The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	846698	898203	5416383	integrase,tRNA,protease,transposase	Stx2-converting_phage(40.0%)	44	839402:839436	885224:885258
839402:839436	attL	ATTGCCGGATGCGGCGTGAACGCCTTATCCGGCCT	NA	NA	NA	NA
WP_000998048.1|846698_848237_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|848286_848634_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|848824_850037_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001239097.1|850077_852213_-	hydrogenase	NA	NA	NA	NA	NA
WP_000609742.1|854087_854762_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953022.1|854810_855800_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	2.9e-98
WP_001121626.1|856407_858057_-	type III secretion system effector EspL2	NA	NA	NA	NA	NA
WP_001453071.1|860290_860464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000605048.1|861036_861585_+	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_000631719.1|863906_864254_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_032319775.1|864250_864901_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	31.6	4.6e-12
WP_162829202.1|864943_866157_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001218882.1|867228_868494_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
WP_000234483.1|868872_869580_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839815.1|869977_872113_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|872162_873419_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001302020.1|873620_874700_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|874764_875040_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001301529.1|875067_876120_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786908.1|876280_877000_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107568.1|876999_877326_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|877509_878229_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394102.1|878404_879451_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745247.1|879567_880575_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239959.1|880817_881954_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174762.1|881946_882540_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277224.1|882547_882838_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|882834_883401_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997808.1|883418_884123_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001055622.1|884140_885121_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017110.1|885311_885728_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
885224:885258	attR	AGGCCGGATAAGGCGTTCACGCCGCATCCGGCAAT	NA	NA	NA	NA
WP_001053178.1|885727_886291_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593272.1|886402_887350_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|887362_888094_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286494.1|888173_888881_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001303653.1|888975_889473_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112296.1|889549_890944_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|891380_892535_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|892838_893054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|893189_893321_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|893329_895306_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758914.1|895451_896183_+	lipoprotein	NA	NA	NA	NA	NA
WP_000105566.1|896318_897239_+	agmatinase	NA	NA	NA	NA	NA
WP_000701842.1|897444_898203_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	1228145	1235196	5416383	tail,transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|1228145_1229359_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1229576_1229846_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1230006_1230429_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1230558_1231617_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1231695_1232346_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1232528_1233119_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1233620_1233869_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1234713_1235196_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 3
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	1514092	1520831	5416383	integrase,transposase	Enterobacteria_phage(50.0%)	6	1501766:1501782	1523027:1523043
1501766:1501782	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1514092_1514662_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|1514801_1516014_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000960724.1|1516428_1517109_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1517118_1518255_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1518429_1519587_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1519898_1520831_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1523027:1523043	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	1746113	1836947	5416383	portal,terminase,lysis,holin,tRNA,transposase,protease,tail	Enterobacteria_phage(54.0%)	83	NA	NA
WP_000968210.1|1746113_1746809_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1746805_1747204_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1747334_1748243_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1748369_1749728_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1749739_1750768_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1750782_1751484_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1751492_1752137_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1752151_1753345_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1753504_1754455_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1754842_1754926_-	protein YohP	NA	NA	NA	NA	NA
WP_001078131.1|1755149_1756586_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1756638_1757400_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1757529_1758108_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1758277_1758865_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1759038_1759971_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1760008_1761724_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1761919_1764217_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1764468_1765386_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1765392_1766550_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1766542_1767469_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	35.1	4.3e-24
WP_000783120.1|1767473_1768205_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1768185_1768293_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1768352_1769054_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_171878939.1|1770192_1771405_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.7e-167
WP_001301135.1|1771725_1771875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070080197.1|1771932_1773459_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.9	7.9e-31
WP_001053042.1|1773960_1774416_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_000224907.1|1774415_1774586_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774495.1|1774578_1774869_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099699.1|1774865_1775228_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971055.1|1775224_1775365_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1775450_1775885_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1776136_1776289_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1777092_1779039_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1779176_1779356_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1779396_1779642_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1779719_1779935_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1779939_1780473_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1780743_1781313_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1781312_1781459_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1781686_1781872_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1782389_1782866_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077630.1|1782862_1784986_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1784982_1785195_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1785194_1786697_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1786641_1788666_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1788753_1789080_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|1789072_1789354_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974959.1|1789356_1789980_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|1789992_1790391_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|1790398_1791151_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|1791164_1791593_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|1791619_1791928_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|1791971_1794617_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|1794613_1794943_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1794942_1795641_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|1795646_1796390_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|1796335_1796965_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080262.1|1797205_1800685_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230466.1|1800751_1801351_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080258.1|1801415_1802729_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023407.1|1802730_1803000_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_075702011.1|1803160_1803577_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	99.3	1.4e-75
