The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015949	Legionella pneumophila strain E3_N chromosome, complete genome	3465352	923873	930713	3465352		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|923873_924650_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|924642_925677_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|925654_926233_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|926266_926992_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|926988_927498_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|927478_928048_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|928044_928572_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|928585_929548_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|929915_930713_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015949	Legionella pneumophila strain E3_N chromosome, complete genome	3465352	1314925	1320862	3465352		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1314925_1315999_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1315983_1316598_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1316594_1317803_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1317810_1318278_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1318403_1320041_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1320037_1320862_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015949	Legionella pneumophila strain E3_N chromosome, complete genome	3465352	2224399	2234523	3465352		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2224399_2226088_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2226219_2227227_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2227350_2228676_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2228694_2229843_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2230051_2231164_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2231259_2232399_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2232588_2234523_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015949	Legionella pneumophila strain E3_N chromosome, complete genome	3465352	2321624	2376649	3465352	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2321624_2323076_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2323146_2324667_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2325514_2325889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2326086_2327694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2327696_2328188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2328198_2329035_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2329627_2330719_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2330950_2336896_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2336916_2338809_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2338873_2339338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2339341_2342062_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2342067_2343453_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2343449_2343872_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2343861_2344644_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2344636_2346448_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2346447_2347116_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2347131_2348127_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2348123_2348732_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2348728_2349064_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2349056_2351609_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2351620_2351971_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2351984_2353271_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2353272_2353986_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2353988_2354552_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2354555_2354849_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2354850_2355153_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2355167_2355404_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2355417_2355795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2355742_2356627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2356799_2357480_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2357628_2358303_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2358751_2359324_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2359307_2359805_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2359797_2360385_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2360389_2362525_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2362543_2363425_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2363531_2363678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2363869_2364046_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2364215_2364713_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2364702_2365482_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2365474_2366329_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2366343_2366637_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2366826_2367348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2367652_2368111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2368684_2368912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2369069_2369591_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2369762_2370317_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2370750_2370951_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2371044_2371428_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2371481_2372435_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2372944_2374363_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2374395_2375571_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2375623_2376649_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015949	Legionella pneumophila strain E3_N chromosome, complete genome	3465352	2673797	2737066	3465352	integrase,tRNA,transposase,protease	Erysipelothrix_phage(18.75%)	57	2679705:2679751	2735737:2735783
WP_010948063.1|2673797_2674799_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2675003_2675243_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2675445_2675889_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2675897_2677631_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2677717_2679583_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2679705:2679751	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2679841_2680969_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2681349_2681535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2681527_2682304_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2682437_2683253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2683294_2684605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2684734_2686216_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2686369_2686612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2686846_2687041_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2687068_2690344_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2690336_2690999_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2691018_2692974_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2692991_2696024_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2696099_2697899_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2697895_2698579_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2698780_2699665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2699684_2699996_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2700012_2700285_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2700312_2701278_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2701289_2701667_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2701663_2701963_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2701959_2704494_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2704490_2705189_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2705185_2706061_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2706063_2706471_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2706476_2707724_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2707735_2708476_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2708498_2708711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2708715_2710098_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2710094_2711984_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2711980_2712526_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2712522_2712687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2712679_2714866_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2714995_2716591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2716900_2718763_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2718759_2719113_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2719506_2719851_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2719850_2720576_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2720575_2721013_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2721260_2722322_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2722744_2724379_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2724333_2724726_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2725207_2725450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2725692_2727633_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2727712_2728564_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2728560_2729169_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2729976_2730381_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2730338_2730464_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2730588_2731641_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2731647_2732865_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2732894_2733941_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2733942_2735007_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2735890_2737066_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2735737:2735783	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
