The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	1225623	1232674	5410617	transposase,tail	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|1225623_1226837_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1227054_1227324_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1227484_1227907_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1228036_1229095_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1229173_1229824_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1230006_1230597_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1231098_1231347_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1232191_1232674_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	1511570	1518309	5410617	transposase,integrase	Enterobacteria_phage(50.0%)	6	1499244:1499260	1520505:1520521
1499244:1499260	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1511570_1512140_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|1512279_1513492_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000960724.1|1513906_1514587_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1514596_1515733_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1515907_1517065_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1517376_1518309_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1520505:1520521	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	1743603	1834437	5410617	portal,tail,holin,transposase,terminase,protease,lysis,tRNA	Enterobacteria_phage(54.0%)	83	NA	NA
WP_000968210.1|1743603_1744299_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1744295_1744694_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1744824_1745733_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1745859_1747218_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1747229_1748258_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1748272_1748974_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1748982_1749627_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1749641_1750835_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1750994_1751945_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1752332_1752416_-	protein YohP	NA	NA	NA	NA	NA
WP_001078131.1|1752639_1754076_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1754128_1754890_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1755019_1755598_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1755767_1756355_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1756528_1757461_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1757498_1759214_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1759409_1761707_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1761958_1762876_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1762882_1764040_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1764032_1764959_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	35.1	4.3e-24
WP_000783120.1|1764963_1765695_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1765675_1765783_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1765842_1766544_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_171878939.1|1767682_1768895_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.7e-167
WP_001301135.1|1769215_1769365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070080197.1|1769422_1770949_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.9	7.9e-31
WP_001053042.1|1771450_1771906_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_000224907.1|1771905_1772076_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774495.1|1772068_1772359_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099699.1|1772355_1772718_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971055.1|1772714_1772855_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1772940_1773375_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1773626_1773779_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1774582_1776529_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1776666_1776846_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1776886_1777132_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1777209_1777425_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1777429_1777963_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1778233_1778803_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1778802_1778949_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1779176_1779362_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1779879_1780356_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077630.1|1780352_1782476_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1782472_1782685_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1782684_1784187_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1784131_1786156_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1786243_1786570_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|1786562_1786844_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974959.1|1786846_1787470_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|1787482_1787881_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|1787888_1788641_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|1788654_1789083_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|1789109_1789418_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|1789461_1792107_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|1792103_1792433_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1792432_1793131_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|1793136_1793880_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|1793825_1794455_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080257.1|1794695_1798175_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.5	0.0e+00
WP_001230466.1|1798241_1798841_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080258.1|1798905_1800219_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_070080259.1|1800220_1800490_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	3.2e-44
WP_075702011.1|1800650_1801067_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	99.3	1.4e-75
WP_001143784.1|1801148_1801790_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1801951_1802200_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1802714_1804400_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1804396_1805116_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1805162_1805633_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1805674_1806136_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001459147.1|1806260_1808264_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1808260_1809397_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1809389_1810121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1810139_1811669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1811679_1812768_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1814008_1814326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1814387_1818017_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1824974_1827008_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1827139_1828249_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1828510_1828792_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1829083_1829626_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1829713_1830388_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1830403_1832884_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162829202.1|1833224_1834437_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 4
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	1943254	2021923	5410617	tail,holin,transposase,lysis,terminase,protease,integrase,head	Stx2-converting_phage(49.4%)	97	1934205:1934219	1949632:1949646
1934205:1934219	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1943254_1944433_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1944413_1944605_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1944686_1945031_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1945218_1945569_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1945565_1945922_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|1946435_1947383_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1947379_1947601_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000188870.1|1947699_1947915_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548528.1|1947991_1948183_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1948155_1948338_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|1948334_1949015_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|1949011_1949797_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1949632:1949646	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_162829202.1|1950072_1951285_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000372937.1|1951486_1951630_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1951598_1951763_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1951835_1952204_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1952386_1952638_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1952696_1952969_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1952946_1953129_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1953697_1954219_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_171878941.1|1954400_1955613_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001302016.1|1956033_1956729_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1956803_1957019_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1957160_1957457_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1957489_1957651_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539352.1|1957637_1958459_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	99.6	4.4e-153
WP_001248388.1|1958455_1959832_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1959902_1960181_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1960313_1960529_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1960539_1960776_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1960732_1961179_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1961175_1961703_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1961699_1961882_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|1962156_1962861_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001108016.1|1963658_1964264_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	99.5	4.3e-97
WP_001028855.1|1964260_1964932_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