WP_001143784.1|1803658_1804300_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1804461_1804710_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1805224_1806910_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1806906_1807626_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1807672_1808143_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1808184_1808646_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001459147.1|1808770_1810774_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1810770_1811907_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1811899_1812631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1812649_1814179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1814189_1815278_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1816518_1816836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1816897_1820527_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1827484_1829518_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1829649_1830759_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1831020_1831302_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1831593_1832136_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1832223_1832898_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1832913_1835394_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162829202.1|1835734_1836947_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 5
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	1945787	2025676	5416383	terminase,head,lysis,holin,transposase,integrase,protease,tail	Stx2-converting_phage(48.81%)	98	1936738:1936752	1952165:1952179
1936738:1936752	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1945787_1946966_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1946946_1947138_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1947219_1947564_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1947751_1948102_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1948098_1948455_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|1948968_1949916_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1949912_1950134_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000188870.1|1950232_1950448_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548528.1|1950524_1950716_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1950688_1950871_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|1950867_1951548_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|1951544_1952330_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1952165:1952179	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_162829202.1|1952605_1953818_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000372937.1|1954019_1954163_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1954131_1954296_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1954368_1954737_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1954919_1955171_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1955229_1955502_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1955479_1955662_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1956230_1956752_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_171878941.1|1956933_1958146_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001302016.1|1958566_1959262_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1959336_1959552_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1959693_1959990_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1960022_1960184_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539352.1|1960170_1960992_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	99.6	4.4e-153
WP_001248388.1|1960988_1962365_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1962435_1962714_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1962846_1963062_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1963072_1963309_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1963265_1963712_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1963708_1964236_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1964232_1964415_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|1964689_1965394_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_070081061.1|1966191_1966779_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	99.5	2.5e-94
WP_162829348.1|1966818_1968032_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_001028855.1|1968107_1968779_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
WP_000512807.1|1968769_1969258_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1969896_1970856_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1970867_1971137_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1971433_1971757_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_070081062.1|1972000_1973938_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	99.7	0.0e+00
WP_000143458.1|1974075_1974255_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1974295_1974568_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1974644_1974860_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1974859_1975357_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1975353_1975791_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1975993_1976491_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1976487_1976745_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1977207_1977435_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1977476_1977842_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958398.1|1978134_1978698_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_070080204.1|1978694_1980356_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_001063023.1|1982400_1982622_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|1985148_1985475_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1985484_1985835_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1985831_1986278_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1986274_1986619_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|1986677_1987394_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1987399_1987774_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1987869_1988079_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070081063.1|1988130_1991211_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.4	0.0e+00
WP_000807954.1|1991203_1991545_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080207.1|1991544_1992243_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	4.3e-133
WP_001302649.1|1992259_1992580_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1992687_1992861_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1992931_1993855_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_021498910.1|1993909_1994647_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	100.0	3.1e-150
WP_134791867.1|1994592_1995225_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_021532863.1|1995558_1995993_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	9.6e-67
WP_021532899.1|1995935_1996283_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	3.7e-61
WP_000998048.1|1996332_1997871_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_070080208.1|1997913_2001393_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230459.1|2001459_2002059_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070081064.1|2002123_2003437_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001509711.1|2003438_2003708_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	1.1e-44
WP_000491542.1|2003848_2004724_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2004948_2005599_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2006922_2008089_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105392.1|2008207_2008681_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2008879_2009938_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2010109_2010439_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2010539_2010722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2011210_2011324_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2011336_2011531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2011989_2012358_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2012431_2012653_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2012715_2013192_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2013206_2013686_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_024177368.1|2013767_2014589_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.4e-45
WP_000846711.1|2014809_2015220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2015235_2015919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070081065.1|2016054_2017194_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2017190_2018096_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2018092_2018974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171878943.1|2018957_2020171_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	1.3e-164
WP_000966626.1|2020542_2022690_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2024137_2025676_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 6
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	2044844	2092664	5416383	capsid,portal,head,terminase,holin,transposase,integrase,tail	Escherichia_phage(40.48%)	54	2030332:2030346	2055499:2055513
