase	transposase	A0A1L2BWN1	Bacteriophage	48.4	1.1e-29
WP_070392718.1|3456219_3456675_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_070392719.1|3457647_3459267_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_070392720.1|3459446_3460940_-	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_070392721.1|3461163_3461439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392722.1|3461516_3462878_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_070392723.1|3462823_3465796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149030952.1|3468184_3468439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517178.1|3468443_3469934_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158517179.1|3470408_3470555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392728.1|3470598_3470862_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_070392729.1|3471437_3472847_+	cytochrome P450	NA	I6XNL0	Cotesia_sesamiae_Mombasa_bracovirus	24.3	1.3e-08
WP_070392730.1|3473174_3473783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517180.1|3473799_3473976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517181.1|3474017_3474209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070392731.1|3474210_3475404_-	DNA double-strand break repair nuclease NurA	NA	NA	NA	NA	NA
WP_070392732.1|3475680_3477111_+|protease	NF038122 family metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	4522673	4542107	9673108	transposase,plate,tail	Bacillus_phage(50.0%)	14	NA	NA
WP_070393331.1|4522673_4527197_+|tail	tail fiber domain-containing protein	tail	A0A2H4N7U4	Lake_Baikal_phage	51.2	1.5e-13
WP_070393332.1|4527535_4527769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168166513.1|4527787_4527934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517669.1|4528524_4530447_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	J9PVC2	Bacillus_phage	27.7	5.5e-37
WP_070393334.1|4530704_4532303_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	27.8	8.2e-47
WP_070393335.1|4532313_4532838_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070393336.1|4533119_4533854_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_070393337.1|4533853_4535608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393338.1|4535604_4536891_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_083305620.1|4537166_4539143_+	ATP-binding protein	NA	K9MCS8	Sulfolobus_virus	34.5	3.8e-09
WP_070393339.1|4539155_4539413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305621.1|4539608_4540754_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_070393341.1|4540931_4541111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393342.1|4541147_4542107_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	5005981	5079053	9673108	protease,transposase	uncultured_virus(14.29%)	56	NA	NA
WP_070390947.1|5005981_5006401_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	42.4	3.8e-20
WP_070390948.1|5006453_5007800_+	IS200/IS605 family accessory protein TnpB-related protein	NA	NA	NA	NA	NA
WP_070393594.1|5008106_5012228_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_193431350.1|5012626_5013391_-	ATP-sensitive inward rectifier potassium channel 10	NA	NA	NA	NA	NA
WP_149031044.1|5013800_5014328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031045.1|5014586_5014805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070393597.1|5014810_5015566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396749.1|5015881_5016628_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_070393598.1|5016759_5018187_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_070393599.1|5018805_5020170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070393600.1|5020166_5021096_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_070393601.1|5021083_5022448_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_070396750.1|5022552_5022864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070393602.1|5022935_5023247_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_158517294.1|5023318_5023477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070393603.1|5023637_5023838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393604.1|5024147_5024696_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_070393605.1|5025156_5026272_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_070393606.1|5026255_5027356_+	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_070393607.1|5027606_5028113_+	DUF3172 domain-containing protein	NA	NA	NA	NA	NA
WP_168166515.1|5028234_5028402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070393608.1|5028464_5029817_+|transposase	transposase	transposase	A0A0R8V9X2	Thermobifida_phage	31.8	1.8e-26
WP_168166474.1|5029823_5029991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393609.1|5029987_5032036_-|protease	PatA/PatG family cyanobactin maturation protease	protease	A0A2K9L1P3	Tupanvirus	30.6	5.9e-13
WP_158517295.1|5032538_5032721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393610.1|5032799_5034248_-	SagB family peptide dehydrogenase	NA	NA	NA	NA	NA
WP_070393611.1|5034479_5035043_+	3'-5' exoribonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	40.2	5.1e-36
WP_158517296.1|5039563_5039716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393612.1|5039863_5040502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393613.1|5040574_5041180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393614.1|5041944_5043096_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_158517297.1|5043356_5043515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305244.1|5043511_5046442_-	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	28.5	1.4e-81
WP_070396752.1|5046862_5048632_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_158517298.1|5049610_5049781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393615.1|5049830_5051012_-	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
WP_070393616.1|5052465_5054853_-	DUF4101 domain-containing protein	NA	NA	NA	NA	NA
WP_070393617.1|5055249_5056278_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_070393618.1|5056313_5057558_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_070396753.1|5057557_5058529_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_070393619.1|5058837_5060469_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.8	1.2e-154
WP_008180318.1|5060570_5060882_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	50.0	1.7e-17
WP_149031046.1|5061252_5061786_+	ferredoxin	NA	NA	NA	NA	NA
WP_070393620.1|5062034_5062682_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.9	1.0e-19
WP_070393621.1|5062755_5064036_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	2.5e-30
WP_070393622.1|5064060_5065296_-	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	32.8	4.7e-26
WP_070393623.1|5066060_5067146_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	59.0	4.5e-105
WP_070393624.1|5067404_5068037_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_070393625.1|5068253_5068553_-	DUF3493 domain-containing protein	NA	NA	NA	NA	NA
WP_075900681.1|5069142_5069259_+	photosystem II reaction center protein I	NA	NA	NA	NA	NA
WP_070393626.1|5069797_5072713_+	DUF3769 domain-containing protein	NA	NA	NA	NA	NA
WP_070393627.1|5072849_5074910_+	AAA-like domain-containing protein	NA	A0A285PX80	Cedratvirus	24.9	2.2e-12
WP_070393630.1|5076333_5076561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070393631.1|5076644_5077205_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_070393043.1|5077247_5077895_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	44.3	2.0e-44
WP_083305249.1|5077919_5079053_+|transposase	transposase	transposase	A0A7P9	Microcystis_virus	37.2	2.0e-55
