The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	83990	210358	2810721	transposase,tail,plate,terminase	Aeromonas_phage(18.75%)	103	NA	NA
WP_070324405.1|83990_85376_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
WP_087651418.1|87606_88360_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070322705.1|88695_90141_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003622497.1|90246_90585_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_070322704.1|90824_92000_+	aminotransferase	NA	NA	NA	NA	NA
WP_070324389.1|92415_94533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322703.1|94917_96138_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_070324390.1|96302_97319_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	30.5	7.1e-12
WP_019089824.1|97330_97468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322700.1|97516_98773_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_070324391.1|99030_99318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089828.1|99677_101495_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	43.3	6.5e-24
WP_082247058.1|101636_102137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070322698.1|102201_103356_+	MFS transporter	NA	NA	NA	NA	NA
WP_019089831.1|103370_104585_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_070322697.1|104729_106190_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_070322696.1|106222_107239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322695.1|107518_108331_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	34.2	5.9e-09
WP_019089837.1|108524_109136_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_070322694.1|109261_109492_-	DUF3126 family protein	NA	NA	NA	NA	NA
WP_070325316.1|109688_110225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886559.1|110362_111120_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070324393.1|111302_113165_+	alginate export family protein	NA	NA	NA	NA	NA
WP_070324394.1|113343_115314_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_070324395.1|115321_117670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089843.1|117730_118546_-	universal stress protein	NA	NA	NA	NA	NA
WP_070322690.1|118797_119595_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_070322689.1|119626_121285_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070322688.1|121490_122663_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_070322687.1|122723_123689_+	cation transporter	NA	NA	NA	NA	NA
WP_087651418.1|125322_126076_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070322686.1|126160_127165_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_019089850.1|127161_128217_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_019089851.1|128351_129635_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_019089853.1|129887_130094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089854.1|130105_130705_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_019089855.1|130862_132029_-	acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit	NA	G1BRG0	Mycobacterium_phage	37.7	2.9e-09
WP_019089856.1|132032_133061_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_070324396.1|133108_134104_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_044583086.1|134366_134567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886597.1|135321_136409_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.7	1.1e-07
WP_070324398.1|137508_138426_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_070324399.1|141120_142143_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.5	5.0e-21
WP_070324400.1|142404_143790_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_070324402.1|145071_146277_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_087651418.1|146539_147293_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070325317.1|147286_147880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324121.1|148023_150480_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_070324403.1|150615_152820_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.7	1.6e-80
WP_070322680.1|152944_154150_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_082246712.1|155117_155942_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070322677.1|156347_156563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089870.1|156561_157002_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_019089872.1|157233_158058_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_019089873.1|158127_158511_+	VOC family protein	NA	NA	NA	NA	NA
WP_019089874.1|158636_159071_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	39.8	1.6e-05
WP_070322675.1|159080_159851_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044583087.1|159996_160470_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324405.1|160770_162156_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
WP_082246970.1|162287_162566_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_019089877.1|162929_163835_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.6	5.4e-11
WP_157886560.1|163989_164280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019089880.1|164524_165085_+	RcnB family protein	NA	NA	NA	NA	NA
WP_070322673.1|165204_165768_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_070322672.1|165767_167012_-	phosphotransferase	NA	NA	NA	NA	NA
WP_070324407.1|167014_169435_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_070324408.1|169519_170782_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.5	8.5e-31
WP_019089885.1|170854_171301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322671.1|171999_173097_-|tail	phage tail protein	tail	A0A077KC23	Edwardsiella_phage	34.0	1.3e-11
WP_070322670.1|173104_173683_-	DUF2612 domain-containing protein	NA	Q6UIZ7	Burkholderia_virus	39.7	3.7e-29
WP_070324409.1|173682_174918_-|plate	baseplate J/gp47 family protein	plate	A0A2R3UAL9	Myoviridae_environmental_samples	39.0	9.2e-62
WP_070324410.1|174904_175258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322667.1|175269_175959_-|plate	baseplate assembly protein	plate	H9C0X6	Aeromonas_phage	43.5	3.1e-35
WP_070324411.1|175955_176843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322665.1|176878_177199_-	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	35.9	1.8e-06
WP_070322664.1|177195_177909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322663.1|177944_178958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167542407.1|178942_179104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322662.1|179127_179583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324412.1|179847_181233_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	6.5e-32
WP_070324413.1|181290_181728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322660.1|182903_183476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322659.1|183436_183817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324414.1|183807_184314_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	41.7	3.0e-11
WP_070322658.1|184350_184668_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	38.4	1.6e-10
WP_070325318.1|184717_185755_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	45.8	3.2e-76
WP_070322656.1|185754_186255_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	46.3	7.0e-29
WP_070324415.1|186292_187951_-	DUF1073 domain-containing protein	NA	H9C0V0	Aeromonas_phage	40.7	3.5e-48
WP_070324417.1|188196_189249_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_070324418.1|189245_190700_-|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	45.4	2.7e-105
WP_019089910.1|190733_190916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|191455_192209_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070322651.1|192473_193118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324419.1|193114_195298_-	acyltransferase	NA	C6ZR20	Salmonella_phage	31.9	4.3e-62
WP_019089914.1|195337_195517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325319.1|195728_197072_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_070324420.1|197495_198746_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157886561.1|198874_199629_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070324422.1|202009_203767_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_070323614.1|203863_204403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324237.1|204446_205040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324423.1|206722_207517_+	LexA family transcriptional regulator	NA	H1ZZB6	Pseudomonas_virus	30.3	3.7e-08
WP_070324426.1|208972_210358_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	2.5e-31
>prophage 2
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	219761	269809	2810721	transposase	Paenibacillus_phage(50.0%)	48	NA	NA
WP_087651418.1|219761_220515_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070323622.1|220702_221392_-	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_070324430.1|221455_221833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089936.1|224073_224898_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_070324238.1|225115_225616_+	CHRD domain-containing protein	NA	NA	NA	NA	NA
WP_019089939.1|225728_226163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089940.1|226273_226666_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_070324431.1|226759_227707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089943.1|227950_228637_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_070323625.1|228668_229472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019089945.1|229537_229726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169818440.1|229989_230166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323626.1|230268_230667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157885539.1|230720_231017_-	YggT family protein	NA	NA	NA	NA	NA
WP_070324432.1|231744_232986_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_070323647.1|233101_233344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324433.1|233867_235253_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_082246971.1|235310_236105_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_026019410.1|236232_236628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099046893.1|238295_239990_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_019089515.1|240378_240606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019089514.1|240620_241718_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_070324435.1|241825_242902_+	glycosyltransferase family 61 protein	NA	NA	NA	NA	NA
WP_070323652.1|243008_243470_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_070323653.1|243466_245659_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_070323654.1|245663_246968_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_070323655.1|247082_248531_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_070324436.1|248636_249503_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324437.1|249509_250406_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_070323658.1|250490_251243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070323659.1|251371_251962_-	methylamine utilization protein MauD	NA	NA	NA	NA	NA
WP_070323660.1|252010_253372_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_070323661.1|253499_254009_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_070323662.1|254011_254599_-	methylamine dehydrogenase (amicyanin) small subunit	NA	NA	NA	NA	NA
WP_070324438.1|254585_255191_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_003625999.1|255187_255730_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_070324439.1|255726_256932_-	amine dehydrogenase	NA	NA	NA	NA	NA
