The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	0	5878	6174401		Tupanvirus(50.0%)	4	NA	NA
WP_004855789.1|2053_2473_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_032694275.1|2483_3989_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	8.9e-19
WP_004855792.1|3994_4960_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_004855794.1|4987_5878_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	7.4e-05
>prophage 2
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	20067	22857	6174401		uncultured_virus(100.0%)	1	NA	NA
WP_032693315.1|20067_22857_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.6	3.3e-75
>prophage 3
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	26749	29217	6174401		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_032693312.1|26749_28159_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004127098.1|28167_29217_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 4
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	36041	36959	6174401		Pandoravirus(100.0%)	1	NA	NA
WP_014836999.1|36041_36959_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.0	4.2e-19
>prophage 5
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	92291	93272	6174401	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_070082752.1|92291_93272_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
>prophage 6
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	98826	100338	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014227417.1|98826_100338_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	5.1e-14
>prophage 7
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	108642	112169	6174401		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_004127220.1|108642_109263_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_014227423.1|109334_110009_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_070082754.1|110100_111474_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004127228.1|111470_112169_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 8
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	116787	118122	6174401		Erwinia_phage(100.0%)	1	NA	NA
WP_004127247.1|116787_118122_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 9
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	130493	133193	6174401		Escherichia_phage(50.0%)	3	NA	NA
WP_032693279.1|130493_131243_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	1.0e-23
WP_032693278.1|131371_132475_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004107558.1|132530_133193_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
>prophage 10
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	159979	161626	6174401		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014227445.1|159979_161626_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	33.0	1.6e-66
>prophage 11
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	171316	182151	6174401		Vibrio_phage(20.0%)	9	NA	NA
WP_032693769.1|171316_172045_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.2e-21
WP_032693768.1|172147_174166_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
WP_032693767.1|174169_175132_-	ribokinase	NA	NA	NA	NA	NA
WP_014837065.1|175115_176531_-	cytosine permease	NA	NA	NA	NA	NA
WP_032693766.1|176549_177566_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.3	2.2e-08
WP_004097500.1|177787_178528_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160743202.1|178592_180089_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004127388.1|180214_181480_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
WP_004097507.1|181821_182151_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 12
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	186201	190479	6174401		Catovirus(33.33%)	4	NA	NA
WP_004097518.1|186201_187332_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
WP_014227455.1|187328_188591_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	2.8e-26
WP_014837069.1|188669_189344_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004097526.1|189348_190479_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
>prophage 13
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	213841	217700	6174401		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_009651718.1|213841_214744_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
WP_014227468.1|214743_215460_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_014227469.1|215537_217700_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	1.3e-116
>prophage 14
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	221549	223376	6174401		Catovirus(100.0%)	1	NA	NA
WP_014837082.1|221549_223376_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	2.8e-83
>prophage 15
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	234180	240359	6174401		Alteromonas_phage(33.33%)	7	NA	NA
WP_032693755.1|234180_235629_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
WP_004097585.1|235699_236455_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_014227479.1|236468_237074_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_032693754.1|237070_238711_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.9	1.5e-40
WP_032693753.1|238788_239040_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_014227481.1|239043_239583_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004097593.1|239585_240359_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
>prophage 16
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	249564	250179	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_014227487.1|249564_250179_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 17
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	260057	279775	6174401		uncultured_Mediterranean_phage(16.67%)	14	NA	NA
WP_014227490.1|260057_261008_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	3.0e-28
WP_004097636.1|262009_263194_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004097638.1|263426_263810_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002438628.1|263811_264357_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
WP_004097640.1|264510_264939_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004097642.1|264942_265647_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004097644.1|266066_266564_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004097645.1|266630_266996_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004097647.1|267321_271350_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
WP_032692785.1|271426_275650_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.3e-67
WP_004097650.1|276059_277400_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_004097651.1|277443_277761_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004097653.1|277764_278070_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014227493.1|278242_279775_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	3.8e-09
>prophage 18
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	288320	297093	6174401		Klosneuvirus(25.0%)	9	NA	NA
WP_025107530.1|288320_288992_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	9.5e-21
WP_004097673.1|289034_289625_+	YjaG family protein	NA	NA	NA	NA	NA
WP_004097675.1|289811_290084_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_004097677.1|290096_290789_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_032692777.1|290792_291227_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_014227505.1|291479_292868_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_032692776.1|292864_294199_+	sigma-54-dependent response regulator transcription factor ZraR	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	2.4e-07
WP_014227507.1|294195_295488_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_032692775.1|295503_297093_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
>prophage 19
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	310886	314570	6174401		Dickeya_phage(100.0%)	1	NA	NA
WP_025107717.1|310886_314570_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 20
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	344591	345701	6174401		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004097762.1|344591_345701_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 21
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	352901	353510	6174401		Lactococcus_phage(100.0%)	1	NA	NA
WP_004097774.1|352901_353510_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 22
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	359350	361991	6174401		Escherichia_phage(50.0%)	2	NA	NA
WP_004097788.1|359350_360766_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	2.8e-200
WP_014227545.1|360911_361991_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	2.6e-28
>prophage 23
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	366093	371411	6174401		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004097797.1|366093_368919_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004097799.1|369165_369693_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
WP_070082756.1|369779_371411_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.5e-06
>prophage 24
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	383223	384573	6174401		Moraxella_phage(100.0%)	1	NA	NA
WP_014227555.1|383223_384573_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
>prophage 25
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	396842	407949	6174401		Staphylococcus_phage(33.33%)	8	NA	NA
WP_032695086.1|396842_398801_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	3.5e-92
WP_004109428.1|399212_400526_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_014837150.1|400562_401246_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598876.1|401452_403600_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	4.1e-33
WP_032695088.1|403856_404768_-	allose kinase	NA	NA	NA	NA	NA
WP_032695089.1|404751_405447_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014837152.1|405457_406438_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_014837153.1|406416_407949_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	26.5	1.4e-11
>prophage 26
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	413616	415259	6174401		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_004097859.1|413616_414303_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	1.1e-08
WP_014227581.1|414500_415259_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.8	2.2e-13
>prophage 27
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	420584	427519	6174401		Burkholderia_virus(25.0%)	8	NA	NA
WP_025107668.1|420584_422087_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	7.0e-56
WP_004097873.1|422233_422539_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_014227587.1|422538_423459_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
WP_032695093.1|423609_424290_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.7	9.3e-32
WP_014837164.1|424513_425296_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_014227589.1|425329_425926_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014837165.1|426041_426629_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032695096.1|427084_427519_+	hypothetical protein	NA	E5AGC9	Erwinia_phage	38.3	5.7e-19
>prophage 28
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	432059	433424	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_044158999.1|432059_433424_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	52.4	2.0e-118
>prophage 29
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	439327	443040	6174401		Streptococcus_phage(50.0%)	3	NA	NA
WP_044159002.1|439327_441340_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.6	2.7e-39
WP_007372582.1|441972_442464_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_007372583.1|442539_443040_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.4	1.5e-47
>prophage 30
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	455787	456948	6174401	integrase	Pseudomonas_phage(100.0%)	1	452775:452788	460116:460129
452775:452788	attL	GCTGATTCAGGCCA	NA	NA	NA	NA
WP_013095165.1|455787_456948_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	43.1	4.7e-44
WP_013095165.1|455787_456948_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	43.1	4.7e-44
460116:460129	attR	GCTGATTCAGGCCA	NA	NA	NA	NA
>prophage 31
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	483179	483935	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038423655.1|483179_483935_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
>prophage 32
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	490295	502556	6174401		uncultured_Caudovirales_phage(100.0%)	16	NA	NA
WP_013095191.1|490295_491018_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.8e-97
WP_162875776.1|491316_491829_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_007372635.1|491953_492463_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	37.8	6.5e-22
WP_007372636.1|492535_492964_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.8e-49
WP_013095195.1|493021_494311_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	3.3e-171
WP_013095196.1|494351_496118_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_044158970.1|496141_496507_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_013095198.1|496529_497009_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	1.8e-34
WP_013095199.1|497065_497419_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.2	5.9e-22
WP_013095200.1|497538_497721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052768258.1|497877_498387_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013095204.1|498591_499593_+	permease	NA	NA	NA	NA	NA
WP_013095205.1|499606_499837_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_013095206.1|499947_500151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372648.1|500232_501060_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	39.9	7.5e-52
WP_013095207.1|501077_502556_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.8	2.2e-195
>prophage 33
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	506656	518474	6174401		uncultured_Caudovirales_phage(40.0%)	11	NA	NA
WP_013095212.1|506656_507133_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	2.4e-18
WP_013095213.1|507435_507786_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013095214.1|507947_509606_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013095215.1|509666_510824_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	63.9	1.3e-121
WP_013095218.1|511271_512180_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_013095219.1|512176_512602_+	universal stress protein	NA	NA	NA	NA	NA
WP_013095220.1|512618_513908_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	54.0	1.5e-123
WP_044158961.1|513989_514379_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	58.0	5.5e-29
WP_013095222.1|514748_515168_+	universal stress protein	NA	NA	NA	NA	NA
WP_044158959.1|515430_516969_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_013095225.1|516965_518474_+	DNA mismatch repair protein MutS	NA	A0A076FGT9	Aureococcus_anophage	24.6	1.2e-07
>prophage 34
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	527385	531405	6174401		Caulobacter_phage(33.33%)	5	NA	NA
WP_013095236.1|527385_528369_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.9	6.2e-53
WP_013095237.1|528465_529416_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_013095238.1|529542_530229_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	37.6	1.5e-29
WP_054442362.1|530276_530690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047028315.1|530865_531405_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	6.2e-47
>prophage 35
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	541583	546438	6174401		Salmonella_phage(33.33%)	5	NA	NA
WP_077270201.1|541583_542936_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	52.3	8.1e-112
WP_070083021.1|542938_544702_+	ParB family protein	NA	NA	NA	NA	NA
WP_070082766.1|544701_545421_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	27.1	6.6e-12
WP_070082767.1|545554_546178_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_070082768.1|546174_546438_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	37.9	2.2e-05
>prophage 36
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	552254	556550	6174401		Streptococcus_phage(33.33%)	4	NA	NA
WP_070082775.1|552254_554288_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	6.0e-42
WP_187418270.1|554958_555423_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_070082776.1|555492_556035_+	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	66.1	1.1e-54
WP_070082777.1|556109_556550_+	DUF29 domain-containing protein	NA	A0A0K2QQ08	Ralstonia_phage	64.8	2.3e-47
>prophage 37
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	595958	596930	6174401		Tetraselmis_virus(100.0%)	1	NA	NA
WP_070082818.1|595958_596930_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	35.4	4.7e-37