>prophage 8
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	5859566	5905844	9673108	transposase	Saccharomonospora_phage(20.0%)	34	NA	NA
WP_149031102.1|5859566_5859926_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	57.6	7.8e-38
WP_149031103.1|5860050_5861244_+|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	56.8	1.3e-124
WP_070394104.1|5861246_5863211_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070394105.1|5863463_5864798_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_070391293.1|5866933_5868619_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	40.6	1.1e-97
WP_070396810.1|5869179_5870247_-|transposase	transposase	transposase	A0A2K9L5M7	Tupanvirus	35.0	1.6e-25
WP_083305291.1|5870233_5870863_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	39.6	1.6e-33
WP_070394106.1|5870972_5871362_+	RidA family protein	NA	NA	NA	NA	NA
WP_158517370.1|5872761_5874192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394108.1|5874196_5876290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394109.1|5876383_5877550_-	catalase	NA	NA	NA	NA	NA
WP_070394110.1|5877752_5879321_-	heme peroxidase	NA	A0A1L6Z288	Macacine_betaherpesvirus	28.9	5.8e-53
WP_149031441.1|5879437_5881201_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070394111.1|5882129_5883497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394112.1|5883701_5884742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517371.1|5884989_5885127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394113.1|5885148_5885439_+	DUF2499 domain-containing protein	NA	NA	NA	NA	NA
WP_070394114.1|5885684_5885993_+	DUF3593 domain-containing protein	NA	NA	NA	NA	NA
WP_070394115.1|5886101_5887337_+	serine/threonine protein kinase	NA	Q0N495	Clanis_bilineata_nucleopolyhedrovirus	24.9	7.6e-08
WP_070394116.1|5888512_5889865_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	33.5	7.7e-46
WP_070396811.1|5890215_5890500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394118.1|5891160_5892951_+	fibronectin-binding domain-containing protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	38.5	1.2e-09
WP_070394119.1|5892964_5894140_-|transposase	transposase	transposase	A0A142F1Q5	Bacillus_phage	33.2	2.0e-21
WP_158517372.1|5894150_5894309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193431272.1|5894729_5895392_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_070394121.1|5895583_5896225_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_070394122.1|5896797_5897574_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_070394123.1|5897720_5898359_+	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_070394124.1|5898544_5899030_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_070394125.1|5899174_5899732_-	elongation factor P	NA	NA	NA	NA	NA
WP_149031104.1|5899861_5900110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394126.1|5900278_5901430_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_070394127.1|5901555_5902794_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_070394128.1|5905004_5905844_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	6262764	6329344	9673108	protease,bacteriocin,transposase	Bacillus_phage(16.67%)	58	NA	NA
WP_070394328.1|6262764_6264111_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	8.5e-138
WP_070394329.1|6264227_6265067_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	24.3	1.3e-06
WP_070394330.1|6265571_6266684_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070394331.1|6266957_6267314_+	iron-sulfur cluster assembly accessory protein	NA	A0A0P0CQC4	Ostreococcus_lucimarinus_virus	36.0	2.0e-14
WP_075902074.1|6267537_6268407_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_070394332.1|6268491_6268785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394333.1|6268846_6269494_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_070394334.1|6269616_6270711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394335.1|6271231_6272470_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_149031123.1|6272694_6272820_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_149031124.1|6272856_6273201_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_070394336.1|6273271_6274294_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_070390948.1|6276906_6278253_-	IS200/IS605 family accessory protein TnpB-related protein	NA	NA	NA	NA	NA
WP_070390947.1|6278305_6278725_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	42.4	3.8e-20
WP_193431275.1|6279524_6280760_+	geranylgeranyl reductase	NA	NA	NA	NA	NA
WP_070394338.1|6280895_6281633_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.1	2.8e-42
WP_070394339.1|6281965_6282787_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_070394340.1|6282863_6284099_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_070396837.1|6284176_6285442_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070396838.1|6285697_6287365_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_158517396.1|6287528_6287684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305310.1|6287699_6288320_+	DUF4340 domain-containing protein	NA	NA	NA	NA	NA
WP_070394341.1|6288707_6289505_+	paraslipin	NA	A0A2K9KZA2	Tupanvirus	28.2	2.9e-24
WP_070394342.1|6289796_6290642_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.0	3.1e-21
WP_070394343.1|6290784_6291510_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_070394344.1|6291769_6293920_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_168166482.1|6293947_6294136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193431276.1|6294687_6294852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394345.1|6294946_6298216_+	DEAD/DEAH box helicase	NA	D4P754	Rhodococcus_phage	28.4	5.1e-35
WP_070394346.1|6298933_6299254_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_070394347.1|6299303_6301022_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070394348.1|6301134_6302463_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_070394349.1|6302910_6303108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394350.1|6303539_6303992_+	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_070394351.1|6304133_6304559_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_158517397.1|6304839_6305016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394353.1|6305143_6305365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517398.1|6307643_6307781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305313.1|6307770_6309228_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
WP_149031126.1|6309893_6310079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517399.1|6310332_6310497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394355.1|6310845_6311199_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_070394356.1|6311173_6311545_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_070394357.1|6311870_6314000_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	27.6	8.8e-28
WP_070394358.1|6314988_6316470_+	pre-peptidase C-terminal domain-containing protein	NA	F5B3R2	Synechococcus_phage	41.8	8.1e-65
WP_070394359.1|6316924_6318406_+	hypothetical protein	NA	F5B3R2	Synechococcus_phage	41.7	7.6e-71
WP_070394360.1|6319061_6320366_+	insulinase family protein	NA	A0A2K9L1M6	Tupanvirus	25.4	6.1e-32
WP_070396841.1|6320803_6321688_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_193431277.1|6321935_6322280_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_070394361.1|6322475_6323246_-	sporulation protein	NA	NA	NA	NA	NA