WP_000512807.1|1964922_1965411_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1966049_1967009_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1967020_1967290_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1967586_1967910_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_021503541.1|1968153_1970091_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|1970228_1970408_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1970448_1970721_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1970797_1971013_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1971012_1971510_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1971506_1971944_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1972146_1972644_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1972640_1972898_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1973360_1973588_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1973629_1973995_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958398.1|1974288_1974852_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_070080204.1|1974848_1976510_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_001063023.1|1978554_1978776_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|1981302_1981629_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1981638_1981989_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1981985_1982432_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1982428_1982773_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|1982831_1983548_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1983553_1983928_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1984023_1984233_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080206.1|1984284_1987527_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_000807954.1|1987519_1987861_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080207.1|1987860_1988559_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	4.3e-133
WP_001302649.1|1988575_1988896_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1989003_1989177_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1989247_1990171_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_021498910.1|1990225_1990963_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	100.0	3.1e-150
WP_134791867.1|1990908_1991541_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_001171540.1|1991874_1992255_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1992251_1992599_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1992648_1994187_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_070080208.1|1994229_1997709_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230459.1|1997775_1998375_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080209.1|1998439_1999753_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001509711.1|1999754_2000024_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	1.1e-44
WP_000491542.1|2000164_2001040_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2001264_2001915_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2003238_2004405_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105392.1|2004523_2004997_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2005195_2006254_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2006425_2006755_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2006855_2007038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2007526_2007640_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2007652_2007847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2008305_2008674_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2008747_2008969_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2009031_2009508_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2009522_2010002_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_024177368.1|2010083_2010905_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.4e-45
WP_000846711.1|2011125_2011536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2011551_2012235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2012370_2013441_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2013437_2014343_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2014339_2015221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171878943.1|2015204_2016418_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	1.3e-164
WP_000966626.1|2016789_2018937_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2020384_2021923_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	2041091	2088911	5410617	portal,tail,holin,capsid,transposase,terminase,integrase,head	Escherichia_phage(38.1%)	54	2026579:2026593	2051746:2051760
2026579:2026593	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_162829202.1|2041091_2042304_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2046588_2047386_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2047621_2048644_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2048643_2048847_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_070080211.1|2048905_2051377_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2051472_2051661_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2051657_2051846_-	cell division inhibitor	NA	NA	NA	NA	NA
2051746:2051760	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2052326_2052479_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2052753_2053398_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2053495_2053723_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2053719_2054145_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2054213_2055251_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2055162_2055705_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2055739_2056438_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2056459_2056684_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2056680_2057037_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2057069_2057222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2057218_2057530_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2057656_2058220_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2058329_2058434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2058620_2058833_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2058874_2059060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2059000_2059279_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_070080212.1|2059280_2060330_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.4e-108
WP_001217457.1|2060342_2060702_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2060698_2061388_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303558.1|2062021_2062450_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_162829202.1|2064859_2066073_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2066383_2066599_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2066603_2066948_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2066998_2067532_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2067687_2067870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2067882_2068014_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2068241_2068427_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2068953_2069268_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2069349_2069574_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2069968_2070478_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2072362_2072569_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2072565_2074158_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2074147_2075653_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2075689_2076037_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2076094_2076361_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2076342_2077083_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2077096_2077528_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2077554_2077968_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_070080260.1|2077948_2080528_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847314.1|2080524_2080854_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2080853_2081552_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080261.1|2081557_2082301_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.0e-150
WP_140395871.1|2082246_2082876_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080262.1|2083116_2086596_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230459.1|2086662_2087262_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080209.1|2087326_2088640_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_070080263.1|2088641_2088911_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	5.4e-44
>prophage 6
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	2146287	2166305	5410617	transposase,tail,integrase	Enterobacteria_phage(70.83%)	28	2159441:2159454	2169447:2169460
WP_162829348.1|2146287_2147501_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000005444.1|2147630_2148815_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2148814_2149327_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2149381_2149747_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2149755_2149911_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2152713_2153202_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2153358_2153931_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_032169999.1|2153974_2154520_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	8.1e-87
WP_162829202.1|2154557_2155770_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000211280.1|2155853_2156168_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2156172_2157132_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2157208_2160031_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2159441:2159454	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2160037_2160403_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2160399_2161017_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2161028_2161328_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2161324_2161591_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2161587_2161791_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2161814_2162231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2162323_2162437_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2162433_2162676_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2162687_2162966_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2162976_2163327_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2163348_2163552_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2163623_2163761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2163850_2164255_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2164270_2164921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2164950_2165298_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2165303_2166305_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2169447:2169460	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	2486849	2603351	5410617	portal,tail,holin,capsid,transposase,terminase,protease,head	Escherichia_phage(29.91%)	135	NA	NA
