The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	1225743	1232794	5404558	tail,transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|1225743_1226957_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1227174_1227444_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1227604_1228027_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1228156_1229215_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1229293_1229944_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1230126_1230717_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1231218_1231467_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1232311_1232794_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	1511690	1518429	5404558	integrase,transposase	Enterobacteria_phage(50.0%)	6	1499364:1499380	1520625:1520641
1499364:1499380	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1511690_1512260_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|1512399_1513612_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000960724.1|1514026_1514707_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1514716_1515853_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1516027_1517185_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1517496_1518429_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1520625:1520641	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	1743723	1834557	5404558	protease,tRNA,tail,holin,transposase,portal,lysis,terminase	Enterobacteria_phage(54.0%)	83	NA	NA
WP_000968210.1|1743723_1744419_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1744415_1744814_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1744944_1745853_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1745979_1747338_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1747349_1748378_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1748392_1749094_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1749102_1749747_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1749761_1750955_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1751114_1752065_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1752452_1752536_-	protein YohP	NA	NA	NA	NA	NA
WP_001078131.1|1752759_1754196_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1754248_1755010_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1755139_1755718_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1755887_1756475_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1756648_1757581_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1757618_1759334_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1759529_1761827_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1762078_1762996_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1763002_1764160_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1764152_1765079_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1765083_1765815_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1765795_1765903_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1765962_1766664_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_171878939.1|1767802_1769015_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.7e-167
WP_001301135.1|1769335_1769485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070080197.1|1769542_1771069_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.9	7.9e-31
WP_001053042.1|1771570_1772026_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_000224907.1|1772025_1772196_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774495.1|1772188_1772479_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099699.1|1772475_1772838_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971055.1|1772834_1772975_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1773060_1773495_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1773746_1773899_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1774702_1776649_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1776786_1776966_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1777006_1777252_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1777329_1777545_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1777549_1778083_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1778353_1778923_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1778922_1779069_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1779296_1779482_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1779999_1780476_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077630.1|1780472_1782596_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1782592_1782805_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1782804_1784307_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1784251_1786276_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1786363_1786690_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|1786682_1786964_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974959.1|1786966_1787590_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|1787602_1788001_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|1788008_1788761_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|1788774_1789203_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|1789229_1789538_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|1789581_1792227_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|1792223_1792553_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1792552_1793251_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|1793256_1794000_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|1793945_1794575_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080213.1|1794815_1798295_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230459.1|1798361_1798961_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080201.1|1799025_1800339_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	2.8e-77
WP_001023407.1|1800340_1800610_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_075702011.1|1800770_1801187_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	99.3	1.4e-75
WP_001143784.1|1801268_1801910_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1802071_1802320_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1802834_1804520_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1804516_1805236_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1805282_1805753_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1805794_1806256_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001459147.1|1806380_1808384_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1808380_1809517_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1809509_1810241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1810259_1811789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1811799_1812888_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1814128_1814446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1814507_1818137_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1825094_1827128_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1827259_1828369_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1828630_1828912_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1829203_1829746_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1829833_1830508_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1830523_1833004_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162829202.1|1833344_1834557_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 4
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	1943374	2022042	5404558	protease,tail,integrase,holin,transposase,head,lysis,terminase	Stx2-converting_phage(49.4%)	97	1934325:1934339	1949752:1949766
1934325:1934339	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1943374_1944553_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1944533_1944725_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1944806_1945151_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1945338_1945689_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1945685_1946042_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|1946555_1947503_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1947499_1947721_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000188870.1|1947819_1948035_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548528.1|1948111_1948303_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1948275_1948458_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|1948454_1949135_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|1949131_1949917_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1949752:1949766	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_162829202.1|1950192_1951405_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000372937.1|1951606_1951750_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1951718_1951883_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1951955_1952324_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1952506_1952758_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1952816_1953089_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1953066_1953249_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1953817_1954339_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_171878941.1|1954520_1955733_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001302016.1|1956153_1956849_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1956923_1957139_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1957280_1957577_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1957609_1957771_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539352.1|1957757_1958579_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	99.6	4.4e-153