>prophage 38
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	614238	619051	6174401		Caulobacter_phage(33.33%)	5	NA	NA
WP_070082833.1|614238_615249_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	1.5e-49
WP_070083025.1|615262_615535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082834.1|615652_616567_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_070082835.1|616686_617370_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	38.1	3.3e-29
WP_070082836.1|617605_619051_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	29.4	9.4e-42
>prophage 39
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	632302	637832	6174401		Cronobacter_phage(33.33%)	5	NA	NA
WP_003855929.1|632302_632596_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_014227597.1|632639_634286_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.0e-188
WP_004097909.1|634419_634773_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_070082839.1|634819_635686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032695141.1|635708_637832_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.0	1.2e-29
>prophage 40
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	648728	653946	6174401		Morganella_phage(33.33%)	6	NA	NA
WP_014227610.1|648728_649259_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-45
WP_004097938.1|649399_649759_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_004097939.1|649769_650165_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004109180.1|650175_650910_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_014227611.1|650902_652693_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.2e-16
WP_070082840.1|652968_653946_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.5e-27
>prophage 41
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	661197	661743	6174401		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004097954.1|661197_661743_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 42
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	666481	669713	6174401		Vibrio_phage(50.0%)	2	NA	NA
WP_014227620.1|666481_667813_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.3e-17
WP_032695149.1|667823_669713_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.2e-59
>prophage 43
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	675239	679601	6174401		Pithovirus(50.0%)	3	NA	NA
WP_004097979.1|675239_676538_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_004097980.1|676687_677113_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004097981.1|677150_679601_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
>prophage 44
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	719667	726219	6174401		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004098041.1|719667_720195_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
WP_032695162.1|720598_721555_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014837206.1|721664_723167_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
WP_014227645.1|723177_724203_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004098052.1|724189_725176_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_070082841.1|725220_726219_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.6e-69
>prophage 45
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	745215	748141	6174401		Cronobacter_phage(50.0%)	2	NA	NA
WP_014227659.1|745215_745680_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
WP_032695170.1|746002_748141_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	3.4e-266
>prophage 46
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	755969	763752	6174401		Enterobacteria_phage(25.0%)	6	NA	NA
WP_014227667.1|755969_756917_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	1.3e-12
WP_032695172.1|757295_760004_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	1.7e-47
WP_009652347.1|760071_760458_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_038423978.1|760612_762082_-	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	1.4e-21
WP_004098115.1|762342_762804_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_032695174.1|762816_763752_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.0e-52
>prophage 47
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	768896	777946	6174401	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_004098127.1|768896_771752_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
WP_032695176.1|771751_772195_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004098131.1|772317_773829_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_004098132.1|774222_775320_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_014227676.1|775319_776402_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_014227677.1|776443_777946_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
>prophage 48
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	793869	798740	6174401		Planktothrix_phage(50.0%)	5	NA	NA
WP_032694862.1|793869_794940_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-22
WP_032694863.1|794945_795770_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_032694864.1|795780_796668_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004128303.1|796657_797530_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004128305.1|797720_798740_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	2.6e-46
>prophage 49
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	803590	804430	6174401		uncultured_marine_virus(100.0%)	1	NA	NA
WP_064388776.1|803590_804430_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	33.2	1.5e-20
>prophage 50
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	820308	821673	6174401		Burkholderia_virus(100.0%)	1	NA	NA
WP_014227732.1|820308_821673_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
>prophage 51
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	834364	840079	6174401		Staphylococcus_phage(50.0%)	3	NA	NA
WP_032693048.1|834364_837094_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.7e-20
WP_032693056.1|837090_838158_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032693045.1|838681_840079_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
>prophage 52
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	848500	851887	6174401	holin	Serratia_phage(100.0%)	1	NA	NA
WP_032693038.1|848500_851887_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	7.4e-05
>prophage 53
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	857764	858349	6174401		Moraxella_phage(100.0%)	1	NA	NA
WP_004098242.1|857764_858349_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 54
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	866545	870519	6174401		Acinetobacter_phage(50.0%)	2	NA	NA
WP_032693022.1|866545_868015_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	27.6	1.1e-34
WP_070082847.1|868089_870519_-	DEAD/DEAH box helicase family protein	NA	A0A0K1LLU7	Rhodobacter_phage	23.9	6.7e-08
>prophage 55
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	882960	884798	6174401		Streptococcus_phage(50.0%)	2	NA	NA
WP_032693014.1|882960_884172_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
WP_014227775.1|884171_884798_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	3.2e-55
>prophage 56
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	921186	922209	6174401		Tupanvirus(100.0%)	1	NA	NA
WP_032692995.1|921186_922209_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	28.4	3.6e-11
>prophage 57
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	929422	932590	6174401	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014227808.1|929422_930484_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.3	2.1e-06
WP_014227809.1|930501_931512_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_032692991.1|931651_932590_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.9	8.5e-68
>prophage 58
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	935752	937032	6174401		Shigella_phage(50.0%)	2	NA	NA
WP_014227813.1|935752_936490_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
WP_032692989.1|936492_937032_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
>prophage 59
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	950340	953045	6174401		Streptococcus_phage(50.0%)	3	NA	NA
WP_004098388.1|950340_951930_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
WP_014227828.1|952147_952759_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003856556.1|952883_953045_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 60
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	957713	959036	6174401		Geobacillus_virus(100.0%)	1	NA	NA
WP_014227832.1|957713_959036_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	2.6e-78
>prophage 61
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	965335	970555	6174401		Enterococcus_phage(33.33%)	3	NA	NA
WP_004098414.1|965335_966568_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
WP_014227837.1|966676_968344_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
WP_014227838.1|968617_970555_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 62
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	974519	975944	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_014227844.1|974519_975944_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.7	2.1e-17
>prophage 63
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	987027	987981	6174401		Cyanophage(100.0%)	1	NA	NA
WP_004098458.1|987027_987981_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 64
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	992368	1000652	6174401	holin	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004128758.1|992368_994285_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_014837364.1|994372_995509_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
WP_014227855.1|995676_996624_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227856.1|996748_997096_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014227857.1|997173_997707_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	2.6e-53
WP_014227858.1|997723_998167_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042944266.1|998552_1000652_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	4.0e-33
>prophage 65
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1005289	1011977	6174401	tRNA	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_014227862.1|1005289_1006465_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.1	8.4e-89
WP_014227863.1|1006517_1007417_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_003018940.1|1007583_1007847_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004098483.1|1008177_1009116_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_014227864.1|1009160_1011977_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	6.7e-76
>prophage 66
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1038273	1039422	6174401		Halovirus(100.0%)	1	NA	NA
WP_032694438.1|1038273_1039422_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	3.1e-48
>prophage 67
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1046165	1047534	6174401		Bacillus_phage(50.0%)	2	NA	NA
WP_004098524.1|1046165_1046645_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
WP_014227890.1|1046685_1047534_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
>prophage 68
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1060075	1065527	6174401		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_025106476.1|1060075_1062982_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
WP_032694434.1|1063169_1065527_-	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	8.0e-06
>prophage 69
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1071742	1072444	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014227903.1|1071742_1072444_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	1.3e-20
>prophage 70
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1093212	1094937	6174401		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_025106489.1|1093212_1094937_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	1.0e-34
>prophage 71
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1121054	1122098	6174401		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_009654638.1|1121054_1122098_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.2e-101
>prophage 72
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1126427	1126979	6174401		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_014227932.1|1126427_1126979_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	32.8	1.9e-14
>prophage 73
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1138227	1139652	6174401		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032694416.1|1138227_1139652_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 74
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1149433	1150204	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_032694412.1|1149433_1150204_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	1.3e-29
>prophage 75
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1155082	1161663	6174401		Mamastrovirus(33.33%)	5	NA	NA
WP_032694408.1|1155082_1156684_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	47.5	3.3e-19
WP_014227949.1|1156784_1159175_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014227950.1|1159378_1159915_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
WP_004098666.1|1159966_1160629_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_014227952.1|1160736_1161663_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
>prophage 76
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1174268	1181034	6174401	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071881716.1|1174268_1175666_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	4.9e-27
WP_014837424.1|1175717_1176599_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_004098689.1|1176659_1177115_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_014227967.1|1177279_1177996_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_032694401.1|1177995_1178532_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_064388485.1|1178604_1181034_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	31.6	9.6e-39
>prophage 77
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1203068	1207724	6174401	transposase	Planktothrix_phage(50.0%)	4	NA	NA
WP_004098728.1|1203068_1203866_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
WP_014227987.1|1203865_1204756_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_064388482.1|1204752_1206735_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_014227989.1|1206794_1207724_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	40.7	2.4e-59
>prophage 78
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1210890	1211235	6174401		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004098733.1|1210890_1211235_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 79
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1215366	1221170	6174401	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004098740.1|1215366_1216806_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
WP_004098741.1|1216997_1218155_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_032694387.1|1218191_1221170_-	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	23.7	5.7e-41
>prophage 80
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1231694	1232453	6174401		Flavobacterium_phage(100.0%)	1	NA	NA
WP_004098751.1|1231694_1232453_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
>prophage 81
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1241287	1245405	6174401		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_014228005.1|1241287_1241884_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
WP_014837451.1|1241922_1245405_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.3	2.7e-204
>prophage 82
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1260176	1261208	6174401		Planktothrix_phage(100.0%)	1	NA	NA
WP_004098793.1|1260176_1261208_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	1.9e-36
>prophage 83
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1267890	1268694	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032693178.1|1267890_1268694_+	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	36.0	2.1e-38
>prophage 84
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1272738	1276949	6174401		Lactobacillus_phage(33.33%)	5	NA	NA
WP_004129156.1|1272738_1274106_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
WP_014837463.1|1274177_1274933_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_014228026.1|1274965_1275688_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004129160.1|1275684_1276152_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.8e-53
WP_014228028.1|1276217_1276949_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