WP_157886562.1|257876_259062_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_070325320.1|259425_259911_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_044583025.1|259984_260251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|262509_263263_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_026019415.1|263486_263720_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_070323663.1|263786_264758_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_019089540.1|264914_265448_+	DNA starvation/stationary phase protection protein	NA	A0A2K9VDB4	Lactobacillus_phage	34.1	1.4e-11
WP_082246973.1|265621_266446_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_087651418.1|267283_268037_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_157885543.1|268014_268164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324445.1|268423_269809_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
>prophage 3
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	373109	485391	2810721	transposase,tail,tRNA,portal,protease,integrase	Paenibacillus_phage(12.0%)	114	393729:393744	418664:418679
WP_157886598.1|373109_374199_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	2.2e-06
WP_070324480.1|374517_376017_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_070324481.1|376100_376406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082246977.1|376450_377263_-	KilA-N domain-containing protein	NA	A0A141GEX9	Brucella_phage	50.0	5.7e-28
WP_070324482.1|377259_377592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082246978.1|377890_378265_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_070324485.1|378354_379119_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_082246979.1|379222_379552_+	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_124307099.1|379578_380136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324486.1|380226_382551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324487.1|382668_383175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089495.1|383158_383320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089496.1|383343_383667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819942.1|383663_384095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324488.1|384098_385583_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070323746.1|385582_385789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324489.1|385803_386850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324490.1|386849_387536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324491.1|387535_387724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089333.1|387723_387933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089334.1|387892_388282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089335.1|388288_388678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089336.1|388677_388899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324492.1|388898_390293_-	DUF4043 domain-containing protein	NA	NA	NA	NA	NA
WP_070324493.1|390373_391018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324494.1|391064_392582_-|portal	phage portal protein	portal	NA	NA	NA	NA
393729:393744	attL	TCCGGCAGGCCATCTG	NA	NA	NA	NA
WP_070324495.1|394061_394526_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	44.1	5.7e-25
WP_157886564.1|394670_395030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324497.1|395103_395667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324498.1|395663_396317_-	hypothetical protein	NA	A0A1V0CNY2	Kaumoebavirus	32.7	7.6e-07
WP_157886565.1|396602_396770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886566.1|396766_396988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324499.1|397096_397840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324500.1|397843_398737_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	46.7	4.6e-31
WP_070324501.1|398861_399284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324502.1|399569_399959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089565.1|400057_400297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324503.1|400298_400964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324505.1|401255_401654_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019089559.1|401799_402309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324507.1|402305_403112_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_070324508.1|403493_404210_+	phage antirepressor KilAC domain-containing protein	NA	A0A2H4IZE1	uncultured_Caudovirales_phage	45.6	5.2e-25
WP_070324509.1|404220_404526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886567.1|404522_404813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323773.1|404812_405049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324511.1|405127_405448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886568.1|405635_406097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323777.1|406098_406932_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	33.8	4.0e-29
WP_070324515.1|407435_408821_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	30.1	5.3e-34
WP_070324517.1|409183_409558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324518.1|409554_409860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324519.1|409856_410273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324520.1|410269_410515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324521.1|410511_410745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324522.1|410741_411074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324523.1|411248_412358_+|integrase	site-specific integrase	integrase	K4PAZ9	Burkholderia_phage	28.0	7.0e-21
WP_157886574.1|412686_413773_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
WP_070323788.1|413832_414759_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_070324525.1|414864_416775_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.5	3.5e-100
WP_087651418.1|416751_417506_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_019088753.1|418080_418341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324405.1|418662_420048_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
418664:418679	attR	CAGATGGCCTGCCGGA	NA	NA	NA	NA
WP_169818441.1|420113_420914_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_070324526.1|420876_422127_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_087651418.1|423993_424747_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070324532.1|429223_430204_-	oxidoreductase	NA	NA	NA	NA	NA
WP_019088758.1|430429_431752_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_070324533.1|431748_433044_+	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_099046885.1|433270_434027_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070324420.1|434156_435407_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_070325325.1|435369_436206_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_087651418.1|436288_437043_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_157886562.1|437261_438447_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_019088761.1|438607_439051_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_070324534.1|439155_440823_-	porin	NA	NA	NA	NA	NA
WP_070323801.1|440986_442009_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A2R8FEI2	Cedratvirus	26.6	8.0e-11
WP_070323802.1|442094_443402_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_070324535.1|443421_444111_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	33.3	1.6e-31
WP_003623768.1|444333_445623_-	adenylosuccinate synthase	NA	K7YXK1	Megavirus	34.5	2.4e-60
WP_070323803.1|445688_446873_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_070323804.1|446925_448404_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_070324253.1|448400_449654_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_070323805.1|449687_450521_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_044582936.1|450517_451762_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_050019154.1|452060_453215_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_070323806.1|453216_453750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003623786.1|453984_455283_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_070323808.1|455344_455638_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_006116856.1|455797_456286_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_019088774.1|456282_457131_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_070323809.1|457195_458842_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_157886569.1|459425_460611_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_070323811.1|460858_461683_-	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_070324254.1|461920_462805_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_070323812.1|462809_464870_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_070324537.1|465092_466049_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003623804.1|466062_466233_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_019088781.1|466365_467124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325326.1|467245_468823_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.7	1.5e-64
WP_019088783.1|468921_469659_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_070323814.1|469677_470865_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.8	3.8e-97
WP_070323815.1|471053_471833_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_019088785.1|471839_472982_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.7	4.9e-25
WP_019088786.1|473137_475042_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	52.0	6.2e-150
WP_019088787.1|475251_475848_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003623821.1|476042_476756_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	3.9e-33
WP_070323818.1|476765_478568_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_019088789.1|478588_478987_-	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_070323819.1|479251_480232_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_070323820.1|480257_480866_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_019088792.1|480980_481898_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_070323822.1|481904_482408_+	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_070324538.1|482501_484847_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	1.4e-175
WP_003623838.1|485013_485391_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	40.0	1.5e-15
>prophage 4
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	799024	850297	2810721	transposase,tRNA,protease,integrase	Enterobacteria_phage(18.75%)	40	841685:841744	854510:855054
WP_070324647.1|799024_800332_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_070324648.1|800469_802407_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	47.0	6.1e-113
WP_044582973.1|802483_803518_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.4	8.3e-16
WP_070323897.1|803651_805010_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_019089109.1|805176_805959_-	response regulator transcription factor	NA	A0A0K0PVG9	Roseobacter_phage	46.8	2.8e-16
WP_070325337.1|806337_806808_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_070324649.1|806804_809894_+	double-strand break repair protein AddB	NA	NA	NA	NA	NA
WP_070324650.1|809890_813466_+	double-strand break repair helicase AddA	NA	NA	NA	NA	NA
WP_019089112.1|813593_813920_+	thioredoxin TrxA	NA	A0A2I2L415	Orpheovirus	38.3	3.3e-11
WP_019089113.1|814103_815009_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_070323893.1|815016_816354_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_070325338.1|816610_817981_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.5	5.8e-41
WP_070324651.1|817977_818748_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003623374.1|818816_819482_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_082246830.1|819929_821114_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	24.9	2.7e-26
WP_070323890.1|821121_822285_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.0	2.0e-26