WP_001260835.1|2486849_2487671_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2487770_2487854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2487946_2488282_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091831.1|2488678_2489932_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2490038_2490932_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2491066_2492287_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2492411_2493107_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071527647.1|2493059_2494352_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2494509_2495124_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2495166_2496021_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2496022_2496640_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001509682.1|2496650_2499074_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041704.1|2499134_2501561_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2501759_2502065_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2502172_2502883_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2502885_2503446_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2503480_2503822_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2503956_2504283_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2505271_2505523_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_070080217.1|2505595_2508067_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2508159_2508351_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2508347_2508536_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|2509104_2509323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2509394_2509694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2510046_2510325_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2510326_2510518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2510538_2510910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2511007_2511310_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2511306_2511732_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2511754_2512717_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2512723_2513464_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2514274_2514670_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2514726_2515311_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2515426_2515531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2515719_2515932_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2516099_2516378_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2516379_2517429_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217457.1|2517441_2517801_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2517797_2518487_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001455449.1|2519123_2519552_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	2.2e-63
WP_000023202.1|2520030_2521881_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2522320_2522536_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2522540_2522885_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2522935_2523469_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_162829202.1|2523575_2524789_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001056806.1|2525052_2525622_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2525621_2525768_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2525995_2526181_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2526605_2526833_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|2526874_2527240_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_070080218.1|2527529_2528093_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_070080219.1|2528089_2529751_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_001063023.1|2531795_2532017_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080220.1|2531962_2534542_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.4	0.0e+00
WP_000125988.1|2534544_2534871_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2534880_2535231_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2535227_2535674_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2535670_2536015_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001030063.1|2536803_2537178_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2537273_2537483_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080221.1|2537534_2540615_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.4	0.0e+00
WP_000807954.1|2540607_2540949_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080222.1|2540948_2541647_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_070080223.1|2541657_2542401_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_050439450.1|2542346_2542979_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001230508.1|2546867_2547467_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_075702005.1|2547531_2548746_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.6	1.6e-79
WP_001121225.1|2549540_2550191_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2550773_2552312_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2552361_2552709_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2552705_2553086_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001120551.1|2554048_2554291_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2555001_2556246_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2556338_2556527_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2556523_2556712_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2557276_2557486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2557486_2558125_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2558136_2558289_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2558581_2558920_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2559311_2559554_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2559537_2559963_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2560031_2561075_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2561067_2561529_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2561562_2562279_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2562311_2562593_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2562589_2562817_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2562809_2563121_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2563248_2563467_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2563468_2564026_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2564259_2564472_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2564591_2564936_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2565057_2565330_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2565331_2566381_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2566393_2566699_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2566761_2567316_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2567540_2567738_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2567873_2568587_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303509.1|2569041_2569470_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_070080264.1|2569947_2571798_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024180155.1|2572236_2572452_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2572456_2572801_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2572851_2573385_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000539795.1|2574223_2574370_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2574592_2574778_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2575303_2575618_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2575699_2575924_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2576310_2576856_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2576830_2578756_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2578752_2578959_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2578955_2580557_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2580537_2581857_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2581866_2582199_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2582254_2583280_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2583321_2583720_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2583731_2584085_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2584099_2584633_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2584629_2585025_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235098.1|2585032_2585785_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|2585798_2586227_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|2586253_2586562_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|2586605_2589251_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|2589247_2589577_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2589576_2590275_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2590280_2591024_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2590969_2591599_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080265.1|2591839_2595316_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.0	0.0e+00
WP_001230466.1|2595382_2595982_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080214.1|2596046_2597360_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001023407.1|2597361_2597631_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2597743_2598319_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2598391_2599021_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2599102_2599744_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2599905_2600148_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|2601651_2603112_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2603147_2603351_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	2849059	2949891	5410617	integrase,tail,holin,transposase,terminase,protease,head	Stx2-converting_phage(32.76%)	102	2890004:2890031	2950028:2950055