WP_070394362.1|6323461_6323905_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_070394363.1|6323904_6324162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394364.1|6324299_6325574_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_158517400.1|6326000_6326222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517401.1|6326347_6326518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394365.1|6326487_6328701_-|protease	PatA/PatG family cyanobactin maturation protease	protease	NA	NA	NA	NA
WP_168166483.1|6328741_6328927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031446.1|6329083_6329344_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	6457234	6497989	9673108	protease,bacteriocin,transposase	Orpheovirus(25.0%)	40	NA	NA
WP_070394435.1|6457234_6457834_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_158517417.1|6457930_6458164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394436.1|6458171_6458786_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_158517418.1|6458938_6459082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394437.1|6459093_6459957_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_158517419.1|6460111_6460318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394439.1|6460256_6460838_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1B1IXQ7	Citrobacter_phage	37.0	1.5e-06
WP_083305321.1|6460878_6461253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394441.1|6461346_6463686_+|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	36.9	8.4e-24
WP_158517420.1|6464496_6464658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031139.1|6465043_6465307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394444.1|6465866_6466055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394448.1|6469804_6470404_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_149031140.1|6470652_6470829_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070394449.1|6470805_6471153_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	43.4	7.6e-14
WP_070394450.1|6471418_6472075_-	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_070394451.1|6472179_6472761_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070394452.1|6472913_6473774_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_070394453.1|6474238_6474907_+|protease	ATP-dependent Zn protease	protease	NA	NA	NA	NA
WP_070394454.1|6475039_6475648_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_070394455.1|6475771_6476359_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070394456.1|6476640_6478557_-	protein kinase	NA	A0A2I2L395	Orpheovirus	24.4	1.5e-10
WP_070394457.1|6478709_6481355_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.9	2.7e-95
WP_070394458.1|6481632_6482307_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_193431279.1|6482931_6484281_-|transposase	transposase	transposase	D5GVY6	Campylobacter_virus	25.6	2.3e-18
WP_193431280.1|6484383_6484791_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.5	2.8e-28
WP_070394461.1|6484769_6485336_-	cytochrome P450	NA	NA	NA	NA	NA
WP_070394462.1|6485540_6486884_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	24.2	4.8e-24
WP_070394463.1|6487128_6487329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031141.1|6487452_6487803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394465.1|6487805_6488783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394466.1|6489108_6489411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031142.1|6489548_6489680_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_070394467.1|6490151_6491207_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070394468.1|6491497_6493174_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_070394470.1|6493456_6494842_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_158517421.1|6494838_6494982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394471.1|6495098_6495836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168166517.1|6496099_6496273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394472.1|6496846_6497989_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	6514145	6544069	9673108	tail,plate,transposase	Bacillus_phage(40.0%)	39	NA	NA
WP_070394486.1|6514145_6514721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_070394487.1|6514760_6515012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394488.1|6515074_6515335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394488.1|6515426_6515687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394488.1|6515778_6516039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394489.1|6516130_6516400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305323.1|6516801_6517200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394490.1|6517926_6518151_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_070394491.1|6518147_6518327_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_070394492.1|6518304_6518646_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_070394493.1|6519196_6519571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394494.1|6519703_6520021_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_149031146.1|6520160_6520343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394495.1|6520517_6520775_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_149031147.1|6520850_6521096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517425.1|6521335_6521512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394497.1|6521604_6521823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394498.1|6522065_6525554_-|tail	tail fiber domain-containing protein	tail	D6PIW7	uncultured_phage	24.2	4.5e-05
WP_158517426.1|6525587_6525776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394499.1|6525791_6526445_-|tail	phage tail protein I	tail	NA	NA	NA	NA
WP_083305324.1|6526479_6526854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394500.1|6526842_6528951_-	hypothetical protein	NA	A0A1B1IVB3	uncultured_Mediterranean_phage	29.9	3.1e-09
WP_070394501.1|6528950_6529259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517427.1|6529311_6529470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394502.1|6529447_6533401_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_158517428.1|6533381_6533531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394503.1|6533638_6534028_-	GPW/gp25 family protein	NA	A0A2I7QXF4	Vibrio_phage	31.9	7.0e-08
WP_070394504.1|6534043_6534469_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_070394505.1|6534837_6535677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517429.1|6535651_6536023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394506.1|6536080_6537154_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_070394507.1|6537162_6538014_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070394508.1|6538004_6539594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394509.1|6539593_6540145_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_044493148.1|6540349_6540712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517430.1|6540886_6541045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394510.1|6541016_6541475_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070394511.1|6541509_6542667_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	26.9	7.1e-40
WP_070394512.1|6542827_6544069_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	35.2	5.3e-41
>prophage 12
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	7166965	7206242	9673108	transposase	Clostridium_botulinum_C_phage(20.0%)	34	NA	NA
WP_070394888.1|7166965_7167595_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	45.3	4.7e-38
WP_070394889.1|7167581_7168706_+|transposase	transposase	transposase	A0A141ZJS9	Faustovirus	26.0	7.9e-20