>prophage 85
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1281050	1281632	6174401		Caulobacter_phage(100.0%)	1	NA	NA
WP_004099149.1|1281050_1281632_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 86
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1316646	1318122	6174401		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014228053.1|1316646_1318122_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.7e-46
>prophage 87
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1323393	1323867	6174401		Burkholderia_phage(100.0%)	1	NA	NA
WP_032693194.1|1323393_1323867_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	34.4	2.8e-19
>prophage 88
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1340539	1345410	6174401		Catovirus(50.0%)	5	NA	NA
WP_014228064.1|1340539_1342072_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.0	1.8e-67
WP_023329014.1|1342082_1342958_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228066.1|1342988_1343669_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004848024.1|1343671_1344316_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_032693202.1|1344312_1345410_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.0e-08
>prophage 89
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1361027	1364738	6174401		Streptococcus_phage(66.67%)	3	NA	NA
WP_032693212.1|1361027_1362281_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	2.2e-95
WP_004848066.1|1362291_1363395_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
WP_004129421.1|1363685_1364738_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
>prophage 90
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1369489	1370233	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_032693216.1|1369489_1370233_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	3.5e-32
>prophage 91
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1377417	1378260	6174401		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032693217.1|1377417_1378260_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.6e-12
>prophage 92
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1387505	1391630	6174401		Brazilian_cedratvirus(66.67%)	5	NA	NA
WP_032693224.1|1387505_1388324_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
WP_032693222.1|1388337_1389147_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004129481.1|1389869_1390052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004848112.1|1390159_1390855_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
WP_014228113.1|1390847_1391630_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
>prophage 93
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1403112	1404159	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014228120.1|1403112_1404159_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 94
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1412215	1412983	6174401		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848135.1|1412215_1412983_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 95
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1437431	1446651	6174401		Bacillus_phage(60.0%)	7	NA	NA
WP_004099396.1|1437431_1438343_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
WP_014228144.1|1438433_1439339_+	fructokinase	NA	NA	NA	NA	NA
WP_014228145.1|1439387_1439750_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032694136.1|1440038_1443173_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.9e-11
WP_014228147.1|1443169_1444372_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
WP_004099401.1|1444650_1445340_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_004848171.1|1445361_1446651_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
>prophage 96
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1463482	1467822	6174401	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_004129667.1|1463482_1464610_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
WP_004099423.1|1464632_1464965_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071846141.1|1464992_1466840_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004848195.1|1466850_1467822_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
>prophage 97
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1472832	1474500	6174401		Indivirus(50.0%)	2	NA	NA
WP_032694145.1|1472832_1473936_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	4.2e-50
WP_004129690.1|1474029_1474500_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 98
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1491497	1493201	6174401		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032694149.1|1491497_1493201_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	3.7e-21
>prophage 99
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1508358	1513408	6174401	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|1508358_1508982_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_004099538.1|1509114_1510389_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
WP_004099539.1|1510572_1512927_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
WP_002444653.1|1513135_1513408_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 100
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1516785	1517481	6174401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014228183.1|1516785_1517481_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 101
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1521908	1525452	6174401		Bacillus_phage(100.0%)	2	NA	NA
WP_032694151.1|1521908_1523681_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	5.7e-49
WP_032694152.1|1523673_1525452_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	6.4e-40
>prophage 102
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1536860	1537970	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_004848307.1|1536860_1537970_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.2e-13
>prophage 103
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1547122	1556510	6174401		Enterobacteria_phage(33.33%)	10	NA	NA
WP_014837605.1|1547122_1548196_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	40.8	4.5e-65
WP_004848323.1|1548308_1548572_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003859006.1|1548571_1548712_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_014228203.1|1548708_1549407_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032694158.1|1549508_1550963_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	2.4e-16
WP_014228205.1|1550937_1551408_-	YlaC family protein	NA	NA	NA	NA	NA
WP_032694159.1|1551534_1552101_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004099646.1|1552263_1552482_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004129911.1|1552508_1552883_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_070082856.1|1553363_1556510_-	multidrug efflux RND transporter permease subunit AcrB	NA	S5VTK5	Leptospira_phage	22.8	4.6e-49
>prophage 104
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1562026	1569873	6174401	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_032694160.1|1562026_1562962_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.3e-64
WP_064506547.1|1563028_1563202_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_032694161.1|1563216_1563744_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_004848353.1|1563813_1564191_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_004099669.1|1564341_1564893_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
WP_032694162.1|1564984_1566892_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.3e-43
WP_004099673.1|1566949_1567282_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004129946.1|1567281_1567887_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_009653565.1|1567998_1569873_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
>prophage 105
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1584291	1588118	6174401		Pteropox_virus(50.0%)	2	NA	NA
WP_014228221.1|1584291_1585542_+	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	9.1e-25
WP_032694165.1|1585616_1588118_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.0e-115
>prophage 106
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1593013	1593694	6174401		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004848402.1|1593013_1593694_+	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	31.3	2.7e-15
>prophage 107
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1596880	1597567	6174401		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228231.1|1596880_1597567_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 108
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1606410	1609171	6174401	tRNA	Moumouvirus(50.0%)	3	NA	NA
WP_004848430.1|1606410_1607796_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
WP_025107125.1|1608090_1608303_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|1608304_1609171_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
>prophage 109
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1612353	1612602	6174401		Salmonella_phage(100.0%)	1	NA	NA
WP_032694558.1|1612353_1612602_-	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	71.8	4.7e-26
>prophage 110
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1618568	1619570	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_032694552.1|1618568_1619570_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.1e-28
>prophage 111
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1631122	1631998	6174401		Burkholderia_virus(100.0%)	1	NA	NA
WP_032694546.1|1631122_1631998_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.5	3.0e-19
>prophage 112
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1638776	1643851	6174401	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
WP_014228245.1|1638776_1640252_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.5	2.9e-46
WP_004848495.1|1640624_1642142_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	2.5e-85
WP_014228246.1|1642294_1642708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228247.1|1642975_1643851_-	class A extended-spectrum beta-lactamase OXY-1-1	NA	A0A1B0VBP7	Salmonella_phage	74.6	3.1e-112
>prophage 113
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1648617	1650102	6174401		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_032694598.1|1648617_1650102_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	21.2	5.7e-10
>prophage 114
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1658421	1659822	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_032694591.1|1658421_1659822_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.1	1.7e-16
>prophage 115
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1664216	1665008	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014837719.1|1664216_1665008_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.7e-14
>prophage 116
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1680561	1681311	6174401		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_014228273.1|1680561_1681311_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	1.3e-18
>prophage 117
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1716366	1719090	6174401		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_032694567.1|1716366_1719090_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.2	9.4e-67
>prophage 118
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1729736	1731780	6174401		Bacillus_virus(50.0%)	2	NA	NA
WP_004848592.1|1729736_1730780_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
WP_032695061.1|1730769_1731780_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	1.6e-11
>prophage 119
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1737111	1745430	6174401		Streptococcus_phage(33.33%)	8	NA	NA
WP_014228326.1|1737111_1738578_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	1.8e-16
WP_004848610.1|1738812_1739664_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004100025.1|1739712_1740354_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032695098.1|1740368_1741034_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014228328.1|1741026_1741788_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.6e-19
WP_014228329.1|1742332_1743097_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032693521.1|1743279_1744617_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_032693522.1|1744725_1745430_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.0e-22
>prophage 120
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1750817	1756735	6174401	holin	Catovirus(50.0%)	4	NA	NA
WP_014837759.1|1750817_1752482_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_032693525.1|1752496_1753969_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032693526.1|1753979_1754573_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_025107047.1|1754701_1756735_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	5.8e-21
>prophage 121
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1760200	1761745	6174401		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014228343.1|1760200_1761745_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	3.1e-14
>prophage 122
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1773293	1778068	6174401		Tupanvirus(50.0%)	2	NA	NA
WP_032693530.1|1773293_1777175_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	26.9	3.1e-55
WP_014837773.1|1777273_1778068_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	9.9e-09
>prophage 123
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1793113	1796730	6174401		Burkholderia_phage(50.0%)	4	NA	NA
WP_004100084.1|1793113_1793518_-	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	6.1e-07
WP_071889425.1|1793498_1793792_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032694347.1|1793978_1795067_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014228366.1|1795227_1796730_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.3e-14
>prophage 124
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1814297	1832959	6174401		Cedratvirus(14.29%)	16	NA	NA
WP_004848726.1|1814297_1815326_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.1	1.7e-29
WP_032694339.1|1815364_1816309_-	sugar kinase	NA	NA	NA	NA	NA
WP_004848729.1|1816320_1817322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032694338.1|1817321_1818308_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047725149.1|1818304_1819810_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
WP_032694337.1|1819854_1820835_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_064388438.1|1821373_1823683_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.1	3.9e-82
WP_014228384.1|1823866_1824409_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_032694334.1|1824405_1825095_-	acireductone synthase	NA	NA	NA	NA	NA
WP_177341173.1|1825289_1826435_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014228387.1|1826435_1827065_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	2.0e-52
WP_014228388.1|1827049_1828273_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	2.6e-61
WP_014228389.1|1828377_1829289_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002894394.1|1830155_1830719_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_004848755.1|1830888_1832454_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_004100140.1|1832530_1832959_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 125
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1837046	1838584	6174401		Morganella_phage(33.33%)	3	NA	NA
WP_004100146.1|1837046_1837256_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
WP_004848768.1|1837320_1837704_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	5.2e-24
WP_014837805.1|1837795_1838584_+	deaminated glutathione amidase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.2	2.8e-08
>prophage 126
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1842501	1844945	6174401		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004848782.1|1842501_1843701_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
WP_032694331.1|1843844_1844945_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 127
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1851961	1860060	6174401	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_014228403.1|1851961_1854544_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.2e-188
WP_014228404.1|1854770_1855253_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_032694326.1|1855452_1857240_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.2	6.2e-27
WP_032694324.1|1857295_1858963_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004100186.1|1859334_1860060_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
>prophage 128
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1865908	1866955	6174401		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004134159.1|1865908_1866955_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 129