WP_162829202.1|2849059_2850272_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000202114.1|2851489_2852056_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000506490.1|2852533_2853322_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001302118.1|2853465_2854593_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000485019.1|2854660_2856595_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	2.4e-32
WP_000859972.1|2856829_2858815_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001288364.1|2858962_2859136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088621.1|2859225_2859975_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|2860243_2860462_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001303294.1|2860587_2860914_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176265.1|2860913_2861651_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|2861843_2863013_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876292.1|2863019_2863328_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256542.1|2863476_2864241_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|2864410_2865001_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099451.1|2865064_2867740_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|2867903_2867999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233043.1|2868112_2868280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|2868282_2868447_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|2868741_2869716_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295576.1|2869925_2872523_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|2872902_2873154_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422055.1|2873189_2874239_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2874458_2875217_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2875213_2875804_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2875843_2876716_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_162829202.1|2877826_2879040_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001295575.1|2879852_2880473_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2880469_2881351_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2881488_2881533_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2881624_2883187_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2883186_2884782_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2884782_2886144_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2886155_2887349_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2887348_2888155_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2888535_2888715_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2888800_2889301_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2889346_2889853_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2890004:2890031	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|2891166_2891817_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2893323_2893914_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2894097_2894745_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2894881_2895028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2895455_2895734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2896073_2896454_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2896450_2896798_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2896847_2898386_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2899351_2899921_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001509602.1|2899986_2900898_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	81.8	1.5e-133
WP_106409364.1|2901004_2901127_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2902724_2904050_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023407.1|2905076_2905346_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000216532.1|2905347_2906661_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2906812_2907412_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_070080232.1|2907479_2910953_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001152180.1|2911141_2911579_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|2911578_2911920_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080237.1|2911912_2915155_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_001453698.1|2915206_2915416_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2915511_2915886_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2915891_2916608_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|2916666_2917011_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2917007_2917454_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2917450_2917801_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2917810_2918137_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2920663_2920885_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080219.1|2922929_2924591_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_047082927.1|2924587_2925151_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	83.4	7.1e-70
WP_000279796.1|2925441_2925807_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2925848_2926076_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2926500_2926686_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2926913_2927060_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2927059_2927629_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2927899_2928433_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_096846312.1|2928483_2928732_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	98.8	1.3e-39
WP_162829202.1|2928794_2930007_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024180155.1|2930145_2930361_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_070080234.1|2930800_2932651_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000935549.1|2933447_2934512_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	2.9e-197
WP_000917750.1|2934662_2934860_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2935101_2935632_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2935640_2936000_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2936012_2937059_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2937060_2937339_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2937408_2937666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2937886_2938099_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2938377_2939136_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2939834_2939999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2939995_2940577_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2940763_2941306_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2941217_2942258_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2942229_2942781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2942764_2942992_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2943068_2943476_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2943739_2944039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2944111_2944330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2944352_2944760_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2944737_2944971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2945529_2945718_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2945714_2945906_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2945998_2948470_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2948534_2948783_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2948760_2949891_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2950028:2950055	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	3044680	3119651	5410617	integrase,portal,tail,holin,capsid,transposase,lysis,terminase,tRNA,protease,head	Enterobacteria_phage(52.83%)	88	3090218:3090233	3118472:3118487
WP_162829202.1|3044680_3045894_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001131446.1|3048362_3048482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|3048442_3048628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3048728_3048902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3048963_3049248_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|3049251_3049587_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001299921.1|3052684_3052903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358812.1|3053034_3054558_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3054941_3055190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888778.1|3055302_3055569_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_162829202.1|3055790_3057003_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000554146.1|3057225_3057462_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001359088.1|3057775_3058987_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332300.1|3059191_3059923_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373094.1|3060143_3060548_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032169657.1|3060600_3060711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3060946_3060991_+	protein YmgK	NA	NA	NA	NA	NA
WP_000872355.1|3061243_3061567_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	7.5e-40
WP_000539892.1|3061669_3061822_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001358785.1|3062301_3062739_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3062763_3063348_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3063846_3064800_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3064986_3066471_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3066773_3068312_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3068361_3068709_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3068705_3069086_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3069161_3069410_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3069466_3070135_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3070632_3070815_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3070893_3071394_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3071430_3071937_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3071955_3072846_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3072965_3073547_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3073546_3076462_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3076526_3077126_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_070080236.1|3077192_3080591_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090919.1|3080651_3081284_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_000194779.1|3081220_3081964_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3081969_3082668_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3082667_3082997_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3082993_3085543_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3085535_3085970_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3085951_3086374_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3086389_3087130_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3087137_3087533_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975102.1|3087529_3088108_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_000752995.1|3088119_3088473_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3088484_3088883_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3088924_3089950_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3090005_3090338_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3090218:3090233	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3090347_3091667_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3091647_3093249_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3093245_3093452_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3093448_3095374_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3095348_3095894_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3096282_3096477_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3096641_3096848_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001459037.1|3097133_3097544_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	8.0e-71