2030332:2030346	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_162829202.1|2044844_2046057_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2050341_2051139_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2051374_2052397_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2052396_2052600_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_070080211.1|2052658_2055130_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2055225_2055414_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2055410_2055599_-	cell division inhibitor	NA	NA	NA	NA	NA
2055499:2055513	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2056079_2056232_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2056506_2057151_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2057248_2057476_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2057472_2057898_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2057966_2059004_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2058915_2059458_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2059492_2060191_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2060212_2060437_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2060433_2060790_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2060822_2060975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2060971_2061283_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2061409_2061973_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2062082_2062187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2062373_2062586_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2062627_2062813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2062753_2063032_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_070080212.1|2063033_2064083_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.4e-108
WP_001217457.1|2064095_2064455_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2064451_2065141_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303558.1|2065774_2066203_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_162829202.1|2068612_2069826_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2070136_2070352_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2070356_2070701_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2070751_2071285_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2071440_2071623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2071635_2071767_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2071994_2072180_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2072706_2073021_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2073102_2073327_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2073721_2074231_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2076115_2076322_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2076318_2077911_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2077900_2079406_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2079442_2079790_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2079847_2080114_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2080095_2080836_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2080849_2081281_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2081307_2081721_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001303170.1|2081701_2084281_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847314.1|2084277_2084607_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2084606_2085305_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2085310_2086054_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2085999_2086629_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080262.1|2086869_2090349_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230466.1|2090415_2091015_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070081066.1|2091079_2092393_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	8.2e-77
WP_001023407.1|2092394_2092664_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 7
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	2150040	2170058	5416383	integrase,tail,transposase	Enterobacteria_phage(70.83%)	28	2163194:2163207	2173200:2173213
WP_162829348.1|2150040_2151254_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000005444.1|2151383_2152568_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2152567_2153080_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2153134_2153500_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2153508_2153664_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2156466_2156955_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2157111_2157684_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_032169999.1|2157727_2158273_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	8.1e-87
WP_162829202.1|2158310_2159523_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000211280.1|2159606_2159921_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2159925_2160885_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2160961_2163784_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2163194:2163207	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2163790_2164156_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2164152_2164770_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2164781_2165081_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2165077_2165344_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2165340_2165544_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2165567_2165984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2166076_2166190_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2166186_2166429_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2166440_2166719_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2166729_2167080_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2167101_2167305_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2167376_2167514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2167603_2168008_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2168023_2168674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2168703_2169051_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2169056_2170058_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2173200:2173213	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	2490602	2583089	5416383	portal,terminase,head,holin,transposase,protease,tail	Stx2-converting_phage(36.21%)	95	NA	NA
WP_001260835.1|2490602_2491424_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2491523_2491607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2491699_2492035_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091831.1|2492431_2493685_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2493791_2494685_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2494819_2496040_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2496164_2496860_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071527647.1|2496812_2498105_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2498262_2498877_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2498919_2499774_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2499775_2500393_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001509682.1|2500403_2502827_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041704.1|2502887_2505314_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2505512_2505818_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2505925_2506636_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2506638_2507199_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2507233_2507575_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2507709_2508036_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2509024_2509276_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_070080217.1|2509348_2511820_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2511912_2512104_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2512100_2512289_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|2512857_2513076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2513147_2513447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2513799_2514078_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2514079_2514271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2514291_2514663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2514760_2515063_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2515059_2515485_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2515507_2516470_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2516476_2517217_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2518027_2518423_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2518479_2519064_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2519179_2519284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2519472_2519685_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2519852_2520131_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2520132_2521182_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217457.1|2521194_2521554_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2521550_2522240_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001455449.1|2522876_2523305_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	2.2e-63
WP_000023184.1|2523783_2525634_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2526072_2526288_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2526292_2526637_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2526687_2527221_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_162829202.1|2527327_2528541_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001056806.1|2528804_2529374_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2529373_2529520_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2529747_2529933_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2530357_2530585_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|2530626_2530992_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_070080218.1|2531280_2531844_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_024219862.1|2531840_2533502_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_001063023.1|2535546_2535768_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080220.1|2535713_2538293_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.4	0.0e+00