WP_001248388.1|1958575_1959952_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1960022_1960301_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1960433_1960649_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1960659_1960896_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1960852_1961299_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1961295_1961823_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1961819_1962002_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|1962276_1962981_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001108016.1|1963778_1964384_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	99.5	4.3e-97
WP_001028855.1|1964380_1965052_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
WP_000512807.1|1965042_1965531_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1966169_1967129_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1967140_1967410_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1967706_1968030_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_021503541.1|1968273_1970211_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|1970348_1970528_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1970568_1970841_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1970917_1971133_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1971132_1971630_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1971626_1972064_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1972266_1972764_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1972760_1973018_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1973480_1973708_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1973749_1974115_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958398.1|1974407_1974971_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_070080204.1|1974967_1976629_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_001063023.1|1978673_1978895_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|1981421_1981748_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1981757_1982108_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1982104_1982551_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1982547_1982892_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|1982950_1983667_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1983672_1984047_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1984142_1984352_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080206.1|1984403_1987646_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_000807954.1|1987638_1987980_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080207.1|1987979_1988678_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	4.3e-133
WP_001302649.1|1988694_1989015_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1989122_1989296_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1989366_1990290_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_021498910.1|1990344_1991082_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	100.0	3.1e-150
WP_134791867.1|1991027_1991660_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_001171540.1|1991993_1992374_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1992370_1992718_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1992767_1994306_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_070080208.1|1994348_1997828_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230459.1|1997894_1998494_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080209.1|1998558_1999872_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001509711.1|1999873_2000143_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	1.1e-44
WP_000491542.1|2000283_2001159_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2001383_2002034_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2003357_2004524_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105392.1|2004642_2005116_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2005314_2006373_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2006544_2006874_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2006974_2007157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2007645_2007759_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2007771_2007966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2008424_2008793_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2008866_2009088_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2009150_2009627_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2009641_2010121_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_024177368.1|2010202_2011024_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.4e-45
WP_000846711.1|2011244_2011655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2011670_2012354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2012489_2013560_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2013556_2014462_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2014458_2015340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171878943.1|2015323_2016537_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	1.3e-164
WP_000966626.1|2016908_2019056_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2020503_2022042_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	2041210	2089027	5404558	tail,integrase,holin,transposase,portal,head,capsid,terminase	Escherichia_phage(40.48%)	53	2041157:2041216	2066187:2067498
2041157:2041216	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|2041210_2042423_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2046707_2047505_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2047740_2048763_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2048762_2048966_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_070080211.1|2049024_2051496_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2051591_2051780_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2051776_2051965_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2052445_2052598_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2052872_2053517_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2053614_2053842_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2053838_2054264_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2054332_2055370_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2055281_2055824_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2055858_2056557_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2056578_2056803_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2056799_2057156_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2057188_2057341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2057337_2057649_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2057775_2058339_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2058448_2058553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2058739_2058952_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2059119_2059398_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_070080212.1|2059399_2060449_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.4e-108
WP_001217457.1|2060461_2060821_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2060817_2061507_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303558.1|2062140_2062569_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_162829202.1|2064978_2066192_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2066502_2066718_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2066722_2067067_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2067117_2067651_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