WP_000738495.1|3097835_3098129_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3098219_3098402_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3098618_3099095_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3099081_3099387_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3099708_3100398_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3100394_3100535_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3100531_3100894_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774484.1|3100890_3101181_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224907.1|3101173_3101344_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3101343_3101799_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_001693106.1|3102300_3103827_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	9.3e-32
WP_001459030.1|3103884_3104007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3104071_3104404_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3104471_3104774_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3104770_3105472_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3106396_3106633_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3106622_3107765_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3107878_3109129_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3109300_3109954_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3109963_3110425_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3110478_3111585_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3111620_3112262_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3112265_3113636_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3113804_3114476_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3114475_3115936_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3116536_3116818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3117073_3117616_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3117821_3118235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3118247_3118583_-|head	head decoration protein	head	NA	NA	NA	NA
3118472:3118487	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3118595_3119651_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	3125743	3177553	5410617	tail,holin,terminase,integrase,head	Stx2-converting_phage(26.53%)	60	3125607:3125621	3181654:3181668
3125607:3125621	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
WP_000085256.1|3125743_3126973_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3127221_3128343_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3128391_3129618_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3129867_3131004_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3130987_3131851_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3132214_3133576_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3133636_3133912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3136220_3139622_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3140212_3142561_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3142580_3142670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071527644.1|3142682_3142919_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	82.0	5.7e-21
WP_000967271.1|3142864_3143602_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3143655_3144534_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_032169778.1|3144797_3144947_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3145056_3145311_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3145327_3146026_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3146025_3146367_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080237.1|3146359_3149602_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_001453698.1|3149653_3149863_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3149958_3150333_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_000133388.1|3151130_3151475_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3151471_3151918_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3151914_3152265_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3152274_3152601_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|3155127_3155349_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080238.1|3157393_3159055_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.1	0.0e+00
WP_070080218.1|3159051_3159615_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_000279786.1|3159903_3160269_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|3160310_3160496_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3160625_3160766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3161122_3161347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3161411_3161618_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3161845_3161992_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3161991_3162561_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3162831_3163365_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731241.1|3163415_3163760_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3163764_3163980_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3164055_3164325_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3164362_3164545_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3164692_3166630_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000762928.1|3167708_3168530_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|3168526_3168901_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265159.1|3168913_3169963_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3169964_3170243_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3170410_3170623_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3170811_3170916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3171031_3171619_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3171621_3171813_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3171814_3172252_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3172238_3172556_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3172509_3172827_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3172816_3173119_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3173115_3173397_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3173429_3174146_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3174179_3174722_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_070080239.1|3174633_3175683_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	77.1	7.7e-86
WP_000693915.1|3175751_3176177_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3176160_3176484_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3176608_3177085_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3177400_3177553_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
3181654:3181668	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 11
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	3278674	3344067	5410617	transposase,protease	Escherichia_phage(35.0%)	62	NA	NA
WP_162829202.1|3278674_3279887_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001304205.1|3280559_3282728_-	DNA2/NAM7 family helicase	NA	NA	NA	NA	NA
WP_001304206.1|3282724_3283240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345400.1|3283480_3284527_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|3286514_3286706_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3286758_3286992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3287087_3287711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3287799_3288309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3288766_3289225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3290578_3291703_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3292432_3292630_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3292695_3292911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|3293270_3293459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3293555_3293735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3293786_3293981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3294761_3295097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3295729_3295948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3297400_3299491_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3300004_3300391_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3300813_3301389_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3301457_3302036_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3302084_3303125_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3303147_3303603_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3303625_3304783_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3304782_3305364_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3305686_3306745_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3306754_3307897_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3307889_3308663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3308664_3309744_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797375.1|3309743_3310700_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506896.1|3310710_3311919_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3311936_3312404_