The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015950	Legionella pneumophila strain E4_N chromosome, complete genome	3416758	923756	930596	3416758		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|923756_924533_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|924525_925560_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|925537_926116_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|926149_926875_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|926871_927381_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|927361_927931_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|927927_928455_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|928468_929431_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|929798_930596_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015950	Legionella pneumophila strain E4_N chromosome, complete genome	3416758	1313229	1319166	3416758		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1313229_1314303_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1314287_1314902_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1314898_1316107_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1316114_1316582_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1316707_1318345_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1318341_1319166_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015950	Legionella pneumophila strain E4_N chromosome, complete genome	3416758	2222704	2232828	3416758		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2222704_2224393_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2224524_2225532_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2225655_2226981_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2226999_2228148_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2228356_2229469_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2229564_2230704_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2230893_2232828_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015950	Legionella pneumophila strain E4_N chromosome, complete genome	3416758	2274656	2329681	3416758	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2274656_2276108_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2276178_2277699_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2278546_2278921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2279118_2280726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2280728_2281220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2281230_2282067_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2282659_2283751_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2283982_2289928_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2289948_2291841_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2291905_2292370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2292373_2295094_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2295099_2296485_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2296481_2296904_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2296893_2297676_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2297668_2299480_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2299479_2300148_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2300163_2301159_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2301155_2301764_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2301760_2302096_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2302088_2304641_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2304652_2305003_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2305016_2306303_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2306304_2307018_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2307020_2307584_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2307587_2307881_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2307882_2308185_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2308199_2308436_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2308449_2308827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2308774_2309659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2309831_2310512_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2310660_2311335_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2311783_2312356_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2312339_2312837_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2312829_2313417_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2313421_2315557_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2315575_2316457_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2316563_2316710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2316901_2317078_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2317247_2317745_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2317734_2318514_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2318506_2319361_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2319375_2319669_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2319858_2320380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2320684_2321143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2321716_2321944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2322101_2322623_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2322794_2323349_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2323782_2323983_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2324076_2324460_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2324513_2325467_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2325976_2327395_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2327427_2328603_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2328655_2329681_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015950	Legionella pneumophila strain E4_N chromosome, complete genome	3416758	2626829	2690098	3416758	protease,integrase,tRNA,transposase	Erysipelothrix_phage(18.75%)	57	2632737:2632783	2688769:2688815
WP_010948063.1|2626829_2627831_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2628035_2628275_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2628477_2628921_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2628929_2630663_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2630749_2632615_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2632737:2632783	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2632873_2634001_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2634381_2634567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2634559_2635336_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2635469_2636285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2636326_2637637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2637766_2639248_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2639401_2639644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2639878_2640073_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2640100_2643376_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2643368_2644031_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2644050_2646006_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2646023_2649056_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2649131_2650931_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2650927_2651611_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2651812_2652697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2652716_2653028_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2653044_2653317_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2653344_2654310_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2654321_2654699_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2654695_2654995_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2654991_2657526_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2657522_2658221_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2658217_2659093_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2659095_2659503_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2659508_2660756_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2660767_2661508_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2661530_2661743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2661747_2663130_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2663126_2665016_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2665012_2665558_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2665554_2665719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2665711_2667898_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2668027_2669623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2669932_2671795_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2671791_2672145_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2672538_2672883_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2672882_2673608_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2673607_2674045_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2674292_2675354_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2675776_2677411_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2677365_2677758_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2678239_2678482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2678724_2680665_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2680744_2681596_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2681592_2682201_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2683008_2683413_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2683370_2683496_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2683620_2684673_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2684679_2685897_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2685926_2686973_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2686974_2688039_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2688922_2690098_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2688769:2688815	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