2066187:2067498	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCATACTGGCTAAGAAGGATAGTTGGGTTTCACATGATACTTATATCTGGCAGTACATTTTCTGACAGACAGTGATGGGTGTTGTCAAGATATTGTGTCATTTATAACCTGAATCAGGGGGGGGAGCCGGAATGTTATCTGGCATTTTTAGCAGAGCCTGAATGCCATAATCACGGCTCCCGGCGTTGGCCGTCAGTGGGCGACACTGGCGGCTTTTTGTTTTCCTTTACTTTCATTTTCTGTCGGCGGTGACGGAGACATACATCAGATGGAAAAAATCACAACAGGTGTGTCATACACCACGTCAGCGGTGGGGACGGGATACTGGTTACTGCAGCTGCTGGACAAAGTCTCTCCGTCCCAGTGGGTGGCAATCGGTGTGCTGGGGAGTCTGCTGTTTGGCCTGCTGACGTATCTGACTAACCTGTATTTCAAAATCAGAGAGGACCGTCGTAAGGCGGCGCGGGGGGAGTAAAGCGATGAAGAAAAAATACGAACTGGGTGTTAAAGGGATAAATAATTACCCGGATAAGATTACTGTTACTGTGGCACCGGAAATTGGTGGGTATCCGTCACTGTTGTTGCCAGATGTGGCGATTAGTCTTGACCGTACTGAAGGTGCCACGCTGGAGTTTTACGAAGCTGAGGCGAAAAAGCAGGCGAAGCAGTTTTTCATGGATGTTGCTGCCGGGTTATGTGAAGGGGATGGTCCGTTGCCGGAAAAGCGCCCCGTAATTTTAGAGGCGCAGGATGTGTTGATAACCTACAGAGGAAAACTACCGGGAATAATTACGGGTTCTCTGAAGACTCCACCGCTGGCCTGAAGACTTAACATATCCAGGGATTTGAAATCGATAAACCCTGATAAATATCCATGAACGCAAAAATCAGATACGGCCTGTCGGCTGCCGTTCTGGCGCTGATTGGTGCAGGGGCGTCTGCGCCTGAAATCCTCGACCAGTTTCTTGACGAAAAAGAAGGTAACCACACCACGGCATACCGTGATGGTGCGGGTATCTGGACCATCTGCCGCGGTGCCATCCTGGTGGATGGTAAACCTGTCGTTCCGGGCATGAAGTTGTCGAAGGAAAAATGCGACCAGGTTAACGCCATTGAACGTGATAAGGCGCTGGAGTGGGTGGAGCGCAATATTAAAGTACCGCTGACCGAACCCCAGAAAGCGGGGATCGCGTCATTCTGTCCGTACAACATTGGTCCCGGTAAGTGTTTCCCGTCGACGTTTTACAGACGAATT	NA	NA	NA	NA
WP_001303555.1|2067806_2067989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2068001_2068133_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2068360_2068546_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2069072_2069387_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2069468_2069693_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2070087_2070597_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2072481_2072688_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2072684_2074277_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2074266_2075772_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2075808_2076156_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2076213_2076480_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2076461_2077202_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2077215_2077647_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2077673_2078087_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001303170.1|2078067_2080647_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847314.1|2080643_2080973_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2080972_2081671_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2081676_2082420_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2082365_2082995_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070081040.1|2083235_2086712_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	97.8	0.0e+00
WP_001230466.1|2086778_2087378_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080214.1|2087442_2088756_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001023407.1|2088757_2089027_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	2146403	2166421	5404558	integrase,tail,transposase	Enterobacteria_phage(70.83%)	28	2159557:2159570	2169563:2169576
WP_162829348.1|2146403_2147617_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_070081041.1|2147746_2148931_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.4	8.7e-219
WP_000290456.1|2148930_2149443_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2149497_2149863_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2149871_2150027_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2152829_2153318_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2153474_2154047_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_032169999.1|2154090_2154636_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	8.1e-87
WP_162829202.1|2154673_2155886_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000211280.1|2155969_2156284_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2156288_2157248_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2157324_2160147_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2159557:2159570	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2160153_2160519_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2160515_2161133_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2161144_2161444_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2161440_2161707_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2161703_2161907_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2161930_2162347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2162439_2162553_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2162549_2162792_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2162803_2163082_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2163092_2163443_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2163464_2163668_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2163739_2163877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2163966_2164371_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2164386_2165037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2165066_2165414_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2165419_2166421_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2169563:2169576	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	2486965	2579446	5404558	protease,tail,holin,transposase,head,terminase	Stx2-converting_phage(34.48%)	95	NA	NA
WP_001260835.1|2486965_2487787_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2487886_2487970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2488062_2488398_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091831.1|2488794_2490048_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2490154_2491048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2491182_2492403_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2492527_2493223_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071527647.1|2493175_2494468_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2494625_2495240_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2495282_2496137_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2496138_2496756_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001509682.1|2496766_2499190_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041704.1|2499250_2501677_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2501875_2502181_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2502288_2502999_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2503001_2503562_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2503596_2503938_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2504072_2504399_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2505387_2505639_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_070080217.1|2505711_2508183_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2508275_2508467_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2508463_2508652_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|2509220_2509439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2509510_2509810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2510162_2510441_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2510442_2510634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2510654_2511026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2511123_2511426_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2511422_2511848_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2511870_2512833_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2512839_2513580_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2514390_2514786_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2514842_2515427_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2515542_2515647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2515835_2516048_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2516215_2516494_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2516495_2517545_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217457.1|2517557_2517917_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2517913_2518603_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2519239_2519668_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2520146_2521997_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2522436_2522652_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2522656_2523001_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2523051_2523585_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_162829202.1|2523691_2524905_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001056806.1|2525168_2525738_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2525737_2525884_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2526111_2526297_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2526721_2526949_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2526990_2527356_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_070081042.1|2527646_2528210_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	78.5	9.9e-64
WP_070080204.1|2528206_2529868_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_001063023.1|2531912_2532134_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|2534660_2534987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2534996_2535347_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2535343_2535790_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2535786_2536131_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_070081043.1|2536189_2536906_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	1.6e-127