WP_000125988.1|2538295_2538622_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2538631_2538982_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2538978_2539425_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2539421_2539766_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001030063.1|2540554_2540929_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2541024_2541234_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080221.1|2541285_2544366_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.4	0.0e+00
WP_000807954.1|2544358_2544700_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152180.1|2544699_2545137_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_070080232.1|2545325_2548799_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001228304.1|2548866_2549466_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|2549617_2550931_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023407.1|2550932_2551202_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001025672.1|2552228_2553554_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2555151_2555274_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001509602.1|2555380_2556292_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	81.8	1.5e-133
WP_000938103.1|2556357_2556927_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2557892_2559431_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2559480_2559828_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2559824_2560205_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001303943.1|2560544_2560823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2561250_2561397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2561533_2562181_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2562364_2562955_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2564461_2565112_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|2566425_2566932_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2566977_2567478_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2567563_2567743_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2568123_2568930_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2568929_2570123_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2570134_2571496_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2571496_2573092_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2573091_2574654_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2574745_2574790_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2574927_2575809_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2575805_2576426_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_162829202.1|2577238_2578451_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001291216.1|2579562_2580435_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2580474_2581065_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2581061_2581820_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2582039_2583089_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	2852909	2952312	5416383	capsid,portal,terminase,head,holin,transposase,integrase,tail	Escherichia_phage(31.07%)	120	2896170:2896183	2953191:2953204
WP_000214712.1|2852909_2853113_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2853148_2854609_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2856112_2856355_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2856516_2857158_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2857239_2857869_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2857941_2858517_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2858629_2858899_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_070080214.1|2858900_2860214_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001230466.1|2860278_2860878_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070081045.1|2860944_2864421_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	97.9	0.0e+00
WP_140395871.1|2864661_2865291_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080198.1|2865236_2865980_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_001151105.1|2865985_2866684_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847314.1|2866683_2867013_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_064032219.1|2867009_2869655_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000532075.1|2869698_2870007_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479039.1|2870033_2870462_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2870475_2871228_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683063.1|2871235_2871631_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2871627_2872161_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2872175_2872529_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2872540_2872939_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2872980_2874006_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2874061_2874394_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2874403_2875723_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2875703_2877305_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2877301_2877508_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2877504_2879430_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2879404_2879950_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2880336_2880561_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2880642_2880957_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2881482_2881668_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2881890_2882037_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2882036_2882606_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2882876_2883410_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2883460_2883805_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2883809_2884025_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2884463_2886314_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001303509.1|2886791_2887220_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000301797.1|2887674_2888388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2888523_2888721_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2888945_2889500_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2889562_2889868_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2889880_2890930_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2890931_2891204_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2891325_2891670_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2891789_2892002_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2892235_2892793_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2892794_2893013_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2893140_2893452_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2893444_2893672_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2893668_2893950_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2893982_2894699_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2894732_2895194_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2895186_2896230_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
2896170:2896183	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|2896298_2896724_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2896707_2896950_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2897341_2897680_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2897972_2898125_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2898136_2898775_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2898775_2898985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2899549_2899738_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2899734_2899923_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2900015_2901260_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2901970_2902213_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_077890479.1|2903175_2903610_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	3.7e-66
WP_021532899.1|2903552_2903900_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	3.7e-61
WP_000998048.1|2903949_2905488_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2906070_2906721_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_075702005.1|2907515_2908730_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.6	1.6e-79
WP_001230508.1|2908794_2909394_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050439450.1|2913282_2913915_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_070080223.1|2913860_2914604_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_070080222.1|2914614_2915313_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|2915312_2915654_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_021503509.1|2915646_2918889_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_001453698.1|2918940_2919150_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2919245_2919620_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2919625_2920342_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|2920400_2920745_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2920741_2921188_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2921184_2921535_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2921544_2921871_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2924397_2924619_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080219.1|2926663_2928325_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_047082927.1|2928321_2928885_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	83.4	7.1e-70