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1871628	1873290	6174401		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_014228410.1|1871628_1873290_-	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 130
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1877917	1887869	6174401	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_014228414.1|1877917_1879870_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
WP_004848839.1|1880048_1881716_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
WP_004130464.1|1882154_1883558_+	chitoporin	NA	NA	NA	NA	NA
WP_004848843.1|1883604_1883937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694321.1|1883989_1885285_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.4e-60
WP_014837817.1|1885339_1886479_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_032694320.1|1886465_1887869_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	2.3e-08
>prophage 131
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1890873	1891647	6174401		Mycobacterium_phage(100.0%)	1	NA	NA
WP_032694316.1|1890873_1891647_-	esterase	NA	W0LK50	Mycobacterium_phage	37.0	2.6e-06
>prophage 132
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1898091	1899576	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032694353.1|1898091_1899576_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 133
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1907843	1915335	6174401		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_014837833.1|1907843_1909892_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	5.5e-27
WP_032694310.1|1909913_1911593_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_009651669.1|1911592_1911682_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004848892.1|1911991_1912198_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_032694308.1|1912442_1913891_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	32.8	4.0e-56
WP_032694307.1|1913853_1915335_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.9e-46
>prophage 134
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1921132	1921924	6174401		Kaumoebavirus(100.0%)	1	NA	NA
WP_014837838.1|1921132_1921924_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	7.5e-09
>prophage 135
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1948665	1949646	6174401	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_070082752.1|1948665_1949646_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
>prophage 136
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1962261	1965778	6174401		Vibriophage(33.33%)	4	NA	NA
WP_014228459.1|1962261_1962981_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	33.0	2.9e-23
WP_014228460.1|1962977_1963922_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.8	5.2e-25
WP_014228461.1|1964039_1964411_-	YbgS-like family protein	NA	NA	NA	NA	NA
WP_014228462.1|1964725_1965778_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
>prophage 137
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1970098	1976624	6174401		Tupanvirus(33.33%)	7	NA	NA
WP_032694537.1|1970098_1971115_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	4.4e-78
WP_014228466.1|1971326_1972796_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	29.6	4.3e-10
WP_004848991.1|1972863_1973652_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004848993.1|1973805_1973955_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_014228467.1|1974100_1974874_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004848997.1|1974873_1975563_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014228468.1|1975565_1976624_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-18
>prophage 138
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1983797	1984529	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228475.1|1983797_1984529_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 139
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1991294	1996248	6174401		Catovirus(50.0%)	4	NA	NA
WP_025108118.1|1991294_1992818_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.4e-80
WP_004849033.1|1992930_1994313_+	amino acid permease	NA	NA	NA	NA	NA
WP_032694532.1|1994412_1994889_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_032694541.1|1994958_1996248_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.0e-18
>prophage 140
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	1999923	2000646	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014228488.1|1999923_2000646_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	8.1e-10
>prophage 141
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2007211	2008117	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228492.1|2007211_2008117_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.7	3.1e-27
>prophage 142
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2017900	2034518	6174401	transposase	Anomala_cuprea_entomopoxvirus(14.29%)	15	NA	NA
WP_032694524.1|2017900_2019640_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
WP_032694523.1|2019636_2020629_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_032694540.1|2020625_2021303_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_014837871.1|2021374_2022298_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070082752.1|2022504_2023485_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
WP_014228505.1|2023837_2025169_+	MFS transporter	NA	NA	NA	NA	NA
WP_014228506.1|2025218_2025968_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_014228507.1|2025981_2026827_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
WP_032694522.1|2026826_2027819_+	transketolase family protein	NA	NA	NA	NA	NA
WP_032694521.1|2028119_2029469_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
WP_014228509.1|2029669_2031814_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.0e-43
WP_014837874.1|2031856_2032825_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004130722.1|2032960_2033221_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004130731.1|2033505_2033772_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
WP_004849092.1|2033840_2034518_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	31.0	3.4e-18
>prophage 143
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2041089	2046193	6174401		Planktothrix_phage(33.33%)	6	NA	NA
WP_004849106.1|2041089_2041812_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
WP_004100490.1|2041808_2042468_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004849110.1|2042601_2043348_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_070082860.1|2043719_2044223_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	26.0	8.4e-06
WP_004100495.1|2044441_2045329_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004130755.1|2045680_2046193_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
>prophage 144
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2050102	2120821	6174401	holin,terminase,head,transposase,portal,capsid,plate,tail	Salmonella_phage(18.75%)	79	NA	NA
WP_025108092.1|2050102_2051143_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
WP_025108091.1|2051294_2052671_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.0	5.0e-24
WP_025108090.1|2052741_2053458_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004130773.1|2053500_2054415_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032694516.1|2054605_2055388_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_004849135.1|2055565_2057158_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	8.5e-60
WP_032694515.1|2057898_2058885_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032694902.1|2059128_2061492_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_032694901.1|2061506_2062808_-	MFS transporter	NA	NA	NA	NA	NA
WP_177341179.1|2063079_2064180_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014228525.1|2064176_2065442_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_032694900.1|2065579_2066395_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032694899.1|2066604_2069037_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
WP_032694898.1|2069041_2069941_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_032694897.1|2070093_2070849_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_032694896.1|2070848_2072084_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_032694895.1|2072261_2073203_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_014228532.1|2073215_2075069_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G3M9Y6	Bacillus_virus	28.8	2.7e-09
WP_004849160.1|2075106_2076645_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_009653824.1|2076697_2077618_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_009653837.1|2077619_2078531_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_009653812.1|2078657_2079983_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_161506334.1|2080279_2080759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694906.1|2080792_2082034_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_004849210.1|2082413_2082797_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_014228535.1|2082900_2084016_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_014837893.1|2084018_2084645_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_070082861.1|2084743_2086030_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.1	3.7e-122
WP_070082862.1|2086029_2086245_-	excisionase family protein	NA	NA	NA	NA	NA
WP_049111946.1|2086332_2086677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082863.1|2086673_2087030_-	hypothetical protein	NA	Q5G8U7	Enterobacteria_phage	79.5	3.2e-52
WP_049111948.1|2087026_2087332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148676387.1|2087346_2087580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082864.1|2087645_2087939_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_032721334.1|2088498_2088900_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	39.3	1.9e-13
WP_032721337.1|2089007_2089259_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	55.3	2.1e-18
WP_070082865.1|2089258_2089672_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	71.4	2.6e-45
WP_070082867.1|2089937_2091014_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.6	1.6e-30
WP_049130028.1|2091026_2091320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077270206.1|2091316_2091529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082868.1|2091521_2092307_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	2.2e-61
WP_070082869.1|2092303_2092720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187418272.1|2092716_2093259_+	hypothetical protein	NA	J9Q748	Salmonella_phage	77.5	1.5e-77
WP_070082870.1|2093853_2094249_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	77.9	2.1e-52
WP_155774241.1|2094987_2095155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064362838.1|2095300_2095606_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	57.6	2.7e-23
WP_077270207.1|2095602_2096247_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	79.5	8.0e-102
WP_009653799.1|2096243_2096384_+	YlcG family protein	NA	NA	NA	NA	NA
WP_057173860.1|2096380_2096980_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.4	7.1e-68
WP_024358952.1|2097679_2097895_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	1.4e-29
WP_070082872.1|2097894_2098392_+	lysozyme	NA	A0A0M3ULD1	Salmonella_phage	83.0	8.2e-78
WP_070082873.1|2098480_2098870_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	42.1	1.8e-19
WP_070082874.1|2099105_2099426_+	negative regulator GrlR	NA	NA	NA	NA	NA
WP_070082875.1|2099564_2099828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082876.1|2099902_2100541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082877.1|2100572_2101082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082878.1|2101396_2101960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082879.1|2101901_2104028_+|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	34.9	1.4e-97
WP_077270223.1|2104067_2104289_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_070083027.1|2104345_2105941_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.7	1.5e-88
WP_070082881.1|2105937_2106807_+	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.0	1.0e-51
WP_070082882.1|2106808_2107387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723969.1|2107386_2107791_+|head	head decoration protein	head	NA	NA	NA	NA
WP_070082883.1|2107888_2108938_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	9.5e-52
WP_070082884.1|2108939_2109308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082885.1|2109313_2109673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082886.1|2109669_2110215_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_070082887.1|2110218_2110404_+	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	42.6	1.8e-06
WP_070082888.1|2110400_2111912_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.6	3.7e-105
WP_048294781.1|2111915_2112284_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_070082889.1|2112285_2112564_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_070082890.1|2112705_2114580_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	41.9	2.7e-17
WP_070082891.1|2114624_2116025_+	DNA circularization protein	NA	NA	NA	NA	NA
WP_070082892.1|2116021_2117101_+|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.5	6.8e-37
WP_077270224.1|2117136_2117685_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	33.1	4.9e-07
WP_048294792.1|2117677_2118127_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	40.7	3.8e-18
WP_070082894.1|2118116_2119265_+|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	27.8	8.3e-17
WP_070082895.1|2119261_2119945_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_148722755.1|2119960_2120821_+|tail	phage tail protein	tail	A0A1I9SEW2	Klebsiella_phage	54.6	6.0e-52
>prophage 145
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2125191	2129765	6174401		Shigella_phage(25.0%)	4	NA	NA
WP_070082898.1|2125191_2126256_-	acyltransferase	NA	Q716G0	Shigella_phage	35.1	9.1e-42
WP_070083028.1|2126486_2126804_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	3.2e-19
WP_029946969.1|2127775_2128978_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	4.7e-95
WP_004849345.1|2129006_2129765_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
>prophage 146
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2137329	2148855	6174401		Bacillus_phage(33.33%)	13	NA	NA
WP_004100567.1|2137329_2137593_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_009653259.1|2137797_2138088_+	YbjC family protein	NA	NA	NA	NA	NA
WP_025108025.1|2138071_2138794_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_009653278.1|2138897_2139800_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
WP_004849367.1|2139889_2140369_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_014228600.1|2140717_2141830_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004134592.1|2141932_2143066_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
WP_014228601.1|2143076_2144030_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004130847.1|2144026_2144872_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_004100588.1|2144929_2145418_+	YbjO family protein	NA	NA	NA	NA	NA
WP_032694258.1|2145460_2146591_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	1.7e-25
WP_004849381.1|2146669_2147386_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	1.1e-35
WP_014228604.1|2147382_2148855_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	4.3e-26
>prophage 147
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2152484	2155224	6174401		Planktothrix_phage(50.0%)	4	NA	NA
WP_004111834.1|2152484_2153213_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_004849391.1|2153440_2153956_-	lipoprotein	NA	NA	NA	NA	NA
WP_004100606.1|2154073_2154397_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014228608.1|2154393_2155224_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	8.2e-06
>prophage 148
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2169100	2192266	6174401	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_025108294.1|2169100_2171047_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
WP_004100627.1|2171114_2171345_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_004100628.1|2171669_2171987_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_032694254.1|2172017_2174300_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	3.7e-165
WP_002211347.1|2174437_2174656_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032694253.1|2174935_2175640_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_070082899.1|2175678_2177400_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.4	1.1e-15
WP_032694251.1|2177400_2179167_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	9.2e-23
WP_004849433.1|2179281_2180250_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