WP_001030063.1|2536911_2537286_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2537381_2537591_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080221.1|2537642_2540723_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.4	0.0e+00
WP_000807954.1|2540715_2541057_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152180.1|2541056_2541494_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_070080232.1|2541682_2545156_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001228304.1|2545223_2545823_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2545974_2547288_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023407.1|2547289_2547559_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001025672.1|2548585_2549911_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2551508_2551631_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001509602.1|2551737_2552649_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	81.8	1.5e-133
WP_000938103.1|2552714_2553284_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2554249_2555788_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2555837_2556185_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2556181_2556562_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2556901_2557180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2557607_2557754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2557890_2558538_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2558721_2559312_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2560818_2561469_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2562782_2563289_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2563334_2563835_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2563920_2564100_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2564480_2565287_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2565286_2566480_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2566491_2567853_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2567853_2569449_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2569448_2571011_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2571102_2571147_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2571284_2572166_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2572162_2572783_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_162829202.1|2573595_2574808_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001291216.1|2575919_2576792_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2576831_2577422_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2577418_2578177_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2578396_2579446_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	2849277	2948681	5404558	tail,integrase,holin,transposase,portal,head,capsid,terminase	Escherichia_phage(32.04%)	120	2892538:2892551	2949560:2949573
WP_000214712.1|2849277_2849481_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2849516_2850977_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2852480_2852723_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2852884_2853526_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2853607_2854237_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2854309_2854885_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2854997_2855267_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_070080214.1|2855268_2856582_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001230466.1|2856646_2857246_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070081045.1|2857312_2860789_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	97.9	0.0e+00
WP_140395871.1|2861029_2861659_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080198.1|2861604_2862348_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_001151105.1|2862353_2863052_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847314.1|2863051_2863381_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_064032219.1|2863377_2866023_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000532075.1|2866066_2866375_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479039.1|2866401_2866830_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2866843_2867596_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683063.1|2867603_2867999_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2867995_2868529_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2868543_2868897_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2868908_2869307_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2869348_2870374_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2870429_2870762_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2870771_2872091_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2872071_2873673_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2873669_2873876_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2873872_2875798_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2875772_2876318_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2876704_2876929_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2877010_2877325_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2877850_2878036_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2878258_2878405_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2878404_2878974_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2879244_2879778_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2879828_2880173_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2880177_2880393_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2880831_2882682_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001303509.1|2883159_2883588_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000301797.1|2884042_2884756_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2884891_2885089_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2885313_2885868_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2885930_2886236_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2886248_2887298_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2887299_2887572_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2887693_2888038_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2888157_2888370_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2888603_2889161_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2889162_2889381_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2889508_2889820_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2889812_2890040_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2890036_2890318_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2890350_2891067_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2891100_2891562_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2891554_2892598_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
2892538:2892551	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|2892666_2893092_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2893075_2893318_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2893709_2894048_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2894341_2894494_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2894505_2895144_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2895144_2895354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2895918_2896107_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2896103_2896292_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2896384_2897629_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2898339_2898582_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171540.1|2899544_2899925_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2899921_2900269_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2900318_2901857_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2902439_2903090_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_075702005.1|2903884_2905099_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.6	1.6e-79
WP_001230508.1|2905163_2905763_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050439450.1|2909651_2910284_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_070080223.1|2910229_2910973_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_070080222.1|2910983_2911682_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|2911681_2912023_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_021503509.1|2912015_2915258_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_001453698.1|2915309_2915519_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2915614_2915989_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2915994_2916711_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|2916769_2917114_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2917110_2917557_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2917553_2917904_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2917913_2918240_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2920766_2920988_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080204.1|2923032_2924694_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_070081042.1|2924690_2925254_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	78.5	9.9e-64