WP_070323889.1|822362_822677_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_070323888.1|822704_823787_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_070323887.1|823811_824483_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_070323886.1|824539_825634_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_167542418.1|825655_826306_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_070323885.1|826329_828942_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	45.7	8.4e-81
WP_070325339.1|829209_830157_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_070323883.1|830265_831171_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_019089127.1|831173_831746_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.7	5.6e-38
WP_070323882.1|831794_832706_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	53.8	1.5e-85
WP_070324652.1|832702_833761_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.0	9.2e-95
WP_070324653.1|833962_836110_+	GMP reductase	NA	NA	NA	NA	NA
WP_070323879.1|836164_836860_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_070323878.1|836985_838443_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_070323877.1|838562_839831_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	35.4	1.2e-61
WP_082246827.1|839852_840203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323875.1|840330_841422_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
841685:841744	attL	CTACGGCGTGTCGTCAGTTAAGCAGGATGATGATTGAGGCGAACTGCACGGCTGCGAGGA	NA	NA	NA	NA
WP_087651418.1|841697_842452_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070324575.1|844202_844562_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020944072.1|844558_844906_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_070324574.1|844969_846580_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	1.8e-113
WP_070324656.1|846861_848121_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_070323874.1|848362_848776_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_070324433.1|848911_850297_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
854510:855054	attR	TCCTCGCAGCCGTGCAGTTCGCCTCAATCATCATCCTGCTTAACTGACGACACGCCGTAGAGCCCTTTTGGAAATTCACGGATGAGCGTTTCGGCGTAGCATGAGGCTTCCCATGGCGATGTGGATCATGGCCTCTGCGACGTCGATCCGCTGTTCGTAGTCCTTCACAAGGCGACGCCAGCGGATCATCCAACCGAAGGTCCGTTCCACAACCCACCGACGCGGCAGGATTTCAAACCCTTTTGCTGTCTCTGACCGCCGGATGATCTCGACTGTGAAGTCGAGAAAAGTGGCCTTATCCATCAACTGGAGGCGGTCATAGGCTCCATCGGCAAACAGGTGCTTCACCCAAGGCCAGCGTTTACGAATGGCATCAAGGATCATCTGTCCTCCTGCACTGTCCGAAATATCGGCTGTTGTCAGCTGGACCAGGAGAAGGCGGCCATCCGTATCAACTGCGATGTGACGTTTCCGACCGACGATCTTCTTGCCTGCGTCATAACCACGTGTCTTTGCGTGGGGTGCCTTGATACTCTGGCTATCAA	NA	NA	NA	NA
>prophage 5
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1048110	1089223	2810721	transposase,integrase	Leptospira_phage(12.5%)	38	1045972:1045989	1088876:1088893
1045972:1045989	attL	TGCCAGTGCCGCACAGTT	NA	NA	NA	NA
WP_082246973.1|1048110_1048935_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070322557.1|1048974_1049322_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_070324709.1|1049402_1051094_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_070324710.1|1051097_1051874_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_070322560.1|1051902_1052829_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_070324711.1|1052917_1053598_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_070322562.1|1053602_1054034_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070322563.1|1054048_1054612_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_070322564.1|1054682_1055129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324712.1|1055155_1055518_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_070322566.1|1055567_1056053_-	bacterioferritin	NA	NA	NA	NA	NA
WP_070324713.1|1056239_1057265_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_070324714.1|1057261_1059226_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070324715.1|1059346_1059937_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_070324716.1|1060258_1061935_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_070324575.1|1062138_1062498_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020944072.1|1062494_1062842_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_070324574.1|1062905_1064516_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	1.8e-113
WP_070324717.1|1064539_1065547_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_070322572.1|1065736_1066558_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_070322573.1|1066586_1066889_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_070322574.1|1066872_1067217_+	urease subunit beta	NA	NA	NA	NA	NA
WP_070322575.1|1067213_1068920_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_070322576.1|1068919_1069405_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_070322577.1|1069382_1070081_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_070322578.1|1070077_1070692_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_070325342.1|1071044_1072166_+	porin	NA	NA	NA	NA	NA
WP_070324718.1|1072216_1072666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|1076940_1077694_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070322585.1|1078960_1080301_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070322586.1|1080293_1081898_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_070322587.1|1081894_1083034_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_070322588.1|1083030_1083771_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.9	5.0e-15
WP_070324720.1|1083809_1084505_+	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	25.4	3.4e-13
WP_070324722.1|1084901_1086092_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	45.5	9.4e-88
WP_070324723.1|1086505_1086736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070324724.1|1086849_1087695_+	hypothetical protein	NA	A0A218MKL5	uncultured_virus	35.8	2.4e-29
WP_070324433.1|1087837_1089223_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
1088876:1088893	attR	TGCCAGTGCCGCACAGTT	NA	NA	NA	NA
>prophage 6
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1136345	1244480	2810721	transposase,tRNA,bacteriocin	Paenibacillus_phage(29.41%)	89	NA	NA
WP_019087907.1|1136345_1136861_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_082246714.1|1136979_1138110_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_070324607.1|1138691_1140077_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	1.5e-33
WP_070324117.1|1141022_1141376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322619.1|1141597_1142128_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_070322620.1|1142252_1143161_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070324739.1|1143160_1143967_+	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	4.6e-14
WP_019087914.1|1143967_1144762_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_070322622.1|1144963_1145467_-	flavin reductase	NA	Q9KX93	Enterobacteria_phage	52.7	1.6e-20
WP_070324740.1|1145532_1146552_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_070324433.1|1147299_1148685_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070324741.1|1148827_1149802_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_087651418.1|1149864_1150619_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070324742.1|1151199_1153455_-	FUSC family protein	NA	NA	NA	NA	NA
WP_070322626.1|1153444_1153963_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070322627.1|1154535_1154964_+	DUF1636 domain-containing protein	NA	NA	NA	NA	NA
WP_019087921.1|1154960_1156013_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_070322628.1|1156032_1159497_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_070322629.1|1159493_1160855_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_070324743.1|1160965_1161580_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_070324744.1|1161576_1162203_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_070324745.1|1162217_1163738_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_070322631.1|1163752_1164391_-	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
WP_070322632.1|1164387_1165377_-	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_070322633.1|1165375_1166494_+	threonine-phosphate decarboxylase	NA	A0A1X7QHI1	Faustovirus	25.5	4.9e-06
WP_070322634.1|1166490_1167324_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_070322635.1|1167320_1168370_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_070322636.1|1168431_1168986_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_070322637.1|1169000_1170197_-	MFS transporter	NA	NA	NA	NA	NA
WP_070324746.1|1170396_1171851_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_070324747.1|1171956_1173276_-	cytochrome c	NA	NA	NA	NA	NA
WP_157886573.1|1175234_1175989_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	7.1e-25
WP_070324749.1|1176581_1177046_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_070324750.1|1177403_1178996_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_070322645.1|1179358_1180663_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_157886563.1|1180939_1181694_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070322646.1|1181897_1182953_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_070322647.1|1183073_1183988_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324751.1|1184674_1185697_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_070324752.1|1185958_1187344_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_070322624.1|1187831_1188911_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070324753.1|1189727_1190303_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_070324754.1|1190327_1191653_-	MFS transporter	NA	NA	NA	NA	NA
WP_070324433.1|1193567_1194953_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070323607.1|1195498_1196986_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_070323605.1|1197555_1199202_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_070324756.1|1199431_1200586_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003625884.1|1200605_1200965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323603.1|1201064_1202330_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_070323602.1|1202326_1202800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324757.1|1202799_1203534_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_070323601.1|1203530_1204490_+	oxidoreductase	NA	NA	NA	NA	NA
WP_070325346.1|1204495_1205464_+	ketopantoate reductase	NA	NA	NA	NA	NA
WP_020944421.1|1205484_1206243_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_070324758.1|1206239_1206716_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_070323599.1|1206759_1207995_+	amidase	NA	NA	NA	NA	NA
WP_014457350.1|1208041_1208533_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070324759.1|1208803_1209760_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087651418.1|1210607_1211361_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070323596.1|1211504_1212908_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_070324760.1|1212996_1214424_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_070323594.1|1214522_1215335_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070324761.1|1215331_1216315_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.1	5.8e-27
WP_070323593.1|1216295_1216970_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070323592.1|1217023_1218238_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_070324762.1|1218603_1219683_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003626381.1|1219879_1220248_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070324763.1|1220350_1221511_-	serine hydrolase	NA	A0A2P0ZZM8	Mycobacterium_phage	25.3	2.3e-06
WP_070323590.1|1221556_1222225_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_070324764.1|1222334_1222721_+	toxin-antitoxin system protein HicB	NA	NA	NA	NA	NA