WP_002439523.1|2180781_2181276_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_032694250.1|2181411_2185530_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	5.0e-88
WP_004130911.1|2185651_2186263_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004849446.1|2186271_2187615_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.7	7.8e-83
WP_009653254.1|2187706_2188999_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
WP_032694249.1|2189199_2191638_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	6.8e-218
WP_032694248.1|2191648_2192266_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	2.2e-72
>prophage 149
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2199397	2202624	6174401		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004871674.1|2199397_2200138_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
WP_014228637.1|2200341_2202624_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 150
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2206672	2207761	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_032694246.1|2206672_2207761_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.3e-80
>prophage 151
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2212054	2216607	6174401		Bacillus_phage(100.0%)	3	NA	NA
WP_004100704.1|2212054_2212342_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
WP_032694244.1|2212557_2214813_+	ComEC family protein	NA	NA	NA	NA	NA
WP_004849478.1|2214858_2216607_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
>prophage 152
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2232641	2242911	6174401	transposase,tRNA	Clostridium_botulinum_C_phage(16.67%)	7	NA	NA
WP_014228411.1|2232641_2233076_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_009653304.1|2233167_2234358_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_014228653.1|2234545_2235631_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.0	1.5e-100
WP_004849497.1|2236222_2237623_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
WP_025107499.1|2237926_2239129_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
WP_014228655.1|2239456_2242072_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_032695054.1|2242137_2242911_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
>prophage 153
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2249623	2251531	6174401		Tupanvirus(100.0%)	1	NA	NA
WP_004849507.1|2249623_2251531_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
>prophage 154
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2264306	2266361	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_032695058.1|2264306_2266361_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
>prophage 155
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2270630	2271831	6174401	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_096913407.1|2270630_2271831_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	82.2	4.3e-141
>prophage 156
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2277304	2279452	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_004849540.1|2277304_2279452_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
>prophage 157
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2290026	2290686	6174401	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004100829.1|2290026_2290686_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 158
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2309125	2309866	6174401		Planktothrix_phage(100.0%)	1	NA	NA
WP_032693372.1|2309125_2309866_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.4e-28
>prophage 159
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2333932	2334712	6174401		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032693408.1|2333932_2334712_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	3.3e-17
>prophage 160
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2338979	2345600	6174401		Morganella_phage(50.0%)	5	NA	NA
WP_004849644.1|2338979_2339192_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	8.4e-24
WP_004849645.1|2339853_2340075_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
WP_032693386.1|2340712_2343832_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.6	1.0e-45
WP_014838032.1|2344150_2344537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131145.1|2344895_2345600_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	5.3e-30
>prophage 161
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2359619	2360648	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_032693394.1|2359619_2360648_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 162
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2366178	2367561	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228757.1|2366178_2367561_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	5.7e-20
>prophage 163
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2381051	2381792	6174401		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228772.1|2381051_2381792_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	6.7e-36
>prophage 164
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2389240	2390143	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_014228780.1|2389240_2390143_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.7e-15
>prophage 165
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2393904	2400482	6174401		Serratia_phage(50.0%)	4	NA	NA
WP_070082903.1|2393904_2396202_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
WP_032693406.1|2396253_2396574_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004131253.1|2396594_2397671_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014228785.1|2397980_2400482_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	6.1e-12
>prophage 166
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2414464	2416712	6174401		Enterobacteria_phage(100.0%)	3	NA	NA
WP_004131287.1|2414464_2414638_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
WP_070082904.1|2414873_2416196_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	86.9	1.5e-198
WP_014228795.1|2416217_2416712_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
>prophage 167
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2433612	2436467	6174401		Cronobacter_phage(50.0%)	4	NA	NA
WP_032692833.1|2433612_2434401_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	5.4e-92
WP_032692832.1|2434451_2434745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032692830.1|2434860_2435649_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_014228810.1|2435771_2436467_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.8	1.2e-26
>prophage 168
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2445818	2449992	6174401		Acanthocystis_turfacea_Chlorella_virus(50.0%)	6	NA	NA
WP_032692826.1|2445818_2446757_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	28.4	4.6e-05
WP_014838074.1|2446842_2447580_+	phosphatase	NA	NA	NA	NA	NA
WP_014228819.1|2447602_2448157_+	molecular chaperone	NA	NA	NA	NA	NA
WP_032692825.1|2448248_2448752_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_014228821.1|2449042_2449348_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014228822.1|2449437_2449992_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 169
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2458361	2459282	6174401		Morganella_phage(100.0%)	1	NA	NA
WP_004849864.1|2458361_2459282_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 170
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2462512	2462758	6174401		Salmonella_phage(100.0%)	1	NA	NA
WP_004101040.1|2462512_2462758_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 171
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2484006	2489760	6174401	transposase	Trichoplusia_ni_ascovirus(25.0%)	7	NA	NA
WP_004131399.1|2484006_2484741_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
WP_000103754.1|2484951_2485188_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_071886325.1|2485277_2486519_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014228411.1|2486713_2487148_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_032693889.1|2487294_2488104_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_032693890.1|2488106_2489129_+	cell division protein YceG	NA	NA	NA	NA	NA
WP_004849914.1|2489118_2489760_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	5.9e-28
>prophage 172
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2505531	2505789	6174401		Erwinia_phage(100.0%)	1	NA	NA
WP_004131427.1|2505531_2505789_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 173
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2512081	2515832	6174401		Planktothrix_phage(50.0%)	4	NA	NA
WP_014228855.1|2512081_2512783_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
WP_014228856.1|2512782_2514027_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_032693895.1|2514075_2514987_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_032693896.1|2515001_2515832_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
>prophage 174
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2522936	2523887	6174401		Cyanophage(100.0%)	1	NA	NA
WP_014228865.1|2522936_2523887_+	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.6e-13
>prophage 175
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2529167	2530304	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014228869.1|2529167_2530304_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 176
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2537087	2589971	6174401	holin,integrase,terminase,tRNA,head,protease,transposase,portal,tail	Escherichia_phage(16.33%)	63	2541164:2541180	2584671:2584687
WP_014228873.1|2537087_2538458_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_004131471.1|2538461_2539103_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004849976.1|2539162_2540269_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_032693069.1|2540307_2540784_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032693070.1|2540793_2541456_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
2541164:2541180	attL	AGCGCCGCCTGCAGCGC	NA	NA	NA	NA
WP_070082909.1|2541692_2542943_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_064411135.1|2543056_2544199_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.2	1.1e-170
WP_074192178.1|2544188_2544425_-	excisionase	NA	NA	NA	NA	NA
WP_064411134.1|2544737_2544971_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	56.8	1.1e-13
WP_064411132.1|2545670_2546003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213841.1|2546248_2547457_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	2.4e-46
WP_064411130.1|2548013_2548421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082910.1|2548417_2549203_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	2.6e-62
WP_064411128.1|2549195_2549396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064411127.1|2549395_2549923_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	5.4e-64
WP_064411126.1|2550055_2550883_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	84.4	6.2e-131
WP_004123001.1|2550939_2551311_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	93.5	2.8e-59
WP_064411191.1|2552168_2552615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049091349.1|2552848_2553082_-	hypothetical protein	NA	Q56BD7	Escherichia_virus	37.0	6.6e-06
WP_064147558.1|2553328_2553961_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	1.0e-32
WP_064411125.1|2554058_2554289_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	3.6e-12
WP_148722757.1|2554338_2554770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082911.1|2554812_2555361_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	54.3	2.6e-45
WP_064349867.1|2555533_2555713_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.5	5.6e-13
WP_070082912.1|2555702_2556635_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	76.9	4.8e-47
WP_070082913.1|2557245_2558199_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.3	2.2e-127
WP_070082914.1|2558191_2560162_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.9	1.8e-197
WP_187418273.1|2560158_2560515_+|protease	SOS-response repressor and protease LexA	protease	A0A291AWY9	Escherichia_phage	63.9	1.5e-17
WP_070082915.1|2561968_2563024_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.7	1.9e-108
WP_049071743.1|2563042_2563873_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	48.0	1.6e-57
WP_016809733.1|2564082_2564274_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	85.7	1.7e-23
WP_070082916.1|2564423_2565503_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.6	1.0e-170
WP_064411117.1|2565779_2566280_+	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	41.6	1.1e-21
WP_015370231.1|2566411_2566837_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	1.1e-59
WP_048258054.1|2566833_2566989_+	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	4.2e-09
WP_014228559.1|2567468_2567879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004139418.1|2568121_2568511_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	80.3	2.4e-48
WP_025108061.1|2568777_2569404_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.3	1.5e-89
WP_064404667.1|2569411_2569687_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.8	3.7e-24
WP_014837907.1|2569922_2570207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108059.1|2570345_2570639_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	6.8e-32
WP_014228564.1|2570763_2570949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064392801.1|2571098_2571299_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	5.9e-19
WP_049106544.1|2571363_2571609_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.5	4.7e-18
WP_032734579.1|2571663_2572005_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	2.7e-48
WP_014838137.1|2572122_2572587_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_077253184.1|2572540_2574277_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.1e-137
WP_064411112.1|2574283_2575603_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	2.2e-138
WP_064411111.1|2577557_2577812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734570.1|2577817_2578150_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_048258044.1|2578162_2578501_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_014838144.1|2578497_2578947_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	5.1e-63
WP_064411110.1|2578943_2579291_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	59.3	1.8e-31
WP_015370213.1|2579347_2580058_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	69.1	1.3e-84
WP_064411109.1|2580088_2580493_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.5	3.2e-32
WP_064411108.1|2580495_2580801_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.0	2.8e-28
WP_064411107.1|2580993_2581509_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	69.5	1.9e-61
WP_070082917.1|2581704_2582079_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	51.6	7.6e-28
WP_064411106.1|2582132_2585540_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	42.9	8.7e-187
2584671:2584687	attR	GCGCTGCAGGCGGCGCT	NA	NA	NA	NA
WP_064411105.1|2585563_2586028_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.3	1.7e-53
WP_064411104.1|2586024_2586501_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.1	2.3e-53
WP_064411103.1|2586516_2586897_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	3.2e-58
WP_070082918.1|2586893_2589971_+	kinase	NA	A0A286S259	Klebsiella_phage	61.1	0.0e+00
>prophage 177
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2594174	2597057	6174401		Klebsiella_phage(50.0%)	5	NA	NA
WP_064411100.1|2594174_2594678_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	71.9	1.6e-52
WP_064411099.1|2594807_2595050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064411098.1|2595049_2595292_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.9	1.2e-29
WP_064411097.1|2595370_2595790_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	2.1e-34
WP_064411096.1|2595791_2597057_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
>prophage 178
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2600193	2607618	6174401		Phage_21(25.0%)	6	NA	NA
WP_074188128.1|2600193_2600346_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	1.9e-17
WP_032693073.1|2600490_2602275_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	5.6e-20
WP_014228927.1|2602352_2603543_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014228929.1|2604901_2605669_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.2	2.6e-14
WP_014228930.1|2605669_2606623_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_014228931.1|2606619_2607618_-	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
>prophage 179
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2614067	2614982	6174401		Morganella_phage(100.0%)	1	NA	NA