WP_000279796.1|2925544_2925910_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2925951_2926179_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2926603_2926789_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2927016_2927163_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2927162_2927732_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2928002_2928536_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2928586_2928931_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2928935_2929151_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_070080234.1|2929590_2931441_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000935549.1|2932237_2933302_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	2.9e-197
WP_000917750.1|2933452_2933650_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2933891_2934422_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2934430_2934790_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2934802_2935849_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2935850_2936129_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2936198_2936456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2936676_2936889_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2937167_2937926_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2938624_2938789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2938785_2939367_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2939553_2940096_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2940007_2941048_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2941019_2941571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2941554_2941782_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2941858_2942266_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2942529_2942829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2942901_2943120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2943142_2943550_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2943527_2943761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2944319_2944508_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2944504_2944696_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2944788_2947260_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2947324_2947573_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2947550_2948681_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2949560:2949573	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 9
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	3043470	3117127	5404558	protease,tRNA,tail,integrase,holin,transposase,portal,head,capsid,lysis,terminase	Enterobacteria_phage(52.94%)	87	3087694:3087709	3115948:3115963
WP_162829202.1|3043470_3044684_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001131446.1|3047152_3047272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|3047232_3047418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3047518_3047692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3047753_3048038_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|3048041_3048377_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001299921.1|3051474_3051693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358812.1|3051824_3053348_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3053731_3053980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888778.1|3054092_3054359_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858015.1|3054387_3054660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554146.1|3054702_3054939_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001359088.1|3055252_3056464_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332300.1|3056668_3057400_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373094.1|3057620_3058025_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032169657.1|3058077_3058188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3058423_3058468_+	protein YmgK	NA	NA	NA	NA	NA
WP_000872355.1|3058720_3059044_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	7.5e-40
WP_000539892.1|3059146_3059299_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001358785.1|3059778_3060216_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3060240_3060825_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3061323_3062277_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3062463_3063948_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3064250_3065789_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3065838_3066186_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3066182_3066563_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3066638_3066887_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3066943_3067612_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3068109_3068292_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3068370_3068871_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3068907_3069414_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3069432_3070323_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3070442_3071024_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3071023_3073939_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3074003_3074603_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_070080236.1|3074669_3078068_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090919.1|3078128_3078761_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_000194779.1|3078697_3079441_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3079446_3080145_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3080144_3080474_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3080470_3083020_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3083012_3083447_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3083428_3083851_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3083866_3084607_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000975102.1|3085005_3085584_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_000752995.1|3085595_3085949_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3085960_3086359_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3086400_3087426_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3087481_3087814_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3087694:3087709	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3087823_3089143_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3089123_3090725_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3090721_3090928_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3090924_3092850_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3092824_3093370_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3093758_3093953_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3094117_3094324_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001459037.1|3094609_3095020_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	8.0e-71
WP_000738495.1|3095311_3095605_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3095695_3095878_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3096094_3096571_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3096557_3096863_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3097184_3097874_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3097870_3098011_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3098007_3098370_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774484.1|3098366_3098657_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224907.1|3098649_3098820_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3098819_3099275_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_001693106.1|3099776_3101303_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	9.3e-32
WP_001459030.1|3101360_3101483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3101547_3101880_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3101947_3102250_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3102246_3102948_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3103872_3104109_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3104098_3105241_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3105354_3106605_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3106776_3107430_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3107439_3107901_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3107954_3109061_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3109096_3109738_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3109741_3111112_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3111280_3111952_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3111951_3113412_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3114012_3114294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3114549_3115092_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3115297_3115711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3115723_3116059_-|head	head decoration protein	head	NA	NA	NA	NA