WP_070394890.1|7168734_7169499_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_070394891.1|7169609_7170077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031193.1|7170762_7170957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394892.1|7170937_7171297_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_070394893.1|7171673_7172765_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_070394894.1|7172991_7173213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394895.1|7173450_7173936_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_158517487.1|7174156_7175044_+	DUF1822 family protein	NA	NA	NA	NA	NA
WP_070394897.1|7175063_7177430_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_158517488.1|7178074_7178224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394899.1|7178386_7179223_-	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_070394900.1|7179764_7179965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394901.1|7180330_7180789_+	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_070394902.1|7181227_7184470_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_158517489.1|7184711_7184873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394903.1|7184926_7185661_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070394904.1|7186033_7187242_+|transposase	transposase	transposase	A0A0H3UZC2	Geobacillus_virus	40.2	3.9e-73
WP_070394905.1|7187322_7188126_+	DUF4058 family protein	NA	NA	NA	NA	NA
WP_070394906.1|7188508_7189726_-	(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_070396893.1|7189827_7190031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394907.1|7190250_7192479_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_070394908.1|7192635_7193328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394909.1|7193805_7194144_-	NfeD family protein	NA	NA	NA	NA	NA
WP_070394910.1|7195010_7195970_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_070394911.1|7196733_7197573_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070394912.1|7197962_7199168_+	Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain	NA	NA	NA	NA	NA
WP_070394913.1|7201162_7201774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394914.1|7202136_7202376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394915.1|7202484_7202730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395357.1|7202985_7204128_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_070394916.1|7204553_7204973_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	43.3	5.0e-20
WP_070394917.1|7205030_7206242_+|transposase	transposase	transposase	A0A0R8V9X2	Thermobifida_phage	40.3	1.4e-67
>prophage 13
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	7219819	7281178	9673108	protease,transposase	Leptospira_phage(22.22%)	44	NA	NA
WP_070391308.1|7219819_7221148_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_070394928.1|7221700_7222132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083305353.1|7222215_7223529_-|transposase	transposase	transposase	A0A1C9C587	Heterosigma_akashiwo_virus	25.1	1.2e-24
WP_070394930.1|7223413_7223959_-|transposase	IS607 family transposase	transposase	A7IVV8	Paramecium_bursaria_Chlorella_virus	45.6	2.7e-34
WP_070394931.1|7224048_7224654_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_070394932.1|7224763_7225489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168166524.1|7225529_7226786_-|transposase	transposase	transposase	A0A1L2BWU7	Bacteriophage	36.1	2.8e-66
WP_070394934.1|7226775_7226994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031460.1|7227032_7228166_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_070394936.1|7228922_7230353_+	form I ribulose bisphosphate carboxylase large subunit	NA	NA	NA	NA	NA
WP_070396895.1|7230434_7230824_+	chaperonin family protein RbcX	NA	NA	NA	NA	NA
WP_070394937.1|7230908_7231256_+	ribulose bisphosphate carboxylase small subunit	NA	NA	NA	NA	NA
WP_070394938.1|7231487_7231898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396896.1|7232387_7233269_-	4-hydroxybenzoate solanesyltransferase	NA	NA	NA	NA	NA
WP_070394939.1|7233410_7234781_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_070394941.1|7235193_7236849_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_149031199.1|7241562_7241871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394943.1|7242286_7243675_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	32.0	1.5e-57
WP_070393396.1|7244034_7245114_+	photosystem II q(b) protein	NA	A0A1D7SRD7	Cyanophage	91.3	4.4e-193
WP_070394944.1|7245835_7248727_+	glycosyltransferase	NA	A0A2H4UTU3	Bodo_saltans_virus	47.5	4.1e-20
WP_070394945.1|7248723_7249395_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_070394946.1|7249674_7250316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031200.1|7250578_7250806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394947.1|7251893_7252127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394948.1|7253005_7254349_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070394949.1|7254587_7256384_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_158517491.1|7256386_7256569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394950.1|7256720_7257563_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_158517492.1|7257578_7258004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517493.1|7258099_7260157_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070394953.1|7262800_7263289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070394954.1|7263871_7264666_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158517494.1|7264864_7270777_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070394956.1|7271034_7271529_+	TIGR00725 family protein	NA	NA	NA	NA	NA
WP_070394957.1|7271613_7272897_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070394958.1|7273695_7274151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394959.1|7274547_7274757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070394960.1|7274949_7275165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083305358.1|7275620_7275797_+	microviridin/marinostatin family tricyclic proteinase inhibitor	NA	NA	NA	NA	NA
WP_070394961.1|7275964_7276942_+	MvdC family ATP-grasp ribosomal peptide maturase	NA	S5VKI3	Leptospira_phage	28.0	1.9e-30
WP_070394962.1|7277101_7278082_+	MvdD family ATP-grasp ribosomal peptide maturase	NA	S5VKI3	Leptospira_phage	32.2	6.8e-36
WP_070394963.1|7278081_7279980_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.2	1.8e-61
WP_070394964.1|7280186_7280807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305359.1|7280830_7281178_-|protease	nickel-type superoxide dismutase maturation protease	protease	NA	NA	NA	NA
>prophage 14
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	7786134	7841742	9673108	transposase	Pseudomonas_phage(30.77%)	38	NA	NA
WP_070395264.1|7786134_7787361_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	41.1	5.2e-65
WP_070395265.1|7787425_7787839_+|transposase	IS200/IS605 family transposase	transposase	A0A7E6	Microcystis_virus	49.6	9.9e-29
WP_070395266.1|7787863_7788412_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070395267.1|7788504_7789749_+	FAD-dependent hydroxylase	NA	NA	NA	NA	NA
WP_070395268.1|7790809_7792288_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	39.3	5.1e-51
WP_070395269.1|7792814_7793216_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_070395270.1|7793199_7793499_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_149031234.1|7793864_7794308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395272.1|7794323_7796048_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	4.4e-54
WP_158517528.1|7796049_7796214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395273.1|7798898_7799273_-	cytochrome c	NA	NA	NA	NA	NA