WP_000279796.1|2929175_2929541_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2929582_2929810_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2930234_2930420_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2930647_2930794_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2930793_2931363_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2931633_2932167_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2932217_2932562_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2932566_2932782_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_070080234.1|2933221_2935072_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000935549.1|2935868_2936933_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	2.9e-197
WP_000917750.1|2937083_2937281_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2937522_2938053_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2938061_2938421_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2938433_2939480_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2939481_2939760_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2939829_2940087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2940307_2940520_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2940798_2941557_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2942255_2942420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2942416_2942998_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2943184_2943727_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2943638_2944679_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2944650_2945202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2945185_2945413_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2945489_2945897_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2946160_2946460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2946532_2946751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2946773_2947181_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2947158_2947392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2947950_2948139_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2948135_2948327_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2948419_2950891_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2950955_2951204_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2951181_2952312_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2953191:2953204	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 10
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	3047101	3120759	5416383	capsid,portal,head,terminase,lysis,holin,transposase,tRNA,integrase,protease,tail	Enterobacteria_phage(53.85%)	88	3091326:3091341	3119580:3119595
WP_162829202.1|3047101_3048315_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001131446.1|3050783_3050903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|3050863_3051049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3051149_3051323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3051384_3051669_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|3051672_3052008_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001299921.1|3055105_3055324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358812.1|3055455_3056979_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3057362_3057611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888778.1|3057723_3057990_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858015.1|3058018_3058291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554146.1|3058333_3058570_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001359088.1|3058883_3060095_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332300.1|3060299_3061031_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373094.1|3061251_3061656_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032169657.1|3061708_3061819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3062054_3062099_+	protein YmgK	NA	NA	NA	NA	NA
WP_000872355.1|3062351_3062675_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	7.5e-40
WP_000539892.1|3062777_3062930_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001358785.1|3063409_3063847_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3063871_3064456_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3064954_3065908_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3066094_3067579_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3067881_3069420_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3069469_3069817_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3069813_3070194_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3070269_3070518_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3070574_3071243_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3071740_3071923_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3072001_3072502_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3072538_3073045_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3073063_3073954_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3074073_3074655_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3074654_3077570_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3077634_3078234_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_070080236.1|3078300_3081699_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090919.1|3081759_3082392_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_000194779.1|3082328_3083072_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3083077_3083776_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3083775_3084105_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3084101_3086651_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3086643_3087078_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3087059_3087482_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3087497_3088238_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3088245_3088641_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975102.1|3088637_3089216_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_000752995.1|3089227_3089581_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3089592_3089991_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3090032_3091058_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3091113_3091446_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3091326:3091341	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3091455_3092775_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3092755_3094357_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3094353_3094560_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3094556_3096482_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3096456_3097002_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3097390_3097585_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3097749_3097956_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001459037.1|3098241_3098652_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	8.0e-71
WP_000738495.1|3098943_3099237_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3099327_3099510_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3099726_3100203_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3100189_3100495_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3100816_3101506_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3101502_3101643_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3101639_3102002_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774484.1|3101998_3102289_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224907.1|3102281_3102452_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3102451_3102907_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_001693106.1|3103408_3104935_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	9.3e-32
WP_001459030.1|3104992_3105115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3105179_3105512_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3105579_3105882_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3105878_3106580_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3107504_3107741_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3107730_3108873_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3108986_3110237_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3110408_3111062_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3111071_3111533_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3111586_3112693_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3112728_3113370_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3113373_3114744_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3114912_3115584_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3115583_3117044_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3117644_3117926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3118181_3118724_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3118929_3119343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3119355_3119691_-|head	head decoration protein	head	NA	NA	NA	NA