3115948:3115963	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3116071_3117127_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	3123219	3175023	5404558	tail,integrase,holin,head,terminase	Stx2-converting_phage(26.53%)	60	3123083:3123097	3179124:3179138
3123083:3123097	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
WP_000085256.1|3123219_3124449_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3124697_3125819_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3125867_3127094_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3127343_3128480_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3128463_3129327_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3129690_3131052_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3131112_3131388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3133696_3137098_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3137688_3140037_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3140056_3140146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071527644.1|3140158_3140395_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	82.0	5.7e-21
WP_000967271.1|3140340_3141078_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3141131_3142010_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_032169778.1|3142273_3142423_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3142532_3142787_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3142803_3143502_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3143501_3143843_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080237.1|3143835_3147078_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_001453698.1|3147129_3147339_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3147434_3147809_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_000133388.1|3148606_3148951_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3148947_3149394_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3149390_3149741_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3149750_3150077_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|3152603_3152825_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080238.1|3154869_3156531_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.1	0.0e+00
WP_070080218.1|3156527_3157091_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_000279786.1|3157379_3157745_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|3157786_3157972_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3158101_3158242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3158598_3158823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3158887_3159094_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3159321_3159468_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3159467_3160037_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3160307_3160841_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731241.1|3160891_3161236_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3161240_3161456_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3161531_3161801_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3161838_3162021_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3162168_3164106_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000762928.1|3165184_3166006_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|3166002_3166377_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265159.1|3166389_3167439_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3167440_3167719_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3167886_3168099_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3168287_3168392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3168507_3169095_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3169097_3169289_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3169290_3169728_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3169714_3170032_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3169985_3170303_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3170292_3170595_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3170591_3170873_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3170905_3171622_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3171655_3172198_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_070081046.1|3172109_3173153_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	78.8	1.4e-87
WP_000693915.1|3173221_3173647_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3173630_3173954_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3174078_3174555_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3174870_3175023_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
3179124:3179138	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 11
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	3276134	3327036	5404558	protease,transposase	Stx2-converting_phage(27.78%)	47	NA	NA
WP_162829202.1|3276134_3277348_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001069768.1|3279719_3280592_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282125.1|3280919_3281102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422760.1|3281401_3281827_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
WP_162829202.1|3282027_3283240_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001304205.1|3283912_3286081_-	DNA2/NAM7 family helicase	NA	NA	NA	NA	NA
WP_001304206.1|3286077_3286593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345400.1|3286833_3287880_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|3289867_3290059_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3290111_3290345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3290440_3291064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3291152_3291662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3292119_3292578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3293931_3295056_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3295785_3295983_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3296048_3296264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|3296623_3296812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3296908_3297088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3297139_3297334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3298114_3298450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3299082_3299301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3300753_3302844_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3303357_3303744_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3304166_3304742_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3304810_3305389_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3305437_3306478_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3306500_3306956_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3306978_3308136_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3308135_3308717_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3309039_3310098_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3310107_3311250_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3311242_3312016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3312017_3313097_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797375.1|3313096_3314053_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506896.1|3314063_3315272_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3315289_3315757_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3316017_3316347_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3316333_3316675_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3317617_3319231_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3319261_3319612_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3319608_3320034_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_162829202.1|3320376_3321590_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032169707.1|3321627_3323967_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000136079.1|3324128_3324305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|3324723_3326262_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3326311_3326659_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3326655_3327036_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 12
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	3446956	3504038	5404558	protease,tail,integrase,holin,transposase,portal,head,capsid	Escherichia_phage(27.91%)	62	3448891:3448906	3505803:3505818
WP_000003653.1|3446956_3447544_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3447540_3448248_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3448266_3450060_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3448891:3448906	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3450056_3451175_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3453589_3453859_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_070080241.1|3453860_3455174_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	9.7e-78