WP_070325347.1|1222792_1224247_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_169818447.1|1224243_1224423_-	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_070323587.1|1224598_1225090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082247000.1|1225122_1226268_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_070324765.1|1226272_1226629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070323585.1|1226630_1227353_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_070324766.1|1227349_1228321_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_070323583.1|1228368_1229031_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_070324767.1|1229085_1229580_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_070323582.1|1229835_1230183_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_019088513.1|1230175_1230889_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_070323581.1|1230916_1231558_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_087651418.1|1232206_1232961_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070324769.1|1233801_1235202_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_070322815.1|1237033_1237393_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020944072.1|1237389_1237737_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_070324770.1|1237800_1239411_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.9e-112
WP_082246974.1|1241201_1242587_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.5	3.8e-32
WP_070323556.1|1243685_1244480_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
>prophage 7
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1269207	1335955	2810721	transposase,tRNA,protease	uncultured_Mediterranean_phage(30.77%)	44	NA	NA
WP_044582826.1|1269207_1269855_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	36.7	2.0e-31
WP_070323546.1|1269993_1271007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323545.1|1271076_1272171_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_026019183.1|1272167_1272443_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_019087836.1|1272463_1273204_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_070323543.1|1273200_1274112_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_014457297.1|1274200_1274281_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_070323542.1|1274624_1275950_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_070324774.1|1275942_1276980_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_070323540.1|1277005_1278142_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_070323539.1|1278266_1279085_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019087830.1|1279145_1279931_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_019087829.1|1279927_1280296_-	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_070324227.1|1280479_1281640_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_019087827.1|1281687_1283487_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070324775.1|1283486_1284464_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_019087825.1|1284484_1285402_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.0	5.1e-25
WP_070323537.1|1285398_1286265_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	39.8	8.5e-30
WP_157885537.1|1286337_1287006_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_070323535.1|1287002_1287833_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	47.5	1.1e-53
WP_070323534.1|1287836_1289105_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.2	1.3e-84
WP_003624383.1|1289123_1289462_+	multidrug transporter	NA	NA	NA	NA	NA
WP_070324777.1|1289458_1291651_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_019087819.1|1291745_1291961_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_070323532.1|1292021_1293131_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_070324226.1|1293379_1293586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324778.1|1293649_1295485_-	FUSC family protein	NA	NA	NA	NA	NA
WP_070324779.1|1295606_1296503_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324780.1|1296528_1296948_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_070323530.1|1305888_1306278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886574.1|1307585_1308673_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
WP_082247001.1|1309876_1310413_-	SCO family protein	NA	NA	NA	NA	NA
WP_041247965.1|1313936_1314959_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_070324784.1|1317660_1319271_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	2.3e-113
WP_020944072.1|1319334_1319682_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_070324785.1|1319678_1320038_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_019088667.1|1321528_1322374_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_157886576.1|1322459_1323646_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_070323529.1|1323791_1325150_-	amidase	NA	NA	NA	NA	NA
WP_070323528.1|1325308_1326250_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324433.1|1328547_1329933_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_019088008.1|1330312_1331383_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.2	3.7e-75
WP_070324787.1|1332972_1333995_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_070324433.1|1334569_1335955_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
>prophage 8
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1342130	1400552	2810721	transposase,tRNA	Streptococcus_phage(55.56%)	42	NA	NA
WP_070324433.1|1342130_1343516_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_082247005.1|1343658_1344060_-	response regulator	NA	NA	NA	NA	NA
WP_070324792.1|1344080_1348010_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070323505.1|1348015_1350913_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_082247063.1|1350931_1352590_-	alginate export family protein	NA	NA	NA	NA	NA
WP_070324794.1|1352598_1353783_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_070323501.1|1354009_1354639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324796.1|1355305_1356385_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070324797.1|1356835_1360537_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_035366585.1|1360589_1362122_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	36.7	1.6e-18
WP_007396165.1|1362124_1362820_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_035366587.1|1362816_1363521_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_070323498.1|1363530_1364385_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_062144438.1|1364434_1364920_+	HPP family protein	NA	NA	NA	NA	NA
WP_157885533.1|1364999_1365386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324799.1|1365672_1367286_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_070323495.1|1367506_1367971_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324800.1|1368268_1369654_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	7.7e-33
WP_082247006.1|1369832_1370705_+	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_070324801.1|1370727_1371699_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025829448.1|1373117_1373393_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_025440047.1|1373434_1374544_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	2.6e-31
WP_070324803.1|1374603_1375005_+	VOC family protein	NA	NA	NA	NA	NA
WP_070324804.1|1376107_1376461_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_070324805.1|1377534_1378017_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324405.1|1379111_1380497_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
WP_070324806.1|1381068_1382094_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.3	7.2e-20
WP_070324807.1|1382355_1383741_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	5.5e-31
WP_070324808.1|1385810_1386794_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_070323490.1|1386821_1387850_+	methionine synthase	NA	NA	NA	NA	NA
WP_070324809.1|1388170_1389070_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324810.1|1389118_1390486_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.6	4.6e-115
WP_070323487.1|1390831_1391137_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_070323486.1|1391133_1391385_-	antitoxin	NA	NA	NA	NA	NA
WP_157886579.1|1391722_1392428_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070324426.1|1392571_1393957_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	2.5e-31
WP_082246867.1|1395756_1395855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323479.1|1395908_1396793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324811.1|1396873_1397854_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_070323477.1|1397880_1398738_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_070324812.1|1398784_1399771_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_099046885.1|1399795_1400552_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1495701	1671815	2810721	transposase,tail,plate,head,capsid,terminase,tRNA,portal,protease,integrase	Streptococcus_phage(10.64%)	162	1628670:1628684	1659470:1659484
WP_019089200.1|1495701_1497030_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070323423.1|1497086_1497506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089198.1|1497502_1498750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089197.1|1498830_1500210_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_070323421.1|1500309_1500495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019089195.1|1500501_1500906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019089194.1|1500902_1501502_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.6	6.9e-23
WP_019089193.1|1501674_1502133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323420.1|1502184_1503009_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_087651418.1|1503114_1503868_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070324847.1|1503925_1506601_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	43.1	1.1e-91
WP_070323418.1|1506824_1508912_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	39.7	4.2e-115
WP_070325357.1|1508904_1510638_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_070324848.1|1510795_1511833_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_070324849.1|1511929_1512910_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_070324850.1|1513063_1514578_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_070324851.1|1514664_1516101_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_019089184.1|1516093_1517056_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_019089183.1|1517052_1517991_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_070324852.1|1517987_1518932_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_070324853.1|1518928_1520362_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_070323411.1|1520358_1521507_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_003623071.1|1521503_1522667_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_019089179.1|1522674_1524090_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_070323409.1|1524086_1525181_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_070324854.1|1525180_1526566_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_070324855.1|1526562_1528032_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_070323406.1|1528028_1530047_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_070324856.1|1530079_1531069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070323404.1|1531073_1532081_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_070325358.1|1532077_1532563_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_070324857.1|1533339_1534398_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	34.4	4.5e-25
WP_070324858.1|1534413_1534860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089170.1|1534856_1536491_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.3	1.1e-67
WP_003623048.1|1536586_1536859_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	61.0	2.1e-19