3119580:3119595	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3119703_3120759_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	3126851	3181004	5416383	terminase,head,holin,transposase,integrase,tail	Stx2-converting_phage(26.0%)	62	3126715:3126729	3184069:3184083
3126715:3126729	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
WP_000085256.1|3126851_3128081_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3128329_3129451_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3129499_3130726_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3130975_3132112_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3132095_3132959_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3133322_3134684_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3134744_3135020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3137328_3140730_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3141320_3143669_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3143688_3143778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071527644.1|3143790_3144027_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	82.0	5.7e-21
WP_000967271.1|3143972_3144710_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3144763_3145642_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_032169778.1|3145905_3146055_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3146164_3146419_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3146435_3147134_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3147133_3147475_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080237.1|3147467_3150710_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_001453698.1|3150761_3150971_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3151066_3151441_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_000133388.1|3152238_3152583_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3152579_3153026_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3153022_3153373_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3153382_3153709_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|3156235_3156457_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080238.1|3158501_3160163_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.1	0.0e+00
WP_070080218.1|3160159_3160723_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_000279786.1|3161011_3161377_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|3161418_3161604_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3161733_3161874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3162230_3162455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3162519_3162726_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3162953_3163100_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3163099_3163669_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3163939_3164473_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731241.1|3164523_3164868_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3164872_3165088_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3165163_3165433_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3165470_3165653_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3165800_3167738_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000762928.1|3168816_3169638_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|3169634_3170009_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265159.1|3170021_3171071_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3171072_3171351_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3171518_3171731_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3171919_3172024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3172139_3172727_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3172729_3172921_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3172922_3173360_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3173346_3173664_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3173617_3173935_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3173924_3174227_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3174223_3174505_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3174537_3175254_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3175287_3175830_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_070081068.1|3175741_3176785_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	78.8	1.4e-87
WP_000693915.1|3176853_3177279_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3177262_3177586_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3177710_3178187_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3178502_3178655_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_001509524.1|3178769_3179285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3179791_3181004_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
3184069:3184083	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 12
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	3281073	3331975	5416383	protease,transposase	Stx2-converting_phage(27.78%)	47	NA	NA
WP_162829202.1|3281073_3282287_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001069768.1|3284658_3285531_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282125.1|3285858_3286041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422760.1|3286340_3286766_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
WP_162829202.1|3286966_3288179_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001304205.1|3288851_3291020_-	DNA2/NAM7 family helicase	NA	NA	NA	NA	NA
WP_001304206.1|3291016_3291532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345400.1|3291772_3292819_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|3294806_3294998_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3295050_3295284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3295379_3296003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3296091_3296601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3297058_3297517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3298870_3299995_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3300724_3300922_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3300987_3301203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|3301562_3301751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3301847_3302027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3302078_3302273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3303053_3303389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3304021_3304240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3305692_3307783_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3308296_3308683_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3309105_3309681_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3309749_3310328_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3310376_3311417_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3311439_3311895_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3311917_3313075_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3313074_3313656_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3313978_3315037_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3315046_3316189_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3316181_3316955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3316956_3318036_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797375.1|3318035_3318992_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506896.1|3319002_3320211_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3320228_3320696_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3320956_3321286_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3321272_3321614_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3322556_3324170_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3324200_3324551_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3324547_3324973_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_162829202.1|3325315_3326529_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032169707.1|3326566_3328906_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000136079.1|3329067_3329244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|3329662_3331201_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3331250_3331598_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3331594_3331975_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 13
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	3451894	3508971	5416383	capsid,portal,head,holin,transposase,integrase,protease,tail	Escherichia_phage(25.58%)	61	3453829:3453844	3510736:3510751
WP_000003653.1|3451894_3452482_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3452478_3453186_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3453204_3454998_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3453829:3453844	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3454994_3456113_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3458527_3458797_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_070080241.1|3458798_3460112_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	9.7e-78
WP_001230466.1|3460176_3460776_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070081069.1|3460843_3464317_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.3	0.0e+00
WP_000649829.1|3464450_3464978_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3465168_3465801_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_070081070.1|3465746_3466490_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	2.7e-149