WP_001230466.1|3455238_3455838_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080242.1|3455905_3459379_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3459512_3460040_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3460230_3460863_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3460808_3461552_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_070080243.1|3461562_3462261_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|3462260_3462590_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_070080244.1|3462586_3465166_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000533402.1|3465146_3465560_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3465586_3466018_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3466031_3466772_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3466753_3467020_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3467077_3467425_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3467461_3468967_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3468956_3470549_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3470545_3470752_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3472928_3474467_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3474516_3474864_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3474860_3475241_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|3475316_3475592_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_162829348.1|3476458_3477671_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_050547091.1|3477668_3477863_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.9	9.7e-19
WP_000138558.1|3478118_3478391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003126.1|3478550_3479084_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|3479304_3479418_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3479639_3479825_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3480352_3480667_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3480871_3482085_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070080245.1|3482260_3484111_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000261909.1|3484878_3485592_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265269.1|3486212_3487031_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3487182_3487554_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3487543_3487915_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3487927_3488977_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3488978_3489257_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3489424_3489580_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000160654.1|3490184_3490958_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3491309_3491723_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3491738_3492509_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3492530_3493277_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3493283_3494375_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3494453_3494909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3495115_3495541_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3495524_3495797_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3495905_3496307_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3496334_3496526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3496525_3496813_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3497090_3497246_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001458970.1|3497387_3497711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3497963_3498149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3498722_3498911_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3498907_3499099_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3499192_3501664_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3501731_3501974_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3501951_3502971_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3503378_3504038_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3505803:3505818	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	3734971	3760046	5404558	protease,tail,integrase,holin,transposase,lysis,terminase	Escherichia_phage(35.71%)	35	3734556:3734570	3760120:3760134
3734556:3734570	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3734971_3735670_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_070081047.1|3735900_3736782_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	2.5e-146
WP_072127173.1|3736950_3737112_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3737608_3738628_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3738661_3739642_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3739818_3740088_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741877.1|3740089_3741343_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.7	2.4e-70
WP_072140989.1|3741402_3741981_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.2	6.8e-100
WP_162829202.1|3742047_3743260_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001072975.1|3743325_3743538_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934140.1|3743534_3745637_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3745636_3746128_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3746802_3746955_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3746942_3747410_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3747406_3747904_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3747903_3748119_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3748261_3748660_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3748740_3748899_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3748984_3749728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3749911_3750601_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3750615_3750738_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3751075_3752035_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3752246_3752912_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3752908_3753529_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3753521_3753692_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3753688_3753871_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_162829202.1|3754791_3756005_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682316.1|3756558_3756741_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3756713_3756905_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000188862.1|3756981_3757197_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763363.1|3757295_3757517_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3757727_3758330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3758572_3758740_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3758779_3758998_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3758975_3760046_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3760120:3760134	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	4271812	4337854	5404558	holin,transposase	Stx2-converting_phage(25.0%)	58	NA	NA
WP_000131044.1|4271812_4273846_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|4273974_4274562_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089099.1|4274575_4276048_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159112.1|4276061_4277750_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.3e-61
WP_001356433.1|4278431_4278566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072140985.1|4280649_4281411_+	protein HyxA	NA	NA	NA	NA	NA
WP_000798051.1|4281452_4282547_+	adhesin	NA	NA	NA	NA	NA
WP_001356435.1|4282500_4282713_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001301982.1|4283805_4284501_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023931.1|4284493_4285921_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|4285931_4286651_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339591.1|4287177_4288032_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046339.1|4288257_4289583_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|4289691_4289928_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|4289939_4290533_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001458949.1|4290692_4291562_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.0e-51
WP_000621002.1|4291810_4292668_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092592.1|4292788_4297042_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_171878957.1|4297757_4298971_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	7.1e-168