WP_070395274.1|7799728_7799842_+	cytochrome b6-f complex subunit PetG	NA	NA	NA	NA	NA
WP_070395275.1|7799892_7800432_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_070395276.1|7800505_7801162_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_070395277.1|7801229_7801739_+	peptidase C15	NA	NA	NA	NA	NA
WP_083305668.1|7801920_7803495_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	33.0	3.9e-57
WP_070395278.1|7804034_7805789_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	40.2	7.3e-97
WP_070395279.1|7806491_7807835_-|transposase	transposase	transposase	A0A1L2BWW3	Bacteriophage	42.2	1.6e-80
WP_158517529.1|7808408_7808549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395282.1|7809140_7810007_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_070395283.1|7810134_7810551_-	universal stress protein	NA	NA	NA	NA	NA
WP_070395284.1|7810741_7811947_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_070395285.1|7812281_7816475_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_070395286.1|7816756_7818055_+	MFS transporter	NA	NA	NA	NA	NA
WP_070395287.1|7818535_7819783_+|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	61.7	6.5e-140
WP_070395288.1|7819898_7821908_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	32.5	3.4e-29
WP_070395289.1|7821962_7822334_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_070395290.1|7822546_7823113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395291.1|7823119_7823740_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_070395292.1|7824025_7824553_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_070391951.1|7825865_7827008_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_070395293.1|7827039_7827426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395294.1|7829134_7829986_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070395295.1|7830176_7833356_+	hypothetical protein	NA	E5ESI2	Bathycoccus_sp._RCC1105_virus	37.2	2.1e-65
WP_070395296.1|7833380_7836020_+	hypothetical protein	NA	A0A0F7LBT8	uncultured_marine_virus	32.9	2.1e-10
WP_070390905.1|7836962_7838654_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.3	1.1e-94
WP_149031235.1|7839550_7840603_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	42.7	1.6e-59
WP_070395357.1|7840599_7841742_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	7845638	7910622	9673108	tRNA,transposase	Bacteriophage(20.0%)	48	NA	NA
WP_168166528.1|7845638_7846118_+|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	70.6	7.7e-41
WP_070395302.1|7846307_7849871_+	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_070395303.1|7850031_7851201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395304.1|7851268_7852411_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_070395305.1|7852810_7853494_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_149031103.1|7853902_7855096_-|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	56.8	1.3e-124
WP_149031236.1|7855220_7855580_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	58.5	7.8e-38
WP_083305394.1|7855858_7856314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395308.1|7856652_7857345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031237.1|7857338_7857512_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_070395310.1|7858147_7859740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395311.1|7859804_7859993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395312.1|7860088_7860382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083305396.1|7860337_7860610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395315.1|7861229_7862711_+	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	36.4	4.9e-70
WP_070395316.1|7862742_7863351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395317.1|7863386_7864706_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_070395318.1|7864794_7865208_-|transposase	IS200/IS605 family transposase	transposase	A0A7E6	Microcystis_virus	48.9	8.1e-31
WP_070395319.1|7865273_7866509_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	38.2	4.7e-58
WP_070395320.1|7866654_7867080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517530.1|7867604_7868021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395323.1|7870471_7871311_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_070395324.1|7871387_7872122_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_070395325.1|7872274_7872811_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_070395326.1|7872925_7874389_-	sodium:glutamate symporter	NA	NA	NA	NA	NA
WP_070395327.1|7874753_7875209_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_070395328.1|7875297_7876095_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_070395329.1|7876425_7877112_-	restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_070395330.1|7878252_7879626_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_168166529.1|7879902_7880079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168166530.1|7880142_7881450_+|transposase	transposase	transposase	A0A1L2BWW3	Bacteriophage	57.6	2.8e-133
WP_070396932.1|7882015_7883152_-	citrate synthase	NA	NA	NA	NA	NA
WP_070395332.1|7883391_7883889_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_070395333.1|7884267_7885518_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_008189673.1|7885628_7886126_-	HNH endonuclease	NA	F5B475	Synechococcus_phage	42.7	8.3e-30
WP_070395334.1|7886331_7886850_+|transposase	IS607 family transposase	transposase	A7RAM3	Paramecium_bursaria_Chlorella_virus	48.0	6.4e-25
WP_070395335.1|7886876_7888109_+|transposase	transposase	transposase	A0A1V0SAM8	Catovirus	25.9	1.1e-22
WP_083305399.1|7888180_7889731_-	response regulator	NA	W8CYM9	Bacillus_phage	43.6	7.8e-18
WP_070395336.1|7889931_7894488_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	32.9	6.0e-34
WP_070395337.1|7895716_7896619_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_070395338.1|7896807_7898103_-	ATPase	NA	NA	NA	NA	NA
WP_070396934.1|7898718_7900167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396935.1|7900671_7901943_+	insulinase family protein	NA	A0A2P1EL85	Moumouvirus	24.0	9.5e-30
WP_070395339.1|7902189_7903464_+	insulinase family protein	NA	NA	NA	NA	NA
WP_070395340.1|7903604_7904414_+	peptidoglycan-binding protein	NA	A0A219VHE4	Ochrobactrum_phage	50.8	3.5e-09
WP_070395341.1|7904733_7905393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396936.1|7905661_7909132_+	response regulator	NA	A0A2H4N7Z5	Lake_Baikal_phage	33.2	9.6e-24
WP_070395342.1|7909557_7910622_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	7977594	8014498	9673108	protease,transposase	Synechococcus_phage(37.5%)	38	NA	NA
WP_070395357.1|7977594_7978737_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_070395358.1|7979033_7979270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395359.1|7979757_7979973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_070395360.1|7980218_7980614_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_158517532.1|7980644_7980788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083305405.1|7980844_7981021_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_070395361.1|7981192_7983610_-	sucrose synthase	NA	NA	NA	NA	NA
WP_070396938.1|7983771_7985295_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_070395362.1|7986056_7986926_-	peptidase	NA	NA	NA	NA	NA
WP_008191847.1|7986944_7987175_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_070395363.1|7987252_7988851_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_070395364.1|7989343_7990003_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	45.8	3.2e-37