WP_001151105.1|3466495_3467194_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847314.1|3467193_3467523_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001303170.1|3467519_3470099_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000533402.1|3470079_3470493_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3470519_3470951_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3470964_3471705_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3471686_3471953_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3472010_3472358_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3472394_3473900_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3473889_3475482_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3475478_3475685_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3477861_3479400_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3479449_3479797_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3479793_3480174_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|3480249_3480525_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_162829348.1|3481391_3482604_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_050547091.1|3482601_3482796_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.9	9.7e-19
WP_000138558.1|3483051_3483324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003126.1|3483483_3484017_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|3484237_3484351_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3484572_3484758_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3485285_3485600_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3485804_3487018_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070080245.1|3487193_3489044_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000261909.1|3489811_3490525_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265269.1|3491145_3491964_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3492115_3492487_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3492476_3492848_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3492860_3493910_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3493911_3494190_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3494357_3494513_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000160654.1|3495117_3495891_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3496242_3496656_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3496671_3497442_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3497463_3498210_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3498216_3499308_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3499386_3499842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3500048_3500474_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3500457_3500730_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3500838_3501240_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3501267_3501459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3502023_3502179_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001458970.1|3502320_3502644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3502896_3503082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3503655_3503844_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3503840_3504032_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3504125_3506597_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3506664_3506907_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3506884_3507904_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3508311_3508971_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3510736:3510751	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 14
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	3739904	3764979	5416383	terminase,lysis,holin,transposase,integrase,protease,tail	Escherichia_phage(35.71%)	35	3739489:3739503	3765053:3765067
3739489:3739503	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3739904_3740603_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3740833_3741715_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3741883_3742045_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3742541_3743561_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3743594_3744575_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3744751_3745021_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741877.1|3745022_3746276_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.7	2.4e-70
WP_072140989.1|3746335_3746914_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.2	6.8e-100
WP_162829202.1|3746980_3748193_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001072975.1|3748258_3748471_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934140.1|3748467_3750570_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3750569_3751061_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3751735_3751888_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3751875_3752343_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3752339_3752837_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3752836_3753052_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3753194_3753593_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3753673_3753832_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3753917_3754661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3754844_3755534_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3755548_3755671_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3756008_3756968_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3757179_3757845_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3757841_3758462_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3758454_3758625_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3758621_3758804_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_162829202.1|3759724_3760938_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682316.1|3761491_3761674_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3761646_3761838_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000188862.1|3761914_3762130_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763363.1|3762228_3762450_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3762660_3763263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3763505_3763673_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3763712_3763931_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3763908_3764979_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3765053:3765067	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	4280999	4410687	5416383	plate,holin,transposase	Escherichia_phage(15.38%)	111	NA	NA
WP_001159112.1|4280999_4282688_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.3e-61
WP_001356433.1|4283368_4283503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072140985.1|4285586_4286348_+	protein HyxA	NA	NA	NA	NA	NA
WP_000798051.1|4286389_4287484_+	adhesin	NA	NA	NA	NA	NA
WP_001356435.1|4287437_4287650_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001301982.1|4288742_4289438_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023931.1|4289430_4290858_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|4290868_4291588_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339591.1|4292114_4292969_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046339.1|4293194_4294520_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|4294628_4294865_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|4294876_4295470_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001458949.1|4295629_4296499_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.0e-51
WP_000621002.1|4296747_4297605_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092592.1|4297725_4301979_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_162829202.1|4302694_4303908_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001038968.1|4304625_4304982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509407.1|4305269_4306196_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|4306352_4307273_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171878957.1|4308278_4309492_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	7.1e-168
WP_000998051.1|4310774_4312313_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4312362_4312710_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|4312706_4313087_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000803998.1|4313350_4313614_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4313613_4313754_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4313823_4314015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4314839_4315382_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4315456_4316044_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4316101_4316770_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4316795_4319321_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4319310_4320954_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4320922_4321633_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|4321945_4322275_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4322522_4323137_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4323554_4324244_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4324240_4325197_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4325193_4327392_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4327401_4328358_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171067.1|4328536_4329664_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4329805_4330864_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4331109_4332012_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4332714_4332993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4333159_4333882_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4333980_4334880_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4335555_4336512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|4338990_4339314_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4339313_4339535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973390.1|4339531_4340089_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.0	1.0e-28