WP_009653416.1|2614067_2614982_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
>prophage 180
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2623132	2627480	6174401		Bacillus_phage(100.0%)	3	NA	NA
WP_014228946.1|2623132_2624629_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	4.1e-08
WP_014228948.1|2624990_2626148_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032692757.1|2626196_2627480_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
>prophage 181
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2630812	2631667	6174401		Indivirus(100.0%)	1	NA	NA
WP_014228950.1|2630812_2631667_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	3.2e-13
>prophage 182
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2635295	2637557	6174401		Tupanvirus(100.0%)	3	NA	NA
WP_032692756.1|2635295_2636549_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.3	9.1e-25
WP_177341174.1|2636679_2636919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032692755.1|2636915_2637557_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	39.1	2.6e-20
>prophage 183
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2643492	2645448	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228966.1|2643492_2645448_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.9	4.4e-42
>prophage 184
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2649678	2650311	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_032692752.1|2649678_2650311_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.9	3.4e-12
>prophage 185
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2656321	2657542	6174401		Klosneuvirus(100.0%)	1	NA	NA
WP_032692746.1|2656321_2657542_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.2e-26
>prophage 186
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2666959	2667787	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_004850083.1|2666959_2667787_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 187
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2674002	2679742	6174401		Tupanvirus(50.0%)	5	NA	NA
WP_014228985.1|2674002_2676261_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	2.1e-144
WP_165795096.1|2676379_2676697_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_014228987.1|2676772_2678164_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_032692741.1|2678298_2678889_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014228989.1|2678980_2679742_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	1.8e-15
>prophage 188
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2684117	2685434	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_032692738.1|2684117_2685434_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.6	1.6e-40
>prophage 189
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2693947	2696905	6174401		Acinetobacter_phage(100.0%)	2	NA	NA
WP_025106981.1|2693947_2695306_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
WP_004850135.1|2695309_2696905_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
>prophage 190
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2709858	2712456	6174401		Tupanvirus(100.0%)	1	NA	NA
WP_014229012.1|2709858_2712456_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.2e-89
>prophage 191
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2717300	2717891	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004121245.1|2717300_2717891_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 192
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2723469	2728661	6174401		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_032692730.1|2723469_2725404_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	25.1	1.4e-08
WP_014229020.1|2725485_2726643_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004121225.1|2726825_2727614_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004850180.1|2727851_2728661_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
>prophage 193
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2752796	2753816	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_014229034.1|2752796_2753816_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.6	6.9e-15
>prophage 194
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2762681	2763476	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_050595113.1|2762681_2763476_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.4e-31
>prophage 195
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2778236	2778962	6174401		Planktothrix_phage(100.0%)	1	NA	NA
WP_177341175.1|2778236_2778962_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.1	5.2e-33
>prophage 196
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2783590	2855269	6174401	holin,protease,tRNA,plate	Escherichia_phage(17.65%)	64	NA	NA
WP_032694500.1|2783590_2784934_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014229072.1|2784930_2785596_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032694501.1|2785592_2787281_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014229074.1|2787424_2787916_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_070082925.1|2788163_2790806_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	6.5e-97
WP_032694503.1|2790802_2793298_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.5	1.0e-19
WP_032694504.1|2793550_2795518_+	membrane protein	NA	A0A077K801	Ralstonia_phage	32.4	6.6e-62
WP_014229081.1|2795519_2795780_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032694505.1|2795779_2797213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064388733.1|2797354_2800588_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014838278.1|2800683_2800962_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032694507.1|2800974_2802732_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032694508.1|2802695_2803781_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032694509.1|2803758_2804298_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032694510.1|2804299_2804755_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032694511.1|2804778_2806113_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014229090.1|2806274_2807954_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_038423198.1|2808008_2809448_-	MFS transporter	NA	NA	NA	NA	NA
WP_014229092.1|2810344_2811727_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_032693662.1|2811790_2812750_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_032693663.1|2812764_2813298_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_014838292.1|2813294_2814518_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032693664.1|2814514_2815237_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_032693665.1|2815238_2816498_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004850270.1|2816494_2817214_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014838295.1|2817210_2817645_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_032693677.1|2818716_2819061_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_162763177.1|2819158_2820346_-	MFS transporter	NA	NA	NA	NA	NA
WP_071889103.1|2820488_2821625_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014838299.1|2821796_2822681_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838300.1|2822794_2823679_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838301.1|2823837_2824818_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_032693669.1|2824862_2825693_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032693678.1|2825887_2826913_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071532263.1|2827751_2827940_+	cold-shock protein	NA	NA	NA	NA	NA
WP_032693671.1|2828309_2828939_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032693672.1|2829064_2829646_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_004850292.1|2829842_2830406_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_032693673.1|2830460_2830775_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_004850297.1|2830952_2831144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229113.1|2831300_2831495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004850301.1|2831781_2832204_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
WP_014229114.1|2832203_2833469_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
WP_170912124.1|2833541_2834633_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032693674.1|2834625_2835369_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	8.6e-15
WP_032693675.1|2835985_2836606_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032693676.1|2836948_2837932_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_070082926.1|2838415_2839789_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.5	8.9e-50
WP_014838310.1|2839833_2840769_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_014229119.1|2841579_2842518_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014229121.1|2842896_2843187_-	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_004850323.1|2843375_2843810_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_004850325.1|2843892_2844105_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_009652979.1|2844258_2845365_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
WP_014838312.1|2845722_2849250_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_046877232.1|2849719_2850421_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	40.0	2.5e-32
WP_032693411.1|2850881_2851244_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	58.3	5.4e-31
WP_009653048.1|2851320_2851713_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_032749344.1|2851702_2851975_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_032693412.1|2851982_2852525_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.3	8.9e-70
WP_032693413.1|2852751_2853117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101621.1|2853444_2853717_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014229134.1|2853713_2854154_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004112629.1|2854279_2855269_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 197
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2864557	2866078	6174401		Indivirus(100.0%)	1	NA	NA
WP_032693419.1|2864557_2866078_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	1.2e-10
>prophage 198
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2888673	2890180	6174401		Streptococcus_phage(50.0%)	2	NA	NA
WP_032693428.1|2888673_2889363_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	9.8e-13
WP_014229164.1|2889433_2890180_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.9	6.2e-05
>prophage 199
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2911767	2912838	6174401		Synechococcus_phage(100.0%)	1	NA	NA
WP_014838352.1|2911767_2912838_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 200
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2922613	2927224	6174401		Klosneuvirus(50.0%)	2	NA	NA
WP_014838357.1|2922613_2926516_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_014229195.1|2926564_2927224_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	1.4e-29
>prophage 201
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2939236	2943855	6174401		Bacillus_phage(20.0%)	8	NA	NA
WP_014229205.1|2939236_2940208_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
WP_004850536.1|2940273_2940477_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
WP_014838364.1|2940769_2940967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004850538.1|2941087_2941252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004101739.1|2941273_2941516_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
WP_025107908.1|2941741_2942269_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.7	2.4e-19
WP_004101746.1|2942438_2942714_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_014229209.1|2942736_2943855_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	4.7e-33
>prophage 202
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2951091	2952600	6174401		Mollivirus(100.0%)	1	NA	NA
WP_014229212.1|2951091_2952600_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	29.5	1.7e-30
>prophage 203
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2965945	2967910	6174401		Phage_TP(100.0%)	1	NA	NA
WP_032693487.1|2965945_2967910_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	3.0e-22
>prophage 204
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2974659	2975670	6174401		Mycoplasma_phage(100.0%)	1	NA	NA
WP_014229231.1|2974659_2975670_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	4.7e-24
>prophage 205
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2989788	2990514	6174401	integrase	Phage_21(100.0%)	1	2982250:2982263	2998605:2998618
2982250:2982263	attL	GGATACCGTCGACG	NA	NA	NA	NA
WP_158657246.1|2989788_2990514_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	48.2	9.5e-59
WP_158657246.1|2989788_2990514_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	48.2	9.5e-59
2998605:2998618	attR	GGATACCGTCGACG	NA	NA	NA	NA
>prophage 206
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	2996835	2998947	6174401		Salmonella_phage(100.0%)	1	NA	NA
WP_014229248.1|2996835_2998947_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	4.2e-139
>prophage 207
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3009465	3010245	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014229256.1|3009465_3010245_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.4e-20
>prophage 208
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3023962	3024667	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_160740895.1|3023962_3024667_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-30
>prophage 209
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3030258	3031803	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_070082929.1|3030258_3031803_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 210
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3037905	3039396	6174401		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004850706.1|3037905_3039396_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 211
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3049376	3050981	6174401		Planktothrix_phage(100.0%)	1	NA	NA
WP_014229286.1|3049376_3050981_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	4.9e-15
>prophage 212
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3055222	3060168	6174401		Tupanvirus(33.33%)	4	NA	NA
WP_004120604.1|3055222_3056233_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.5e-25
WP_014229291.1|3056489_3057089_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	5.3e-23
WP_074188781.1|3057890_3058418_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032695035.1|3058455_3060168_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.2e-32
>prophage 213
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3078738	3082322	6174401		Bacillus_virus(50.0%)	2	NA	NA
WP_025108277.1|3078738_3079434_+	MgtC family protein	NA	G3MA03	Bacillus_virus	43.1	6.2e-15
WP_032695024.1|3079589_3082322_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	1.9e-35
>prophage 214
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3090594	3092183	6174401		Bacillus_virus(50.0%)	2	NA	NA
WP_009652192.1|3090594_3091410_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	4.3e-07
WP_014838454.1|3091406_3092183_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.5e-17
>prophage 215
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3105371	3109490	6174401		Klosneuvirus(50.0%)	4	NA	NA
WP_032695015.1|3105371_3106757_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.5	9.7e-28
WP_014838463.1|3107064_3108000_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004850829.1|3108024_3108765_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032695014.1|3108761_3109490_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	2.8e-18
>prophage 216
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3126579	3127464	6174401		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004850866.1|3126579_3127464_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.7	3.7e-81
>prophage 217
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3134699	3136097	6174401		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032695001.1|3134699_3136097_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	5.3e-42
>prophage 218
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3150738	3152270	6174401	transposase,integrase	Bacillus_phage(100.0%)	1	3145843:3145860	3161342:3161359
3145843:3145860	attL	CAGGCCTTTTTCCTGCAG	NA	NA	NA	NA
WP_187418266.1|3150738_3152270_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_187418266.1|3150738_3152270_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
3161342:3161359	attR	CAGGCCTTTTTCCTGCAG	NA	NA	NA	NA
>prophage 219
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3172067	3192615	6174401		Bacillus_phage(50.0%)	5	NA	NA