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3312664_3312994_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3312980_3313322_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3314264_3315878_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3315908_3316259_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3316255_3316681_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_162829202.1|3317023_3318237_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000397130.1|3320181_3320853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3321723_3321864_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3322165_3322429_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3323640_3324258_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3324269_3324944_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3324944_3325409_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3325418_3327122_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3327114_3327435_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3327443_3327746_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3327836_3328535_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3328915_3329191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3329415_3331035_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3331127_3331487_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3332172_3332463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3332486_3332738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3332785_3333391_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_171878941.1|3334543_3335757_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001171554.1|3336095_3336476_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3336472_3336820_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3336869_3338408_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001509494.1|3338826_3338991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3339042_3340255_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032169707.1|3340477_3342817_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_162829202.1|3342854_3344067_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 12
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	3444766	3503161	5410617	integrase,portal,tail,holin,capsid,transposase,protease,head	Escherichia_phage(29.55%)	63	3446701:3446716	3504926:3504941
WP_000003653.1|3444766_3445354_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3445350_3446058_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3446076_3447870_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3446701:3446716	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3447866_3448985_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3451399_3451669_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_070080241.1|3451670_3452984_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	9.7e-78
WP_001230466.1|3453048_3453648_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080242.1|3453715_3457189_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3457322_3457850_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3458040_3458673_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3458618_3459362_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_070080243.1|3459372_3460071_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|3460070_3460400_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_070080244.1|3460396_3462976_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000533402.1|3462956_3463370_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3463396_3463828_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3463841_3464582_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3464563_3464830_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3464887_3465235_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3465271_3466777_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3466766_3468359_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3468355_3468562_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3470738_3472277_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3472326_3472674_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3472670_3473051_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|3473126_3473402_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_162829348.1|3474268_3475481_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_050547091.1|3475478_3475673_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.9	9.7e-19
WP_000138558.1|3475928_3476201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003126.1|3476360_3476894_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|3477114_3477228_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3477449_3477635_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3478162_3478477_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3478681_3479895_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070080245.1|3480070_3481921_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000261909.1|3482688_3483402_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265269.1|3484022_3484841_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3484992_3485364_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3485353_3485725_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3485737_3486787_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3486788_3487067_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3487234_3487390_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_162829202.1|3487994_3489208_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000160654.1|3489307_3490081_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3490432_3490846_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3490861_3491632_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3491653_3492400_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3492406_3493498_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3493576_3494032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3494238_3494664_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3494647_3494920_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3495028_3495430_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3495457_3495649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3495648_3495936_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3496213_3496369_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001458970.1|3496510_3496834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3497086_3497272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3497845_3498034_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3498030_3498222_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3498315_3500787_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3500854_3501097_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3501074_3502094_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3502501_3503161_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3504926:3504941	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	3734094	3760482	5410617	integrase,tail,holin,transposase,lysis,terminase,protease	Escherichia_phage(40.0%)	37	3733679:3733693	3760556:3760570
3733679:3733693	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3734094_3734793_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3735023_3735905_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3736073_3736235_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3736731_3737751_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3737784_3738765_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_149025285.1|3738941_3739088_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	93.8	1.6e-10
WP_162829202.1|3739089_3740302_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070080267.1|3740305_3740524_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.3	4.9e-27
WP_000741877.1|3740525_3741779_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.7	2.4e-70
WP_072140989.1|3741838_3742417_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.2	6.8e-100
WP_162829202.1|3742483_3743696_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001072975.1|3743761_3743974_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934140.1|3743970_3746073_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3746072_3746564_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3747238_3747391_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3747378_3747846_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3747842_3748340_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3748339_3748555_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3748697_3749096_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3749176_3749335_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3749420_3750164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3750347_3751037_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3751051_3751174_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3751511_3752471_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3752682_3753348_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3753344_3753965_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3753957_3754128_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3754124_3754307_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_162829202.1|3755227_3756441_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682316.1|3756994_3757177_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3757149_3757341_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000188862.1|3757417_3757633_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763363.1|3757731_3757953_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3758163_3758766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3759008_3759176_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3759215_3759434_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3759411_3760482_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3760556:3760570	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	4276498	4343875	5410617	transposase,holin	Escherichia_phage(25.0%)	59	NA	NA
WP_001159112.1|4276498_4278187_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.3e-61
WP_001356433.1|4278868_4279003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072140985.1|4281086_4281848_+	protein HyxA	NA	NA	NA	NA	NA
WP_000798051.1|4281889_4282984_+	adhesin	NA	NA	NA	NA	NA