WP_026019365.1|1536882_1537536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324859.1|1537541_1538669_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.4	8.9e-56
WP_070324860.1|1538723_1539743_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_019089166.1|1539851_1540121_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_026019364.1|1540169_1540484_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_082246785.1|1541022_1541211_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_070324358.1|1542717_1543923_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_070323397.1|1544043_1544397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886580.1|1544770_1544923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324863.1|1546084_1547470_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.5	8.5e-32
WP_070323395.1|1548239_1548710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324864.1|1548728_1549964_+	TolC family protein	NA	NA	NA	NA	NA
WP_070324214.1|1549960_1551115_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_070324865.1|1551114_1554189_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_070323392.1|1554188_1554860_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_070323391.1|1554856_1556209_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_070324866.1|1556342_1557047_+	VIT family protein	NA	NA	NA	NA	NA
WP_070324433.1|1557324_1558710_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_087651418.1|1559723_1560478_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_157886574.1|1560612_1561700_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
WP_011252535.1|1563086_1563884_-|transposase	IS5-like element IS12528 family transposase	transposase	NA	NA	NA	NA
WP_070324433.1|1563988_1565374_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070324751.1|1567409_1568432_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_070324868.1|1571371_1572328_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_070324869.1|1572379_1573084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624576.1|1573186_1573429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070323387.1|1573652_1575011_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.3	8.0e-35
WP_070324870.1|1575058_1576375_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_003624573.1|1576503_1577016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324871.1|1577133_1577685_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_019088193.1|1577868_1578507_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_019088194.1|1578525_1579299_-	ubiquinol-cytochrome c reductase	NA	NA	NA	NA	NA
WP_070324213.1|1579298_1580540_-	cytochrome b N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_082246782.1|1581192_1582245_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.2	4.8e-19
WP_070323382.1|1582226_1582829_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	32.7	8.5e-21
WP_019088198.1|1582813_1584157_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	42.2	1.6e-80
WP_070324872.1|1584194_1584680_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	38.3	7.3e-23
WP_070324873.1|1584750_1585761_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_070325359.1|1585875_1588470_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_070323380.1|1588572_1589832_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003624557.1|1589933_1590170_-	DUF3297 family protein	NA	NA	NA	NA	NA
WP_070323379.1|1590271_1591036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019088204.1|1591077_1592040_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003624554.1|1592055_1592256_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_070323378.1|1592257_1594342_-	FUSC family protein	NA	NA	NA	NA	NA
WP_070323377.1|1594656_1595805_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_070324874.1|1595801_1598507_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_019088208.1|1598490_1599957_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_070323374.1|1600172_1600727_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_070323373.1|1600719_1601298_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_082247011.1|1601354_1601966_-	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	48.9	2.3e-45
WP_070323372.1|1602005_1602476_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_070324875.1|1602595_1603804_-	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_082247012.1|1604088_1605588_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.0	2.6e-50
WP_082247013.1|1607673_1608792_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_070323368.1|1608961_1609375_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.9	7.8e-42
WP_070323367.1|1609397_1610618_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	42.9	1.4e-83
WP_070323366.1|1610672_1611542_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_044582870.1|1611691_1612054_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_019088222.1|1612085_1614356_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_070324877.1|1614439_1615387_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	26.4	3.9e-20
WP_026019237.1|1615394_1616381_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_070324878.1|1616377_1617313_+|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_070325363.1|1617366_1617831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886601.1|1618025_1619369_-	ammonium transporter	NA	NA	NA	NA	NA
WP_070324880.1|1619552_1620884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324881.1|1620937_1622761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324882.1|1622826_1624296_-	discoidin domain-containing protein	NA	A0A0P0YM34	Yellowstone_lake_phycodnavirus	37.7	1.3e-27
WP_070324883.1|1624631_1626836_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_070324885.1|1627160_1628801_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.8	2.8e-175
1628670:1628684	attL	GAAGCTCTTGTCCAG	NA	NA	NA	NA
WP_026019247.1|1628854_1629148_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.1	1.4e-21
1628670:1628684	attL	GAAGCTCTTGTCCAG	NA	NA	NA	NA
WP_070324886.1|1629358_1630027_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_003625755.1|1630170_1630374_+	cold-shock protein	NA	A0A218MMZ6	uncultured_virus	51.5	1.3e-13
WP_070324887.1|1630392_1633350_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	31.9	7.4e-09
WP_026019249.1|1633482_1634313_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_070324888.1|1634358_1634925_-	elongation factor P	NA	NA	NA	NA	NA
WP_070324889.1|1635335_1636553_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	50.5	5.6e-112
WP_157886581.1|1636660_1637416_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_157886582.1|1637408_1637741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325364.1|1637749_1638361_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	40.2	1.7e-37
WP_070324575.1|1638956_1639316_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020944072.1|1639312_1639660_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_070324574.1|1639723_1641334_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	1.8e-113
1639832:1639846	attR	GAAGCTCTTGTCCAG	NA	NA	NA	NA
WP_070324893.1|1641387_1641663_-	hypothetical protein	NA	NA	NA	NA	NA
1639832:1639846	attR	GAAGCTCTTGTCCAG	NA	NA	NA	NA
WP_003631324.1|1641659_1641863_-	AlpA family phage regulatory protein	NA	A0A2L0V109	Agrobacterium_phage	46.3	1.1e-09
WP_070324894.1|1641859_1642264_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070324895.1|1642242_1642584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324896.1|1642583_1642814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324897.1|1642810_1643068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324898.1|1643064_1643406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082247015.1|1643499_1644006_+	hypothetical protein	NA	J7HXA3	Pseudomonas_phage	32.6	1.4e-08
WP_070324900.1|1643890_1644547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886583.1|1644637_1644988_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070324902.1|1645062_1645284_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070324903.1|1645358_1645874_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003631109.1|1645967_1646456_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_070324906.1|1646906_1647407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324907.1|1647524_1648697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324908.1|1648693_1649257_+	hypothetical protein	NA	W5RVC2	Staphylococcus_phage	32.8	1.2e-21
WP_070324910.1|1649486_1649708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082247065.1|1650130_1650427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324911.1|1650562_1650970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324912.1|1651118_1651994_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A068F1P9	Mycobacterium_phage	29.2	1.9e-08
WP_070324913.1|1651998_1652631_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	44.5	4.9e-43
WP_020944001.1|1652627_1652792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324915.1|1653009_1653666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324916.1|1653812_1654337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324917.1|1654299_1656318_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.6	2.1e-140
WP_003630354.1|1656329_1656632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324918.1|1656631_1658281_+|portal	phage portal protein	portal	V5Q9Y6	Xylella_phage	36.3	1.2e-80
WP_003630351.1|1658277_1659108_+	S49 family peptidase	NA	A0A1B2LRQ7	Wolbachia_phage	38.9	5.2e-37
WP_070324919.1|1659134_1659734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324920.1|1659730_1660120_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	33.3	6.7e-11
WP_070325366.1|1660202_1661264_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.3	3.1e-50
WP_070324921.1|1661267_1661549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324922.1|1661550_1661952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886584.1|1662001_1662412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070324924.1|1662421_1662625_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_070324925.1|1662625_1664101_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003630341.1|1664112_1664496_+|tail	tail protein	tail	NA	NA	NA	NA
WP_070324926.1|1664498_1665143_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_162272824.1|1665440_1667213_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_070324928.1|1667217_1668516_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	25.0	8.0e-16
WP_157886585.1|1668632_1669664_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	29.7	1.5e-20
WP_070324930.1|1669663_1670194_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_070324931.1|1670195_1670696_+	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	33.3	5.1e-11
WP_070324932.1|1670699_1671815_+|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	28.6	1.5e-18
>prophage 10
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1819516	1889524	2810721	transposase,tRNA,protease	Streptococcus_phage(18.18%)	56	NA	NA
WP_035352640.1|1819516_1820170_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	4.7e-57
WP_070324994.1|1820290_1821556_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	3.6e-130
WP_070324995.1|1821754_1824280_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.4	1.5e-204
WP_070324996.1|1824424_1824712_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	54.4	9.3e-18