WP_032694989.1|3172067_3173870_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	23.5	5.7e-20
WP_032694988.1|3173856_3175569_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	2.3e-31
WP_032694987.1|3175825_3176785_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_064388354.1|3176968_3183067_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.9	1.5e-32
WP_070082931.1|3183153_3192615_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	8.1e-49
>prophage 220
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3208206	3208953	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_177341168.1|3208206_3208953_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	4.6e-16
>prophage 221
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3213560	3215558	6174401		Acinetobacter_phage(100.0%)	1	NA	NA
WP_086073937.1|3213560_3215558_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 222
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3219308	3220037	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_032694970.1|3219308_3220037_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	8.4e-23
>prophage 223
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3238231	3239068	6174401		Mycobacterium_phage(100.0%)	1	NA	NA
WP_032694956.1|3238231_3239068_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	38.5	1.1e-13
>prophage 224
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3248331	3249864	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032694951.1|3248331_3249864_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 225
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3257636	3261200	6174401		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014838545.1|3257636_3258632_+	2-hydroxyacid dehydrogenase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
WP_004851075.1|3258721_3259984_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_032694947.1|3260114_3261200_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	67.1	7.9e-142
>prophage 226
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3265628	3266438	6174401		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_014229450.1|3265628_3266438_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.4	2.8e-11
>prophage 227
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3270425	3271883	6174401		Mycoplasma_phage(100.0%)	1	NA	NA
WP_032694938.1|3270425_3271883_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.3	1.7e-38
>prophage 228
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3279191	3279932	6174401		Indivirus(100.0%)	1	NA	NA
WP_032695038.1|3279191_3279932_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	7.3e-14
>prophage 229
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3283433	3284225	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014229467.1|3283433_3284225_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 230
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3304152	3305565	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_032694368.1|3304152_3305565_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.5e-17
>prophage 231
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3315646	3316027	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_004102351.1|3315646_3316027_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 232
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3320170	3321676	6174401		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014229495.1|3320170_3320869_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
WP_014229496.1|3320878_3321676_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.9	1.2e-11
>prophage 233
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3325856	3326960	6174401		uncultured_virus(100.0%)	1	NA	NA
WP_014229500.1|3325856_3326960_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	1.1e-101
>prophage 234
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3334845	3342062	6174401		Escherichia_phage(50.0%)	5	NA	NA
WP_032694473.1|3334845_3335916_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	44.6	1.3e-64
WP_032694472.1|3336123_3339231_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	60.0	0.0e+00
WP_014229511.1|3339286_3340537_+	MFS transporter	NA	NA	NA	NA	NA
WP_014838607.1|3340610_3341699_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	82.5	3.7e-176
WP_014229513.1|3341801_3342062_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	83.5	9.9e-35
>prophage 235
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3348288	3358680	6174401		Klosneuvirus(20.0%)	9	NA	NA
WP_032694468.1|3348288_3350331_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.2	1.4e-14
WP_004851244.1|3350502_3351252_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_014229523.1|3351342_3352029_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004851249.1|3352072_3352504_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	39.3	1.5e-19
WP_032694481.1|3352781_3354245_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.4	1.4e-45
WP_029946863.1|3354479_3355856_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_014838618.1|3355899_3356919_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004851257.1|3356933_3358148_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	9.7e-48
WP_014229526.1|3358353_3358680_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
>prophage 236
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3363433	3365559	6174401		Escherichia_phage(100.0%)	3	NA	NA
WP_032694466.1|3363433_3364051_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	2.6e-73
WP_014229530.1|3364052_3364910_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_014838620.1|3364950_3365559_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.6	2.2e-24
>prophage 237
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3375933	3378090	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014229540.1|3375933_3378090_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.0	7.8e-16
>prophage 238
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3385440	3386400	6174401		Salmonella_phage(100.0%)	1	NA	NA
WP_004851304.1|3385440_3386400_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 239
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3397325	3400103	6174401		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032694458.1|3397325_3400103_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	4.7e-66
>prophage 240
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3416623	3417139	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_014229564.1|3416623_3417139_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 241
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3431761	3433063	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_014229576.1|3431761_3433063_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
>prophage 242
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3444512	3444716	6174401		Salmonella_phage(100.0%)	1	NA	NA
WP_004851411.1|3444512_3444716_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 243
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3450074	3451445	6174401		Pandoravirus(100.0%)	1	NA	NA
WP_014229586.1|3450074_3451445_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	8.0e-67
>prophage 244
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3462625	3463900	6174401	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_032692908.1|3462625_3463900_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	7.2e-86
>prophage 245
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3472540	3474018	6174401		Salmonella_phage(50.0%)	2	NA	NA
WP_004119475.1|3472540_3473062_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
WP_014838670.1|3473121_3474018_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.7	2.7e-07
>prophage 246
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3478175	3486874	6174401		Bacillus_phage(20.0%)	9	NA	NA
WP_014229604.1|3478175_3479030_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
WP_014229605.1|3479154_3479736_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	2.6e-43
WP_032692912.1|3479792_3480959_-	MFS transporter	NA	NA	NA	NA	NA
WP_049082851.1|3481123_3481213_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004851481.1|3481509_3482535_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
WP_014229606.1|3482553_3483465_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032692914.1|3483577_3484762_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014229608.1|3485060_3486209_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	6.5e-86
WP_014229609.1|3486238_3486874_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	2.1e-22
>prophage 247
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3501379	3505472	6174401		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_014229621.1|3501379_3502264_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
WP_014838678.1|3502285_3503092_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004119381.1|3503198_3503834_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_032692917.1|3504058_3504688_+	LysE family transporter	NA	NA	NA	NA	NA
WP_032692919.1|3504701_3505472_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	6.2e-16
>prophage 248
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3510538	3515935	6174401	integrase	Bacillus_virus(33.33%)	4	3514815:3514830	3518989:3519004
WP_032692922.1|3510538_3511519_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.1	4.2e-09
WP_014229628.1|3511515_3512481_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.8e-09
WP_032692923.1|3512555_3514961_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
3514815:3514830	attL	TAACAGATACCAGGCG	NA	NA	NA	NA
WP_014229630.1|3515386_3515935_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
WP_014229630.1|3515386_3515935_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
3518989:3519004	attR	TAACAGATACCAGGCG	NA	NA	NA	NA
>prophage 249
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3521957	3522509	6174401	integrase	Escherichia_phage(100.0%)	1	3519200:3519214	3529433:3529447
3519200:3519214	attL	GATATGCAGGACGTT	NA	NA	NA	NA
WP_014838689.1|3521957_3522509_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_014838689.1|3521957_3522509_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
3529433:3529447	attR	AACGTCCTGCATATC	NA	NA	NA	NA
>prophage 250
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3526268	3527141	6174401		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014229640.1|3526268_3527141_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
>prophage 251
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3560908	3563251	6174401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032695051.1|3560908_3563251_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	3.9e-05
>prophage 252
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3584081	3588409	6174401		Planktothrix_phage(50.0%)	3	NA	NA
WP_032694740.1|3584081_3584903_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	5.6e-15
WP_088168676.1|3585409_3587482_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_014838728.1|3587620_3588409_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	8.5e-29
>prophage 253
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3601472	3603436	6174401		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_014229695.1|3601472_3602489_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	6.0e-43
WP_025108198.1|3602485_3603436_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	4.8e-34
>prophage 254
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3621596	3622817	6174401		environmental_halophage(100.0%)	1	NA	NA
WP_032694061.1|3621596_3622817_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	2.6e-93
>prophage 255
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3640522	3658509	6174401	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_014229722.1|3640522_3642901_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
WP_004851771.1|3643243_3644077_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_014229723.1|3644230_3645277_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.4	2.3e-82
WP_160741222.1|3645442_3645622_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_032694067.1|3645656_3647099_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.4	7.4e-55
WP_004134084.1|3647260_3647725_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_032694068.1|3647806_3648556_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.2e-09
WP_014229728.1|3648555_3649107_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_014229729.1|3649331_3650132_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_009653750.1|3650158_3651145_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004851790.1|3651245_3651545_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_032694069.1|3651549_3653937_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004851795.1|3653952_3654936_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_001386830.1|3655165_3655210_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004102963.1|3655333_3655690_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3655740_3655938_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_052746887.1|3656034_3656577_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
WP_004102966.1|3656580_3658509_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
>prophage 256
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3667872	3670769	6174401		Bacillus_virus(66.67%)	3	NA	NA
WP_014229737.1|3667872_3668709_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.9e-08
WP_004851821.1|3668754_3669759_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
WP_032694075.1|3669755_3670769_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.2	6.4e-13
>prophage 257
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3679071	3689494	6174401		Erwinia_phage(20.0%)	10	NA	NA
WP_032694077.1|3679071_3679689_-	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	52.6	3.3e-52
WP_004121719.1|3680244_3680652_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004851836.1|3680786_3681689_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.5e-58
WP_004851838.1|3681886_3682900_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.4e-06
WP_014229740.1|3682980_3683889_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_014229741.1|3684001_3684460_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004121732.1|3684502_3685345_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	46.3	1.6e-12
WP_004103123.1|3686574_3687252_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_014229743.1|3687251_3687962_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_014838755.1|3687958_3689494_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 258
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3705928	3706717	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014838761.1|3705928_3706717_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 259
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3712075	3717781	6174401		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_009651994.1|3712075_3712306_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
WP_004121802.1|3712571_3713672_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_004103146.1|3713760_3714615_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
WP_004851879.1|3714654_3715467_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004851880.1|3715470_3715863_-	SirB family protein	NA	NA	NA	NA	NA
WP_032694081.1|3715859_3716699_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004851884.1|3716698_3717781_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
>prophage 260
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3720995	3723872	6174401		Tupanvirus(50.0%)	2	NA	NA
WP_004103157.1|3720995_3721943_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
WP_014229756.1|3722192_3723872_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.1e-22
>prophage 261
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3727548	3728556	6174401	integrase	uncultured_Caudovirales_phage(100.0%)	1	3727528:3727542	3729800:3729814
3727528:3727542	attL	CCACAAAATCCACGC	NA	NA	NA	NA
WP_074193846.1|3727548_3728556_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
WP_074193846.1|3727548_3728556_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
3729800:3729814	attR	CCACAAAATCCACGC	NA	NA	NA	NA
>prophage 262
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3747139	3748612	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032694095.1|3747139_3748612_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 263
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3751633	3752092	6174401		Acinetobacter_phage(100.0%)	1	NA	NA
WP_009651983.1|3751633_3752092_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
>prophage 264
