The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015953	Legionella pneumophila strain E6_N chromosome, complete genome	3405173	921831	928671	3405173		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|921831_922608_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|922600_923635_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|923612_924191_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|924224_924950_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|924946_925456_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|925436_926006_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|926002_926530_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|926543_927506_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|927873_928671_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015953	Legionella pneumophila strain E6_N chromosome, complete genome	3405173	1311051	1316988	3405173		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1311051_1312125_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1312109_1312724_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1312720_1313929_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1313936_1314404_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1314529_1316167_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1316163_1316988_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015953	Legionella pneumophila strain E6_N chromosome, complete genome	3405173	2222574	2232698	3405173		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2222574_2224263_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2224394_2225402_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2225525_2226851_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2226869_2228018_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2228226_2229339_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2229434_2230574_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2230763_2232698_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015953	Legionella pneumophila strain E6_N chromosome, complete genome	3405173	2274526	2329551	3405173	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2274526_2275978_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2276048_2277569_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2278416_2278791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2278988_2280596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2280598_2281090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2281100_2281937_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2282529_2283621_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2283852_2289798_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2289818_2291711_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2291775_2292240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2292243_2294964_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2294969_2296355_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2296351_2296774_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2296763_2297546_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2297538_2299350_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2299349_2300018_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2300033_2301029_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2301025_2301634_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2301630_2301966_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2301958_2304511_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2304522_2304873_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2304886_2306173_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2306174_2306888_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2306890_2307454_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2307457_2307751_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2307752_2308055_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2308069_2308306_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2308319_2308697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2308644_2309529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2309701_2310382_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2310530_2311205_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2311653_2312226_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2312209_2312707_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2312699_2313287_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2313291_2315427_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2315445_2316327_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2316433_2316580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2316771_2316948_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2317117_2317615_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2317604_2318384_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2318376_2319231_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2319245_2319539_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2319728_2320250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2320554_2321013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2321586_2321814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2321971_2322493_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2322664_2323219_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2323652_2323853_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2323946_2324330_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2324383_2325337_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2325846_2327265_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2327297_2328473_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2328525_2329551_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015953	Legionella pneumophila strain E6_N chromosome, complete genome	3405173	2626700	2689969	3405173	tRNA,protease,integrase,transposase	Erysipelothrix_phage(18.75%)	57	2632608:2632654	2688640:2688686
WP_070074399.1|2626700_2627702_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.4	1.3e-90
WP_010948064.1|2627906_2628146_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2628348_2628792_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2628800_2630534_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2630620_2632486_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2632608:2632654	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2632744_2633872_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2634252_2634438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2634430_2635207_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2635340_2636156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2636197_2637508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2637637_2639119_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2639272_2639515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2639749_2639944_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2639971_2643247_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2643239_2643902_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2643921_2645877_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2645894_2648927_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2649002_2650802_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2650798_2651482_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2651683_2652568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2652587_2652899_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2652915_2653188_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2653215_2654181_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2654192_2654570_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2654566_2654866_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2654862_2657397_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2657393_2658092_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2658088_2658964_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2658966_2659374_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2659379_2660627_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2660638_2661379_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2661401_2661614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2661618_2663001_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2662997_2664887_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2664883_2665429_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2665425_2665590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2665582_2667769_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2667898_2669494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2669803_2671666_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2671662_2672016_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2672409_2672754_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2672753_2673479_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2673478_2673916_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_152027021.1|2674163_2675336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080444600.1|2675647_2677282_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2677236_2677629_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2678110_2678353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2678595_2680536_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2680615_2681467_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2681463_2682072_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2682879_2683284_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2683241_2683367_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2683491_2684544_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2684550_2685768_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2685797_2686844_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2686845_2687910_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2688793_2689969_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2688640:2688686	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