WP_001356435.1|4282937_4283150_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001301982.1|4284242_4284938_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023931.1|4284930_4286358_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|4286368_4287088_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339591.1|4287614_4288469_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046339.1|4288694_4290020_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|4290128_4290365_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|4290376_4290970_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001458949.1|4291129_4291999_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.0e-51
WP_000621002.1|4292247_4293105_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092592.1|4293225_4297479_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_162829202.1|4298194_4299408_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001038968.1|4300125_4300482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509407.1|4300769_4301696_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|4301852_4302773_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171878957.1|4303778_4304992_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	7.1e-168
WP_000998051.1|4306274_4307813_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4307862_4308210_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|4308206_4308587_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000803998.1|4308850_4309114_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4309113_4309254_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4309323_4309515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4310339_4310882_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4310956_4311544_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4311601_4312270_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4312295_4314821_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4314810_4316454_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4316422_4317133_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|4317445_4317775_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4318022_4318637_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4319054_4319744_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_070080270.1|4319740_4320697_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4320693_4322892_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4322901_4323858_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171067.1|4324036_4325164_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4325305_4326364_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4326609_4327512_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4328214_4328493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4328659_4329382_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4329480_4330380_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4331055_4332012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|4334490_4334814_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4334813_4335035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973390.1|4335031_4335589_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.0	1.0e-28
WP_001244581.1|4335585_4335846_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4336779_4337532_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4337528_4338080_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4338085_4338358_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4338767_4339334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4339333_4339924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4339954_4340587_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4340579_4341038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4341037_4341655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829348.1|4341720_4342933_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_087498070.1|4343032_4343875_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	4351386	4359444	5410617		Streptococcus_phage(33.33%)	8	NA	NA
WP_001234373.1|4351386_4352205_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214420.1|4352296_4352782_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186786.1|4352797_4353274_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|4353342_4353564_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_000942525.1|4354847_4355918_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|4355896_4356556_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000893282.1|4357075_4358329_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4358340_4359444_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
>prophage 16
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	4379573	4404868	5410617	transposase,plate	uncultured_Caudovirales_phage(50.0%)	16	NA	NA
WP_000027427.1|4379573_4380746_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4380826_4381012_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4380926_4381190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070080248.1|4383154_4384291_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000509109.1|4388228_4392461_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4392536_4394678_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4394887_4395406_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4396102_4396603_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4396637_4396862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509383.1|4396912_4398304_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4398394_4398808_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4398811_4400662_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4400625_4401708_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4401732_4403013_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4403009_4403534_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4403536_4404868_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 17
NZ_CP017446	Escherichia coli O157:H7 strain 9234 chromosome, complete genome	5410617	5039065	5053730	5410617	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	5034906:5034921	5052435:5052450
5034906:5034921	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5039065_5040481_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5040563_5041547_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5041712_5041955_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5042088_5043126_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5043214_5044312_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5044373_5044622_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5044782_5045424_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5045505_5046135_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5046207_5046780_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5046891_5047161_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5047162_5048476_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5048540_5049140_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5050461_5050998_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5050988_5051339_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5051335_5051620_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5051955_5052153_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5052497_5052779_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5052435:5052450	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5052826_5053000_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5053196_5053730_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP017447	Escherichia coli O157:H7 strain 9234 plasmid pO157, complete sequence	92559	3473	54866	92559	integrase,transposase,protease	Stx2-converting_phage(30.0%)	39	39657:39671	60056:60070
WP_162829348.1|3473_4686_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000592771.1|4859_7070_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|7113_7503_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|8728_12631_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001171540.1|12999_13380_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|13376_13724_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|13773_15312_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302199.1|17258_18080_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|18079_19186_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|19275_20997_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|21070_22069_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001358886.1|22937_25634_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25720_26596_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|26596_28564_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28563_30069_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|30070_31294_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|31324_31759_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|31755_32310_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|32324_32672_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|32668_33268_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|33264_34242_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|34280_35453_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|35439_35952_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|36009_36843_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36934_37336_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|39226_39742_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39657:39671	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|39743_42740_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42789_44910_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44913_46353_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|47095_47326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|47446_48187_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|48471_49449_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49856_50057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|50053_50674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50670_51354_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51812_52031_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|52032_52338_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016988.1|52338_53121_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.2	1.9e-49
WP_162829202.1|53652_54866_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
60056:60070	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