WP_001244581.1|4340085_4340346_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4341279_4342032_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4342028_4342580_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4342585_4342858_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4343267_4343834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4343833_4344424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4344454_4345087_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4345079_4345538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4345537_4346155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829348.1|4346220_4347433_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_087498070.1|4347532_4348375_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001509364.1|4348397_4351049_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.1	5.4e-43
WP_162829348.1|4351129_4352342_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000165865.1|4353429_4354305_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000189397.1|4354518_4355226_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001458941.1|4355227_4355377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508241.1|4355388_4355604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642925.1|4355695_4356106_+	hypothetical protein	NA	G5DES5	Salmonella_phage	42.6	2.1e-26
WP_000480477.1|4356171_4357110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234373.1|4357199_4358018_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214420.1|4358109_4358595_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186786.1|4358610_4359087_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|4359155_4359377_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_000942525.1|4360660_4361731_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|4361709_4362369_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000893282.1|4362888_4364142_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4364153_4365257_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4365544_4366600_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4366638_4367040_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4367097_4368342_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4368433_4368892_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4369152_4370610_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001059871.1|4371708_4372161_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4372170_4372569_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4372571_4372865_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4372916_4373972_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4374042_4374828_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_070081074.1|4374772_4376512_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4377329_4378103_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4378288_4378549_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4378567_4378828_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4378983_4379724_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4379694_4380462_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4380566_4381145_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4381384_4383829_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4383871_4384345_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4384498_4385269_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4385386_4386559_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4386639_4386825_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4386739_4387003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070080248.1|4388967_4390104_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000509109.1|4394047_4398280_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4398355_4400497_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4400706_4401225_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4401921_4402422_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4402456_4402681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509383.1|4402731_4404123_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4404213_4404627_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4404630_4406481_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4406444_4407527_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4407551_4408832_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4408828_4409353_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4409355_4410687_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 16
NZ_CP017434	Escherichia coli O157:H7 strain 1130 chromosome, complete genome	5416383	5044849	5059514	5416383	integrase,tail,tRNA	Enterobacteria_phage(43.75%)	19	5040690:5040705	5058219:5058234
5040690:5040705	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5044849_5046265_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5046347_5047331_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5047496_5047739_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5047872_5048910_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5048998_5050096_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5050157_5050406_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5050566_5051208_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5051289_5051919_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5051991_5052564_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5052675_5052945_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5052946_5054260_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5054324_5054924_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5056245_5056782_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5056772_5057123_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5057119_5057404_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5057739_5057937_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5058281_5058563_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5058219:5058234	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5058610_5058784_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5058980_5059514_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP017435	Escherichia coli O157:H7 strain 1130 plasmid pO157, complete sequence	92624	3473	53121	92624	protease,integrase,transposase	Stx2-converting_phage(33.33%)	38	39657:39671	60097:60111
WP_162829348.1|3473_4686_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000592771.1|4859_7070_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|7113_7503_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|8728_12631_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_077890479.1|12999_13434_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	3.7e-66
WP_021532899.1|13376_13724_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	3.7e-61
WP_000998048.1|13773_15312_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302199.1|17258_18080_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|18079_19186_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|19275_20997_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|21070_22069_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001358886.1|22937_25634_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25720_26596_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|26596_28564_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28563_30069_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|30070_31294_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|31324_31759_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|31755_32310_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|32324_32672_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|32668_33268_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|33264_34242_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|34280_35453_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|35439_35952_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|36009_36843_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36934_37336_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|39226_39742_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39657:39671	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|39743_42740_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42789_44910_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44913_46353_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|47095_47326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|47446_48187_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_070081077.1|48471_49449_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.6	2.5e-99
WP_000708307.1|49856_50057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|50053_50674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50670_51354_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51812_52031_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|52032_52338_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016988.1|52338_53121_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.2	1.9e-49
60097:60111	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
