The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015947	Legionella pneumophila strain E2_N chromosome, complete genome	3336955	918835	925675	3336955		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|918835_919612_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|919604_920639_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|920616_921195_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|921228_921954_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|921950_922460_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|922440_923010_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|923006_923534_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|923547_924510_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|924877_925675_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015947	Legionella pneumophila strain E2_N chromosome, complete genome	3336955	1308307	1314244	3336955		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1308307_1309381_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1309365_1309980_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1309976_1311185_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1311192_1311660_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1311785_1313423_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1313419_1314244_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015947	Legionella pneumophila strain E2_N chromosome, complete genome	3336955	2217023	2227147	3336955		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2217023_2218712_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2218843_2219851_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2219974_2221300_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2221318_2222467_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2222675_2223788_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2223883_2225023_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2225212_2227147_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015947	Legionella pneumophila strain E2_N chromosome, complete genome	3336955	2545394	2608663	3336955	protease,transposase,tRNA,integrase	Erysipelothrix_phage(18.75%)	57	2551302:2551348	2607334:2607380
WP_010948063.1|2545394_2546396_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2546600_2546840_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2547042_2547486_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2547494_2549228_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2549314_2551180_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2551302:2551348	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2551438_2552566_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2552946_2553132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2553124_2553901_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2554034_2554850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2554891_2556202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2556331_2557813_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2557966_2558209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2558443_2558638_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2558665_2561941_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2561933_2562596_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2562615_2564571_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2564588_2567621_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2567696_2569496_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2569492_2570176_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2570377_2571262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2571281_2571593_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2571609_2571882_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2571909_2572875_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2572886_2573264_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2573260_2573560_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2573556_2576091_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2576087_2576786_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2576782_2577658_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2577660_2578068_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2578073_2579321_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2579332_2580073_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2580095_2580308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2580312_2581695_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2581691_2583581_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2583577_2584123_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2584119_2584284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2584276_2586463_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2586592_2588188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2588497_2590360_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2590356_2590710_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2591103_2591448_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2591447_2592173_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2592172_2592610_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2592857_2593919_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2594341_2595976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2595930_2596323_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2596804_2597047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2597289_2599230_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2599309_2600161_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2600157_2600766_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2601573_2601978_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2601935_2602061_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2602185_2603238_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2603244_2604462_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2604491_2605538_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2605539_2606604_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2607487_2608663_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2607334:2607380	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