WP_019088394.1|1825103_1825469_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_019088395.1|1825487_1826048_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_167542412.1|1826097_1826700_+	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_070323285.1|1826699_1827980_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_070324997.1|1827976_1828618_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_070324998.1|1828629_1829958_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_070324999.1|1829963_1832042_+	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_070325000.1|1832047_1833076_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_070325001.1|1833075_1833564_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_082247023.1|1833582_1834314_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_026019264.1|1834322_1834634_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_070325003.1|1834640_1836581_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_070325004.1|1836653_1838096_+	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_070323278.1|1838092_1838836_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003625287.1|1838840_1839650_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_070325005.1|1839659_1841303_+	ribonuclease J	NA	NA	NA	NA	NA
WP_003625290.1|1841449_1842766_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070325006.1|1842771_1844019_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_070323275.1|1844011_1844734_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	3.6e-34
WP_044582895.1|1844737_1845220_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_019088411.1|1845501_1846299_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070325007.1|1846320_1847154_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_070323272.1|1847196_1849020_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7RAT6	Paramecium_bursaria_Chlorella_virus	38.6	4.6e-102
WP_019088414.1|1849019_1850396_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
WP_070325008.1|1850478_1851177_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_070325009.1|1851190_1851997_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_070323268.1|1851993_1852779_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_019088418.1|1852775_1853870_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_070325374.1|1853866_1855066_-	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_082246774.1|1855062_1856025_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_070323267.1|1856108_1857089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325010.1|1857113_1858067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019088423.1|1858072_1859287_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	3.0e-33
WP_003625320.1|1859293_1859545_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_070325011.1|1859677_1861444_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_019088425.1|1861443_1862574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325013.1|1869776_1870244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323263.1|1870549_1871287_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_070325014.1|1871326_1872373_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_019087966.1|1872372_1873239_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_070325015.1|1873268_1875542_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087651418.1|1876327_1877082_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_082247025.1|1877296_1878874_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_070323258.1|1878873_1879827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070325016.1|1880143_1881007_+	arginine deiminase	NA	NA	NA	NA	NA
WP_070323256.1|1881042_1881987_+	glyoxylate/hydroxypyruvate reductase A	NA	M1NSB9	Streptococcus_phage	24.9	2.1e-10
WP_070325375.1|1882022_1883267_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_070323255.1|1883411_1885013_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_070323254.1|1885012_1885432_+	cytochrome c	NA	NA	NA	NA	NA
WP_070325017.1|1885789_1887175_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	6.9e-34
WP_082247026.1|1887317_1888118_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070324399.1|1888501_1889524_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.5	5.0e-21
>prophage 11
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1900008	1969007	2810721	transposase,tRNA	Streptococcus_phage(36.36%)	51	NA	NA
WP_070324433.1|1900008_1901394_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070324420.1|1902156_1903407_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_070325023.1|1903995_1905381_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_070325024.1|1905704_1906226_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_044582809.1|1906598_1908176_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_070325025.1|1908197_1909823_-	TolC family protein	NA	NA	NA	NA	NA
WP_070324433.1|1911283_1912669_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_082247028.1|1913102_1914488_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.5	1.1e-31
WP_169818443.1|1914821_1915941_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_099046885.1|1919653_1920410_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325027.1|1920814_1921585_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_019087732.1|1922821_1923802_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.4	6.7e-15
WP_070325028.1|1923798_1924842_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	8.1e-11
WP_019087730.1|1924831_1925806_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_070325029.1|1925818_1926838_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_070325030.1|1926834_1928496_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070323201.1|1928709_1930188_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	2.8e-97
WP_070325031.1|1930197_1931511_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_070325032.1|1931606_1933439_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_080585929.1|1933435_1933915_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_070325033.1|1934097_1934820_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_026019168.1|1935672_1936404_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_070323198.1|1936417_1937413_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019087719.1|1937446_1937959_-	cytochrome c	NA	NA	NA	NA	NA
WP_012813070.1|1937970_1938468_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_019087718.1|1938512_1939754_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_070325034.1|1939864_1941091_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_019087716.1|1941212_1941794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325035.1|1941931_1942669_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_070325036.1|1942675_1944664_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_019088452.1|1944668_1945607_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_044582897.1|1945608_1945839_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_070325037.1|1945934_1946186_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_070325038.1|1946301_1946961_+	ROK family protein	NA	NA	NA	NA	NA
WP_070325039.1|1947018_1948404_+|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_070324751.1|1948665_1949688_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_070323194.1|1950267_1951059_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_070324191.1|1951055_1952138_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_082247030.1|1952817_1955871_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_070325041.1|1956816_1957470_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_070323191.1|1957469_1958390_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_070325042.1|1958397_1959657_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_070323189.1|1959653_1960187_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_070325379.1|1960296_1960926_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_070323188.1|1960925_1961768_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_070325043.1|1963199_1964810_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.9e-112
WP_020944072.1|1964873_1965221_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_070322815.1|1965217_1965577_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_070325044.1|1966726_1967281_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_087651418.1|1967273_1968028_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_082247031.1|1968182_1969007_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	1983296	2059667	2810721	transposase	Streptococcus_phage(41.18%)	51	NA	NA
WP_070324433.1|1983296_1984682_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_026019267.1|1985081_1985429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325051.1|1985425_1986877_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_070324433.1|1987225_1988611_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070325052.1|1988661_1989834_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_070325053.1|1990423_1991920_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_070323173.1|1992261_1994718_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_082247066.1|1994805_1995672_+	transporter	NA	NA	NA	NA	NA
WP_026019426.1|1996700_1997636_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_070325055.1|1997642_1999577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324115.1|2000439_2001825_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	2.0e-33
WP_070323172.1|2002439_2003888_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_070325057.1|2004650_2005883_+	precorrin-3B synthase	NA	NA	NA	NA	NA
WP_070325058.1|2005869_2006499_+	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_070323170.1|2006499_2007225_+	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_070325059.1|2007221_2007980_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_070325060.1|2007949_2008753_-	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
WP_070323167.1|2008841_2010086_+	bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_070323166.1|2010082_2010457_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_070325061.1|2010457_2011216_+	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_019088931.1|2011220_2012294_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_044582946.1|2012396_2013752_-	MFS transporter	NA	NA	NA	NA	NA
WP_169818444.1|2014331_2015153_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325062.1|2015369_2016392_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.5	8.5e-21
WP_070325063.1|2016653_2018039_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_070323163.1|2018399_2019044_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_070325064.1|2019168_2019810_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_070325065.1|2019982_2021239_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_087651418.1|2021289_2022044_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070325066.1|2022226_2024740_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.1	4.8e-158
WP_070325068.1|2032482_2034669_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.5	7.5e-67
WP_157886574.1|2034951_2036038_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
WP_070324433.1|2036390_2037776_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070325069.1|2038386_2038683_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_070325070.1|2038679_2039063_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_070325071.1|2039248_2039545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325072.1|2039819_2040173_-	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_070324575.1|2040293_2040653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020944072.1|2040649_2040997_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	45.2	3.5e-11
WP_070325073.1|2041060_2042671_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.9e-112
WP_070325074.1|2043034_2044420_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	7.7e-33
WP_070325076.1|2045703_2045916_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_070324426.1|2045973_2047359_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	2.5e-31