WP_070395365.1|7990239_7990833_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_070395366.1|7990810_7991938_-	DUF3326 domain-containing protein	NA	NA	NA	NA	NA
WP_070395367.1|7991934_7992120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395368.1|7992229_7992550_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	V5UTY8	Synechococcus_phage	50.6	3.3e-16
WP_158517533.1|7992813_7992951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395369.1|7993745_7994168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395370.1|7994326_7995718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395371.1|7995795_7995978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031241.1|7996086_7996959_+	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_070395373.1|7996961_7998551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517534.1|7998677_7998821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395375.1|7999011_8000274_+	methyltransferase domain-containing protein	NA	A0A2H4UUL2	Bodo_saltans_virus	28.9	3.0e-44
WP_070395376.1|8000301_8001003_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_070395378.1|8001403_8003242_+	hypothetical protein	NA	M4QHP6	Synechococcus_phage	30.4	7.7e-57
WP_070395379.1|8003493_8004468_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_070395380.1|8004430_8005096_+	cyclase family protein	NA	NA	NA	NA	NA
WP_070396939.1|8005170_8005842_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_070395381.1|8006070_8007171_+	RRXRR domain-containing protein	NA	A0A7T5	Microcystis_virus	51.2	1.1e-90
WP_070395382.1|8007234_8008167_+	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.0	5.7e-16
WP_070395383.1|8008157_8008913_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	33.9	3.4e-11
WP_149031242.1|8008994_8009801_+	DUF115 domain-containing protein	NA	NA	NA	NA	NA
WP_070395384.1|8009970_8010876_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070395385.1|8011091_8011505_-	response regulator	NA	NA	NA	NA	NA
WP_158517535.1|8011778_8012390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_070395387.1|8012503_8012977_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_070395388.1|8013298_8014498_+|transposase	transposase	transposase	D9J0Y9	Brochothrix_phage	41.3	1.8e-70
>prophage 17
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	8078427	8139751	9673108	tail,tRNA,transposase,protease,integrase	Hokovirus(10.0%)	55	8073131:8073175	8151858:8151902
8073131:8073175	attL	TTGTCTTGATGCAGTCGCTCATGGGGGAAACCCCCAAGACCGCGC	NA	NA	NA	NA
WP_070395432.1|8078427_8079300_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_158517539.1|8080656_8080794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083305410.1|8084227_8084623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031246.1|8084824_8085034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395433.1|8085265_8085982_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_070395434.1|8086763_8087726_+	deoxyhypusine synthase family protein	NA	NA	NA	NA	NA
WP_070395435.1|8088139_8088748_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_070395436.1|8089173_8090160_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_070395437.1|8090418_8091327_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158517540.1|8091295_8091448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395438.1|8091805_8092951_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_168166564.1|8093477_8095025_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	3.4e-21
WP_070395440.1|8097017_8097731_-	choice-of-anchor E domain-containing protein	NA	NA	NA	NA	NA
WP_149031247.1|8098951_8099206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031248.1|8099192_8099381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395442.1|8099825_8100518_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_070395443.1|8100714_8100927_-	HetP family heterocyst commitment protein	NA	NA	NA	NA	NA
WP_070395444.1|8101957_8102416_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_070395445.1|8102820_8103402_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_070395446.1|8103607_8103955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395447.1|8104173_8104566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395448.1|8104936_8105179_-	DUF4327 family protein	NA	NA	NA	NA	NA
WP_083305413.1|8106120_8107881_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_008179934.1|8107877_8108276_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_083305414.1|8108350_8108554_-	DUF751 family protein	NA	NA	NA	NA	NA
WP_070395450.1|8108726_8111195_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.9	9.5e-127
WP_070395451.1|8111336_8111939_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_070395452.1|8112003_8113419_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_070395453.1|8113599_8114520_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_070395454.1|8114516_8115266_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.7	1.3e-26
WP_070395455.1|8115436_8115709_-	DUF3143 domain-containing protein	NA	NA	NA	NA	NA
WP_070395456.1|8115913_8116534_-	J domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	50.7	8.5e-08
WP_149031469.1|8116771_8118022_-|transposase	transposase	transposase	A0A1L2BWU7	Bacteriophage	35.6	9.0e-65
WP_070395458.1|8118161_8119472_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_070396945.1|8119489_8120332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031250.1|8121479_8122391_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_070396946.1|8122663_8123788_+|transposase	transposase	transposase	A0A7P9	Microcystis_virus	48.8	4.0e-88
WP_070396947.1|8123846_8124569_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_070395460.1|8124591_8124915_+	DUF2488 family protein	NA	NA	NA	NA	NA
WP_070395461.1|8124969_8125614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395462.1|8125681_8126137_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_070395463.1|8126356_8127286_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_070395464.1|8127651_8128515_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.6	3.3e-34
WP_070395465.1|8128705_8129158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395466.1|8129147_8129588_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_158517541.1|8129777_8129936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031470.1|8130412_8131306_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_070395468.1|8131519_8131822_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_070395469.1|8131947_8132928_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_070395470.1|8132974_8133937_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	37.0	6.9e-41
WP_070395471.1|8134124_8135138_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JIM2	Lactococcus_phage	32.9	2.1e-35
WP_070396948.1|8135080_8136130_+	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_070395472.1|8136122_8137412_+	threonine synthase	NA	NA	NA	NA	NA
WP_070395473.1|8138036_8138405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168166565.1|8138779_8139751_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	21.9	4.6e-08
8151858:8151902	attR	GCGCGGTCTTGGGGGTTTCCCCCATGAGCGACTGCATCAAGACAA	NA	NA	NA	NA
>prophage 18
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	8604267	8650845	9673108	transposase	Bacillus_phage(22.22%)	42	NA	NA
WP_070395754.1|8604267_8605170_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	34.0	7.0e-27
WP_070395755.1|8605389_8605692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031279.1|8606027_8606285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395756.1|8606270_8606861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395757.1|8606978_8608682_-	iron uptake porin	NA	NA	NA	NA	NA