WP_000998051.1|4300253_4301792_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4301841_4302189_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|4302185_4302566_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000803998.1|4302829_4303093_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4303092_4303233_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4303302_4303494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4304318_4304861_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4304935_4305523_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4305580_4306249_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4306274_4308800_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4308789_4310433_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4310401_4311112_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|4311424_4311754_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4312001_4312616_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4313033_4313723_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4313719_4314676_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4314672_4316871_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4316880_4317837_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171067.1|4318015_4319143_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4319284_4320343_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4320588_4321491_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4322193_4322472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4322638_4323361_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4323459_4324359_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4325034_4325991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|4328469_4328793_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4328792_4329014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973390.1|4329010_4329568_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.0	1.0e-28
WP_001244581.1|4329564_4329825_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4330758_4331511_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4331507_4332059_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4332064_4332337_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4332746_4333313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4333312_4333903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4333933_4334566_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4334558_4335017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4335016_4335634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829348.1|4335699_4336912_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_087498070.1|4337011_4337854_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	4345365	4353423	5404558		Streptococcus_phage(33.33%)	8	NA	NA
WP_001234373.1|4345365_4346184_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214420.1|4346275_4346761_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186786.1|4346776_4347253_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|4347321_4347543_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_000942525.1|4348826_4349897_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|4349875_4350535_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000893282.1|4351054_4352308_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4352319_4353423_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
>prophage 16
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	4373552	4398865	5404558	plate,transposase	uncultured_Caudovirales_phage(50.0%)	16	NA	NA
WP_000027427.1|4373552_4374725_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4374805_4374991_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4374905_4375169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070080248.1|4377133_4378270_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000509109.1|4382225_4386458_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4386533_4388675_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4388884_4389403_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4390099_4390600_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4390634_4390859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509383.1|4390909_4392301_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4392391_4392805_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4392808_4394659_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4394622_4395705_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4395729_4397010_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4397006_4397531_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4397533_4398865_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 17
NZ_CP017442	Escherichia coli O157:H7 strain 4276 chromosome, complete genome	5404558	5033012	5047677	5404558	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	19	5028853:5028868	5046382:5046397
5028853:5028868	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5033012_5034428_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5034510_5035494_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5035659_5035902_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5036035_5037073_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5037161_5038259_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5038320_5038569_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5038729_5039371_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5039452_5040082_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5040154_5040727_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5040838_5041108_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5041109_5042423_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5042487_5043087_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5044408_5044945_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5044935_5045286_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5045282_5045567_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5045902_5046100_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5046444_5046726_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5046382:5046397	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5046773_5046947_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5047143_5047677_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP017443	Escherichia coli O157:H7 strain 4276 plasmid pO157, complete sequence	92583	3473	54866	92583	protease,integrase,transposase	Stx2-converting_phage(30.0%)	39	39657:39671	60056:60070
WP_162829348.1|3473_4686_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000592771.1|4859_7070_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|7113_7503_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|8728_12631_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001171540.1|12999_13380_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|13376_13724_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|13773_15312_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302199.1|17258_18080_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|18079_19186_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|19275_20997_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|21070_22069_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001358886.1|22937_25634_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25720_26596_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|26596_28564_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28563_30069_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|30070_31294_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|31324_31759_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|31755_32310_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|32324_32672_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|32668_33268_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|33264_34242_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|34280_35453_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|35439_35952_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|36009_36843_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36934_37336_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|39226_39742_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39657:39671	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|39743_42740_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42789_44910_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44913_46353_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|47095_47326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|47446_48187_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|48471_49449_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49856_50057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|50053_50674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50670_51354_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51812_52031_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|52032_52338_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016988.1|52338_53121_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.2	1.9e-49
WP_162829202.1|53652_54866_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
60056:60070	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