WP_082247032.1|2047537_2048983_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_070325078.1|2048957_2049980_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	1.0e-21
WP_099046885.1|2050106_2050864_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325079.1|2051573_2052653_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070324433.1|2052872_2054258_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070325080.1|2054519_2055542_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.5	1.1e-20
WP_082247067.1|2056840_2057821_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_157886574.1|2058579_2059667_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
>prophage 13
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	2067406	2160807	2810721	transposase,tRNA	Streptococcus_phage(33.33%)	52	NA	NA
WP_070325084.1|2067406_2068792_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	1.3e-32
WP_050019145.1|2069657_2069936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325086.1|2070078_2071452_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_070323138.1|2071642_2072116_+	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_070323137.1|2072116_2072725_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082246712.1|2074193_2075018_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325088.1|2076177_2076507_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_070325385.1|2076602_2077493_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070323134.1|2077489_2078542_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.8	1.2e-14
WP_070325089.1|2078538_2079351_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.7	1.2e-14
WP_070324182.1|2079371_2079692_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_087651418.1|2080024_2080779_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070325090.1|2080809_2083701_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.9	3.3e-187
WP_082247069.1|2083826_2084066_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	58.8	6.3e-12
WP_070325092.1|2084123_2085509_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_157886574.1|2086403_2087490_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
WP_070323128.1|2087636_2088659_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_070323127.1|2088942_2089257_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070325386.1|2090993_2097020_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_070325094.1|2097909_2099295_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	5.9e-33
WP_070325095.1|2099967_2100834_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_070324115.1|2102610_2103996_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	2.0e-33
WP_082247035.1|2104340_2104724_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325097.1|2104700_2106029_-	histidine-type phosphatase	NA	NA	NA	NA	NA
WP_070323797.1|2109623_2111780_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	5.0e-31
WP_070325098.1|2111779_2113084_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_070323795.1|2113178_2113439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324252.1|2113708_2115127_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_019088751.1|2115230_2115962_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_070323793.1|2115999_2116920_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_070325099.1|2116992_2117970_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_070324515.1|2118821_2120207_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	30.1	5.3e-34
WP_070325100.1|2121848_2125388_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_070325101.1|2125406_2126051_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_019088047.1|2126912_2127392_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_070325102.1|2127403_2128318_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.7	1.7e-36
WP_070325103.1|2131481_2132867_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	1.1e-31
WP_157886559.1|2133658_2134415_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325105.1|2136769_2137417_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_019088921.1|2137437_2138193_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_070322624.1|2139642_2140722_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070323099.1|2140884_2141187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070323098.1|2141234_2142035_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_082246712.1|2142794_2143619_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325106.1|2144019_2145330_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_070324350.1|2145604_2146537_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	43.4	5.1e-57
WP_157886589.1|2146560_2146797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|2149764_2150518_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070325109.1|2156379_2157765_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_070325110.1|2158026_2159049_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.2	2.5e-20
WP_070323090.1|2159531_2159954_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_157886590.1|2160052_2160807_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	1.2e-24
>prophage 14
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	2207552	2249818	2810721	transposase,integrase	Bacillus_phage(18.18%)	38	2218348:2218370	2251763:2251785
WP_070325131.1|2207552_2208938_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_070323061.1|2209940_2210708_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_070325132.1|2210711_2211503_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	5.2e-26
WP_070325133.1|2211539_2212070_-	DUF2165 domain-containing protein	NA	NA	NA	NA	NA
WP_070325134.1|2212218_2213232_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_070323058.1|2213228_2214599_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_070323057.1|2214628_2215501_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_070323056.1|2215517_2216432_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_087651418.1|2217513_2218268_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
2218348:2218370	attL	GCTTAACTGACGACACGCCGTAG	NA	NA	NA	NA
WP_070324176.1|2218812_2219154_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_070323054.1|2219368_2220484_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.9	1.7e-35
WP_070325135.1|2220499_2222551_-	alpha,alpha-trehalase TreF	NA	NA	NA	NA	NA
WP_070325136.1|2222616_2224425_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	23.7	6.7e-29
WP_070323051.1|2224476_2225226_-	response regulator	NA	NA	NA	NA	NA
WP_082246746.1|2225383_2225860_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.4	5.2e-05
WP_019090335.1|2225967_2226561_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_019090334.1|2226566_2226848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325390.1|2226949_2228632_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_070323049.1|2228724_2230449_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.3	2.1e-24
WP_070323048.1|2230451_2232146_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.5	4.2e-17
WP_019090330.1|2232222_2232600_+	OmpA family protein	NA	NA	NA	NA	NA
WP_070325137.1|2232604_2234485_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.6	6.2e-78
WP_019090328.1|2234481_2235252_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_019090327.1|2235392_2236913_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_082246745.1|2236958_2237789_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_070325138.1|2237816_2239316_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_019090324.1|2239380_2239899_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_006115317.1|2240037_2240514_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_026019509.1|2240574_2241099_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_070323044.1|2241067_2242057_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_070323043.1|2242081_2243230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324174.1|2243216_2244104_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_019090318.1|2244170_2244503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325391.1|2244533_2244821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886574.1|2244857_2245944_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
WP_070325139.1|2245997_2247608_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.2	3.9e-113
WP_070325141.1|2248084_2249164_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082247040.1|2249182_2249818_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A2L0V119	Agrobacterium_phage	46.1	5.1e-40
2251763:2251785	attR	GCTTAACTGACGACACGCCGTAG	NA	NA	NA	NA
>prophage 15
NZ_CP015168	Acetobacter ascendens strain LMG 1591 chromosome, complete genome	2810721	2633557	2685787	2810721	transposase,protease	Prochlorococcus_phage(11.11%)	45	NA	NA
WP_070322624.1|2633557_2634637_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_169818446.1|2635181_2636198_-	ATP-sensitive potassium channel protein	NA	NA	NA	NA	NA
WP_070322842.1|2636338_2637715_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_070322841.1|2637743_2638682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019090005.1|2638678_2639629_-	MCE family protein	NA	NA	NA	NA	NA
WP_070325262.1|2639628_2640330_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_019090003.1|2640331_2641228_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_070325263.1|2641224_2643543_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_070325264.1|2643713_2645204_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_070325265.1|2645301_2647587_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_070322836.1|2647747_2648515_-	chromosomal replication initiator DnaA	NA	NA	NA	NA	NA
WP_070325266.1|2648626_2649709_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	5.8e-52
WP_070322835.1|2649705_2650329_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_070325267.1|2650374_2651697_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_019089995.1|2651770_2652448_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_070325268.1|2652547_2654335_+	heparinase II/III family protein	NA	NA	NA	NA	NA
WP_070325269.1|2654344_2655454_+	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	24.6	8.9e-08
WP_070325405.1|2655479_2655977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070322830.1|2656157_2656832_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	46.1	1.3e-46
WP_070325270.1|2656828_2657416_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_070322828.1|2657432_2658299_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_070322827.1|2658295_2659075_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_019089987.1|2659177_2659498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089986.1|2659534_2659729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325271.1|2659737_2661186_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_019089983.1|2661450_2662794_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_070325272.1|2662790_2665586_+	DUF4175 domain-containing protein	NA	NA	NA	NA	NA
WP_070325273.1|2665675_2666662_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.1	3.8e-50
WP_070322822.1|2666651_2667413_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_070322821.1|2667528_2668512_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.3	5.8e-19
WP_070325274.1|2668528_2668849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070324115.1|2670034_2671420_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	2.0e-33
WP_019089976.1|2671764_2672583_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.1	9.1e-34