WP_070395758.1|8608984_8610679_-	iron uptake porin	NA	NA	NA	NA	NA
WP_149031280.1|8610726_8610909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395759.1|8611036_8612731_-	iron uptake porin	NA	NA	NA	NA	NA
WP_193431291.1|8613182_8613845_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_070395760.1|8614390_8615572_-|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	62.9	2.8e-137
WP_070395761.1|8615703_8617011_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_070395762.1|8617125_8618454_-	HNH endonuclease	NA	H6WG01	Cyanophage	44.1	3.4e-06
WP_070395763.1|8618730_8619477_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	5.6e-38
WP_070395764.1|8619832_8620579_+	creatininase family protein	NA	NA	NA	NA	NA
WP_158517570.1|8620551_8620722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396982.1|8620930_8621527_-|transposase	IS607 family transposase	transposase	M1I5D0	Acanthocystis_turfacea_Chlorella_virus	45.3	2.4e-36
WP_070395766.1|8621734_8623318_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_070395767.1|8623522_8624251_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.3	3.9e-44
WP_070395768.1|8624311_8624956_+	cofactor assembly of complex C subunit B	NA	NA	NA	NA	NA
WP_070395769.1|8624984_8625524_+	DUF456 family protein	NA	NA	NA	NA	NA
WP_070395770.1|8625580_8626831_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_070395771.1|8627472_8628756_-	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	51.7	1.3e-98
WP_083305445.1|8629507_8629705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395772.1|8629847_8630324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395773.1|8630320_8631121_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_070395774.1|8631694_8632003_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_070391050.1|8632202_8632796_+|transposase	IS607 family transposase	transposase	A7RAM3	Paramecium_bursaria_Chlorella_virus	41.1	1.1e-33
WP_083305532.1|8632698_8633871_+|transposase	transposase	transposase	A0A1V0S8G3	Catovirus	28.7	6.5e-25
WP_070395775.1|8633918_8636588_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_070395776.1|8636994_8637534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395777.1|8638107_8639601_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_070395778.1|8639660_8640392_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_149031281.1|8640404_8640584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395780.1|8640821_8641772_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_070395781.1|8641773_8642472_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_070395782.1|8642503_8642866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395783.1|8642886_8643390_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_070395784.1|8643739_8644282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395785.1|8644278_8646606_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_070395786.1|8646700_8648623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517571.1|8648942_8649107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395787.1|8649372_8650845_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	8734368	8789637	9673108	transposase	uncultured_Mediterranean_phage(18.18%)	47	NA	NA
WP_070393043.1|8734368_8735016_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	44.3	2.0e-44
WP_083305249.1|8735040_8736174_+|transposase	transposase	transposase	A0A7P9	Microcystis_virus	37.2	2.0e-55
WP_070395830.1|8736288_8739084_+	hypothetical protein	NA	A0A1B1IPM9	uncultured_Mediterranean_phage	28.2	3.8e-07
WP_083305457.1|8739642_8743593_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_158517580.1|8743860_8748549_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A1B1IPM9	uncultured_Mediterranean_phage	28.4	1.3e-07
WP_070395831.1|8749001_8749877_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_070396991.1|8750387_8751911_+	serine/threonine protein kinase	NA	K7YWJ1	Megavirus	29.7	2.5e-08
WP_070395832.1|8752184_8752547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031288.1|8752824_8753499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395834.1|8753912_8754365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083305686.1|8755165_8757034_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.5	3.8e-59
WP_070395837.1|8757817_8758180_-	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_070395839.1|8758523_8760158_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_070395840.1|8760210_8761161_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.0	2.1e-26
WP_070390947.1|8761493_8761913_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	42.4	3.8e-20
WP_070390948.1|8761965_8763312_+	IS200/IS605 family accessory protein TnpB-related protein	NA	NA	NA	NA	NA
WP_070395841.1|8766208_8767297_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_070395842.1|8767618_8767885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395843.1|8767957_8768791_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_070395844.1|8769137_8769377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395845.1|8769416_8770349_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_158517581.1|8770389_8770587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395846.1|8770608_8770791_+	translation initiation factor IF-2	NA	NA	NA	NA	NA
WP_070395847.1|8770937_8771426_+	cytochrome c-550	NA	NA	NA	NA	NA
WP_083305459.1|8771661_8772267_+	photosystem II cytochrome PsbV2	NA	NA	NA	NA	NA
WP_070395848.1|8772571_8773834_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070395849.1|8773903_8774824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395850.1|8775119_8776715_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_193431365.1|8776633_8776879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031477.1|8777046_8778321_+|transposase	transposase	transposase	A0A1L2BWU7	Bacteriophage	36.2	7.7e-64
WP_070395852.1|8778328_8778748_-	DUF29 family protein	NA	NA	NA	NA	NA
WP_070395853.1|8778900_8779395_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_070396993.1|8779391_8779637_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_149031291.1|8779706_8779880_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_158517582.1|8779930_8780086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396994.1|8780248_8780920_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_193431360.1|8781069_8781309_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_070395854.1|8781629_8781830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517583.1|8782212_8782359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517584.1|8783105_8783465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149031292.1|8783554_8783980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517585.1|8784102_8784243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395855.1|8784303_8784765_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_070395856.1|8785135_8785540_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_070395857.1|8785539_8785782_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_070395858.1|8786233_8787454_+|transposase	transposase	transposase	A0A191SB13	Nostoc_phage	38.1	3.1e-46
WP_070395859.1|8789229_8789637_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	41.3	8.6e-17
>prophage 20
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	8998657	9049296	9673108	bacteriocin,transposase	Bacteriophage(50.0%)	33	NA	NA
WP_070395982.1|8998657_8999893_+|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	59.1	1.1e-134
WP_070395983.1|9002627_9003809_-	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_158517612.1|9003778_9004039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395984.1|9004167_9004965_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_070395985.1|9005198_9005711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517613.1|9005976_9006117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395986.1|9006207_9006711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395987.1|9006872_9007178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395988.1|9007680_9008316_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_158517614.1|9009270_9013494_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_070395991.1|9015738_9017190_+|transposase	transposase	transposase	A0A1L2BWW3	Bacteriophage	43.1	1.2e-81
WP_070395992.1|9017212_9021481_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_070395993.1|9022293_9023346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070397014.1|9023787_9024849_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_070395994.1|9024894_9025968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395995.1|9025969_9027022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395996.1|9027080_9028298_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_149031312.1|9028852_9029050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070395997.1|9029046_9030663_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
WP_193431295.1|9031041_9033936_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	28.9	6.1e-32
WP_158517615.1|9033955_9034108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517616.1|9034130_9034274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070395998.1|9034433_9036641_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.0	7.2e-33
WP_070397016.1|9036662_9037556_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070395999.1|9037917_9038391_-	Nif11-like leader peptide family RiPP precursor	NA	NA	NA	NA	NA
WP_070396000.1|9038863_9040363_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_070396001.1|9040392_9041205_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_158517617.1|9041286_9041451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396002.1|9041795_9042935_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083305478.1|9043866_9044229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396003.1|9044216_9045860_-	DUF882 domain-containing protein	NA	R9ZW03	Cellulophaga_phage	32.5	1.1e-09
WP_070396004.1|9046552_9046960_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070396005.1|9048882_9049296_+|transposase	IS200/IS605 family transposase	transposase	A0A1L2BWN1	Bacteriophage	63.5	1.7e-41
>prophage 21
NZ_CP017599	Moorea producens PAL-8-15-08-1 chromosome, complete genome	9673108	9312384	9381055	9673108	tRNA,bacteriocin,transposase	Bacillus_phage(33.33%)	60	NA	NA
WP_070396177.1|9312384_9313272_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	35.2	7.6e-26
WP_158517637.1|9313297_9313465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517638.1|9313516_9313675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396178.1|9314131_9314494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396179.1|9314564_9315512_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_070396180.1|9315758_9316682_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_193431298.1|9317023_9319282_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_070396181.1|9321107_9321806_+	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_070396182.1|9321828_9322356_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_070396183.1|9322348_9323161_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070396184.1|9323525_9323879_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_008186584.1|9323944_9324142_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_070396185.1|9324208_9325501_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	40.2	1.0e-15
WP_070396186.1|9325620_9326262_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_070396187.1|9326627_9327740_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_070396188.1|9327792_9327987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396190.1|9330342_9331527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396191.1|9332109_9333501_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.7	2.2e-72
WP_070396192.1|9333616_9334501_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_158517639.1|9334615_9334783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070397030.1|9334806_9335703_+	ROK family protein	NA	NA	NA	NA	NA
WP_070396193.1|9335915_9336491_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_149031340.1|9336761_9336950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396195.1|9338154_9338538_-	Mth938-like domain-containing protein	NA	NA	NA	NA	NA
WP_070397031.1|9338843_9340496_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_149031341.1|9340585_9340795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149031342.1|9340994_9341267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396196.1|9341291_9345245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517640.1|9345251_9345491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396197.1|9345599_9346106_-	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	35.5	2.4e-16
WP_070397032.1|9346229_9346976_-	ChaB family protein	NA	NA	NA	NA	NA
WP_070396198.1|9347585_9347834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396199.1|9347887_9348211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396200.1|9348379_9348679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396201.1|9348749_9349094_-	ssl1498 family light-harvesting-like protein	NA	NA	NA	NA	NA
WP_070396202.1|9349672_9351022_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_070396203.1|9351286_9352522_+|transposase	transposase	transposase	A0A1L2BWU7	Bacteriophage	53.1	1.7e-92
WP_070396204.1|9352671_9356835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396205.1|9357460_9358273_+	creatininase family protein	NA	NA	NA	NA	NA
WP_070396206.1|9358870_9360217_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_070396207.1|9360596_9360881_-	YggT family protein	NA	NA	NA	NA	NA
WP_083305494.1|9361252_9361372_+	photosystem II reaction center X protein	NA	NA	NA	NA	NA
WP_070396208.1|9361567_9362536_+	Ycf66 family protein	NA	NA	NA	NA	NA
WP_070396209.1|9362707_9363715_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_070396210.1|9364026_9365157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396211.1|9365483_9365777_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_158517641.1|9366309_9366606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517642.1|9366655_9366799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396212.1|9366987_9368808_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	2.0e-28
WP_070396213.1|9369159_9369450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396214.1|9370011_9370263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396215.1|9370657_9370999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070396216.1|9371596_9371872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158517643.1|9372236_9372398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396217.1|9373201_9374281_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_070396218.1|9374852_9375425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396220.1|9377579_9377777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070396221.1|9377808_9377991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143727925.1|9379492_9379672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158517073.1|9380134_9381055_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