WP_070325275.1|2673119_2673611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325276.1|2676322_2676673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|2677021_2677775_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070325277.1|2677896_2678145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325278.1|2678966_2679290_-	Myb-like DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070325279.1|2679286_2679538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812727.1|2679534_2679726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324420.1|2680678_2681929_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157886594.1|2682683_2682959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325281.1|2682997_2683330_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_006116155.1|2683326_2683581_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_157886574.1|2684699_2685787_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	1.7e-06
>prophage 1
NZ_CP015169	Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence	259464	94378	124730	259464	transposase	Streptococcus_phage(62.5%)	20	NA	NA
WP_070324405.1|94378_95764_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
WP_070324405.1|96977_98363_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
WP_070325563.1|99200_99734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325458.1|99733_100909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325564.1|101637_102300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061499311.1|104703_105117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325461.1|105498_106113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325462.1|106109_107123_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_082247082.1|107192_107540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052013654.1|107808_108087_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	58.4	4.0e-18
WP_070325463.1|108840_110160_+	replication protein C	NA	NA	NA	NA	NA
WP_070325465.1|110565_111951_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	1.5e-33
WP_070325466.1|112272_113319_+	Fic family protein	NA	S4TP71	Salmonella_phage	28.0	5.1e-05
WP_070325467.1|113331_114417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070324405.1|117262_118648_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	4.5e-33
WP_070325468.1|119253_119586_+	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_070325469.1|119588_120080_+	type II toxin-antitoxin system YhaV family toxin	NA	Q8HA46	Vibrio_phage	41.8	8.7e-24
WP_012813162.1|120513_120786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325023.1|121362_122748_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_082246712.1|123905_124730_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015169	Acetobacter ascendens strain LMG 1591 plasmid unnamed1, complete sequence	259464	129676	195756	259464	integrase,tRNA,transposase	Streptococcus_phage(35.0%)	55	124777:124795	201281:201299
124777:124795	attL	GAATTTCCAAAAGGGCTCT	NA	NA	NA	NA
WP_070325472.1|129676_131062_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	6.5e-32
WP_070324575.1|131252_131612_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	44.1	1.3e-05
WP_020944072.1|131608_131956_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	52.4	1.5e-25
WP_070324574.1|132019_133630_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	1.8e-113
WP_070322624.1|134030_135110_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325473.1|135438_135699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886608.1|136643_138860_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_070325476.1|139906_143086_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.4	5.1e-72
WP_070325477.1|143082_144330_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003630865.1|144342_144645_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_070325478.1|144641_145046_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_070325479.1|145042_146656_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	28.7	5.6e-43
WP_070325480.1|147214_148216_-	TniQ family protein	NA	NA	NA	NA	NA
WP_070325481.1|148208_149132_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_070325566.1|149134_150790_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_070325482.1|150996_151476_-	hypothetical protein	NA	S5VW65	Mycobacterium_phage	41.3	5.5e-15
WP_070324433.1|151891_153277_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_070325483.1|153385_153784_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_003631349.1|154102_154369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631350.1|154399_154735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325484.1|154776_155871_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_035366746.1|156668_157652_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_062143070.1|157679_158708_+	methionine synthase	NA	NA	NA	NA	NA
WP_070325485.1|159026_159926_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070324115.1|161232_162618_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	2.0e-33
WP_157885560.1|162738_163056_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	46.2	6.4e-20
WP_124307272.1|163625_165344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019089587.1|165373_165607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325486.1|166446_167466_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_070325487.1|167577_168963_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_029604385.1|170924_172358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813340.1|172463_172688_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070325489.1|172687_173092_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_070324433.1|173481_174867_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	3.4e-33
WP_082247085.1|174998_175169_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_012813344.1|175169_175475_+	CcdB family protein	NA	NA	NA	NA	NA
WP_070325490.1|175607_176441_-	TIGR02391 family protein	NA	A0A059NT45	Lactococcus_phage	27.2	2.1e-25
WP_070325491.1|176409_177267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325492.1|177605_178661_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	55.5	1.3e-77
WP_070325493.1|178669_179368_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.9	5.0e-81
WP_070325494.1|179389_180685_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.8	4.4e-131
WP_070325495.1|180684_181107_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.2	3.3e-48
WP_082247086.1|181103_181457_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061499378.1|181534_182230_-	VIT family protein	NA	NA	NA	NA	NA
WP_070325567.1|182426_182993_+	cytochrome b	NA	NA	NA	NA	NA
WP_070325496.1|183156_184377_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_070325497.1|184827_186018_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_070325498.1|186037_186949_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	27.1	3.1e-22
WP_019092466.1|187238_187565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070325500.1|187692_188682_+	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_070325501.1|189188_190049_-	EamA family transporter	NA	NA	NA	NA	NA
WP_070325502.1|190776_192078_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.3e-29
WP_070325503.1|192697_193627_+	oxidoreductase	NA	NA	NA	NA	NA
WP_070325504.1|193709_194228_+	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_070325505.1|194370_195756_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.3	5.9e-33
201281:201299	attR	GAATTTCCAAAAGGGCTCT	NA	NA	NA	NA
>prophage 1
NZ_CP015170	Acetobacter ascendens strain LMG 1591 plasmid unnamed2, complete sequence	117661	6025	74721	117661	integrase,tRNA,transposase	Streptococcus_phage(33.33%)	55	3509:3523	13019:13033
3509:3523	attL	AAGAATTTTTCCCTT	NA	NA	NA	NA
WP_070325573.1|6025_7516_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157886574.1|7592_8680_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.1e-42
WP_006115563.1|9352_9631_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	47.8	4.9e-16
WP_081461411.1|9634_9928_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_070325574.1|10120_11200_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325575.1|11377_13600_-	TonB-dependent receptor	NA	NA	NA	NA	NA
13019:13033	attR	AAGAATTTTTCCCTT	NA	NA	NA	NA
WP_070325576.1|13675_14257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082247102.1|14308_14488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325577.1|14577_15642_+	TonB family protein	NA	NA	NA	NA	NA
WP_070325578.1|15885_16965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157886618.1|17110_18197_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-42
WP_070325580.1|18223_19219_+	Fic family protein	NA	S4TP71	Salmonella_phage	28.0	4.9e-05
WP_070324607.1|20062_21448_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.9	1.5e-33
WP_070325581.1|21505_21865_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070325582.1|21955_22999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006115566.1|22998_23490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070325583.1|23455_23866_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_035366749.1|24780_25272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026019419.1|25273_25726_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_070325584.1|25814_27131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|28680_29434_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_070324420.1|29563_30814_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_070325586.1|31785_33171_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	1.9e-31
WP_070325589.1|34450_35530_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070325590.1|36466_36832_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_003631279.1|36893_37283_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_023524174.1|37279_37552_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_019089624.1|37565_37781_-	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_006115867.1|37816_38395_+	DUF488 domain-containing protein	NA	A0A2K9L455	Tupanvirus	40.0	5.1e-23
WP_157886619.1|38874_39093_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006115571.1|39126_39765_-	HPP family protein	NA	NA	NA	NA	NA
WP_070325592.1|39973_41359_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	3.2e-31
WP_070324399.1|41620_42643_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.5	5.0e-21
WP_070325593.1|45245_46679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813340.1|46784_47009_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070325489.1|47008_47413_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_080587162.1|47562_47808_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_042788970.1|47808_48114_+	CcdB family protein	NA	NA	NA	NA	NA
WP_070325618.1|48393_49008_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.7	1.6e-38
WP_070325023.1|51404_52790_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_169818449.1|53730_53901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070325595.1|53927_57062_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	2.1e-62
WP_070325596.1|57061_58096_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_062105906.1|58092_59352_-	TolC family protein	NA	NA	NA	NA	NA
WP_010516881.1|59527_60178_-	cation transporter	NA	NA	NA	NA	NA
WP_070325597.1|60251_60650_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082247105.1|61096_62482_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.5	5.0e-32
WP_082247106.1|62498_62813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099046885.1|63312_64069_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	1.3e-10
WP_070325023.1|65449_66835_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_070325478.1|67899_68304_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003630865.1|68300_68603_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_070325477.1|68615_69863_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_070325599.1|69859_73039_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.4	5.1e-72
WP_157886562.1|73535_74721_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	5.2e-22