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3758908	3765105	6174401		Morganella_phage(25.0%)	6	NA	NA
WP_032694098.1|3758908_3759436_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	57.5	2.5e-48
WP_014229779.1|3759514_3760009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694100.1|3760242_3761883_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	2.0e-133
WP_004851947.1|3762198_3763092_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229781.1|3763151_3763838_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	3.0e-06
WP_025108425.1|3764016_3765105_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
>prophage 265
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3786488	3787100	6174401		Geobacillus_virus(100.0%)	1	NA	NA
WP_009651970.1|3786488_3787100_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 266
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3802590	3810675	6174401	tRNA	Bacillus_phage(66.67%)	7	NA	NA
WP_014229806.1|3802590_3804276_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
WP_004852007.1|3804484_3805069_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004852009.1|3805112_3805808_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014229807.1|3805875_3807786_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
WP_004113724.1|3807918_3808263_+	RidA family protein	NA	NA	NA	NA	NA
WP_014229808.1|3808433_3809573_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_014229809.1|3809580_3810675_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	28.5	1.7e-14
>prophage 267
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3817837	3819193	6174401		Pandoravirus(100.0%)	1	NA	NA
WP_032694111.1|3817837_3819193_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	2.7e-43
>prophage 268
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3823037	3824597	6174401		Moraxella_phage(100.0%)	1	NA	NA
WP_004852040.1|3823037_3824597_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 269
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3832033	3832243	6174401		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3832033_3832243_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 270
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3836476	3840174	6174401	transposase,protease	Clostridium_botulinum_C_phage(50.0%)	3	NA	NA
WP_014228411.1|3836476_3836911_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_014229823.1|3837007_3837889_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032694908.1|3838125_3840174_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.6e-85
>prophage 271
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3847642	3848296	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_014229829.1|3847642_3848296_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
>prophage 272
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3857545	3858514	6174401		Pectobacterium_phage(50.0%)	2	NA	NA
WP_004103351.1|3857545_3857776_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_014229839.1|3857854_3858514_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
>prophage 273
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3865955	3871629	6174401		Cyanophage(50.0%)	4	NA	NA
WP_004122041.1|3865955_3867431_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
WP_161505349.1|3867756_3868662_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229845.1|3868787_3870230_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_014229846.1|3870294_3871629_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
>prophage 274
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3876653	3882994	6174401		Listeria_phage(25.0%)	7	NA	NA
WP_014229851.1|3876653_3877976_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_014229852.1|3877991_3878936_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_014229853.1|3879014_3879767_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.0e-15
WP_014229854.1|3879766_3880552_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004852130.1|3880760_3881771_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
WP_004103390.1|3881779_3882391_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014229855.1|3882472_3882994_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 275
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3886866	3893587	6174401	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_064388207.1|3886866_3887685_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.6e-57
WP_004122068.1|3887738_3888134_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_009652021.1|3888173_3888917_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_004852151.1|3888913_3889936_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_014229858.1|3890234_3890978_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014838837.1|3891054_3891624_-	VOC family protein	NA	NA	NA	NA	NA
WP_032693591.1|3891853_3893587_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.2	4.1e-84
>prophage 276
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3900610	3902125	6174401		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014229863.1|3900610_3902125_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 277
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3919402	3920155	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_032693583.1|3919402_3920155_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 278
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3926861	3942050	6174401	integrase	Burkholderia_phage(25.0%)	14	3928796:3928810	3945769:3945783
WP_032693580.1|3926861_3928529_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
WP_025106102.1|3928636_3928816_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
3928796:3928810	attL	ATCACTGACCAACAA	NA	NA	NA	NA
WP_004852222.1|3928891_3929803_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032693579.1|3929986_3930898_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_025106100.1|3930872_3931367_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
WP_025106099.1|3931347_3932781_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	4.6e-97
WP_014229888.1|3932837_3933533_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	2.3e-06
WP_004852229.1|3933575_3933857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229889.1|3934484_3935555_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	5.3e-90
WP_014229890.1|3936207_3936597_+	GtrA family protein	NA	NA	NA	NA	NA
WP_014229891.1|3936593_3937586_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.5	1.3e-50
WP_032693578.1|3937582_3939040_+	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	41.1	1.2e-100
WP_161505340.1|3939661_3940462_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_032693577.1|3940799_3942050_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	30.0	3.8e-47
3945769:3945783	attR	TTGTTGGTCAGTGAT	NA	NA	NA	NA
>prophage 279
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3946182	3947100	6174401		Burkholderia_virus(100.0%)	1	NA	NA
WP_032693554.1|3946182_3947100_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.9	3.9e-09
>prophage 280
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3950429	3950624	6174401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032693553.1|3950429_3950624_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	5.9e-08
>prophage 281
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3970536	3974993	6174401	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_032693495.1|3970536_3971823_-	hypothetical protein	NA	Q858S9	Enterobacteria_phage	27.2	6.4e-42
WP_032693519.1|3972568_3973330_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_048213841.1|3973784_3974993_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	2.4e-46
>prophage 282
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3978965	3982093	6174401		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_032693499.1|3978965_3979781_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	42.6	9.7e-52
WP_032693500.1|3981148_3982093_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.5	1.3e-55
>prophage 283
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	3995119	4002970	6174401		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_032693510.1|3995119_3997807_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	3.6e-71
WP_032693511.1|3997857_3998289_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.8	8.5e-23
WP_032693512.1|3998822_3999908_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032693513.1|3999907_4002970_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.2	1.2e-25
>prophage 284
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4020729	4021644	6174401		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032693825.1|4020729_4021644_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	30.2	1.5e-08
>prophage 285
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4028175	4029444	6174401	integrase	Pseudomonas_phage(100.0%)	1	4024304:4024318	4038615:4038629
4024304:4024318	attL	AACAGGCTGCTGGAG	NA	NA	NA	NA
WP_070082946.1|4028175_4029444_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	40.9	1.4e-76
WP_070082946.1|4028175_4029444_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	40.9	1.4e-76
4038615:4038629	attR	AACAGGCTGCTGGAG	NA	NA	NA	NA
>prophage 286
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4040937	4041123	6174401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003036401.1|4040937_4041123_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	4.3e-08
>prophage 287
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4056519	4057467	6174401		Caulobacter_phage(100.0%)	1	NA	NA
WP_070082965.1|4056519_4057467_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	4.6e-53
>prophage 288
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4063119	4064193	6174401		Wolbachia_phage(100.0%)	1	NA	NA
WP_040120416.1|4063119_4064193_-	cGAMP-activated phospholipase CapV	NA	A0A1B2LRS3	Wolbachia_phage	31.1	9.8e-20
>prophage 289
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4094192	4099172	6174401		Stx2-converting_phage(50.0%)	3	NA	NA
WP_014230017.1|4094192_4095359_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.1	3.1e-184
WP_014230018.1|4095539_4096964_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_014838912.1|4097069_4099172_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.3e-63
>prophage 290
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4112563	4114621	6174401		uncultured_virus(50.0%)	2	NA	NA
WP_014230029.1|4112563_4113388_+	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
WP_032693845.1|4113418_4114621_+	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.5	2.6e-29
>prophage 291
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4127144	4128044	6174401		Cellulophaga_phage(100.0%)	1	NA	NA
WP_032693852.1|4127144_4128044_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 292
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4133588	4135581	6174401	transposase	Klosneuvirus(50.0%)	2	NA	NA
WP_004122447.1|4133588_4134188_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
WP_077270219.1|4134612_4135581_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	90.7	1.6e-170
>prophage 293
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4138823	4153286	6174401		Escherichia_phage(22.22%)	12	NA	NA
WP_004852435.1|4138823_4139978_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	3.0e-75
WP_032693857.1|4139996_4141889_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004852439.1|4141902_4142643_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.1e-06
WP_004138730.1|4142642_4143410_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032693858.1|4144715_4145720_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.1	3.6e-32
WP_139512586.1|4146191_4146314_+	small membrane protein	NA	NA	NA	NA	NA
WP_032693859.1|4146887_4148054_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
WP_014230057.1|4148227_4148782_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_014230058.1|4148797_4149688_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
WP_032693860.1|4149719_4150589_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	1.7e-110
WP_032693861.1|4150602_4151667_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.2e-104
WP_014838945.1|4151879_4153286_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
>prophage 294
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4157084	4159532	6174401		Catovirus(50.0%)	2	NA	NA
WP_032693866.1|4157084_4157855_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.8	2.2e-05
WP_071993377.1|4157882_4159532_-	hypothetical protein	NA	A0A0U3C9T3	Klebsiella_phage	34.5	1.8e-81
>prophage 295
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4169987	4176874	6174401		Bacillus_phage(25.0%)	5	NA	NA
WP_016946203.1|4169987_4170884_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.4e-45
WP_032693729.1|4171860_4173447_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	2.9e-36
WP_014230076.1|4173685_4175533_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004852489.1|4175560_4176142_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
WP_070082973.1|4176232_4176874_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 296
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4189765	4190740	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_032693722.1|4189765_4190740_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.2e-08
>prophage 297
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4209241	4217636	6174401	tRNA	Bacillus_phage(33.33%)	8	NA	NA
WP_032693716.1|4209241_4210777_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
WP_014230101.1|4210773_4211496_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_016946932.1|4211814_4213176_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	6.1e-200
WP_009654032.1|4213420_4214314_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
WP_014230103.1|4214314_4214785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693715.1|4214771_4215572_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014230105.1|4215988_4216762_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_014230106.1|4216772_4217636_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.4	1.1e-08
>prophage 298
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4226270	4227638	6174401		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_032693709.1|4226270_4227638_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.3	1.2e-43
>prophage 299
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4235677	4237654	6174401		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032693706.1|4235677_4237654_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	3.1e-160
>prophage 300
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4246117	4255070	6174401	tRNA	Enterobacteria_phage(60.0%)	10	NA	NA
WP_032693702.1|4246117_4248151_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	8.0e-55
WP_014230129.1|4248351_4248819_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_070082974.1|4248922_4249390_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.2	2.6e-65
WP_014230130.1|4249443_4250163_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_004852614.1|4250156_4251845_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.9e-259
WP_014839041.1|4252055_4252814_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	4.7e-77
WP_142394549.1|4252879_4253134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004103838.1|4253313_4253427_+	protein YohO	NA	NA	NA	NA	NA
WP_014839042.1|4253401_4254139_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230133.1|4254122_4255070_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
>prophage 301
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4261643	4262198	6174401		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004138576.1|4261643_4262198_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.9e-20
>prophage 302
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4266393	4267128	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_032693698.1|4266393_4267128_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	2.1e-50
>prophage 303
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4283037	4284558	6174401		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_014230153.1|4283037_4284558_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 304
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4288316	4292283	6174401		Cellulophaga_phage(50.0%)	3	NA	NA
WP_004103895.1|4288316_4288985_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
WP_014839058.1|4289353_4290190_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032693692.1|4290309_4292283_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
>prophage 305
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4296400	4297258	6174401		Catovirus(100.0%)	1	NA	NA
WP_014230162.1|4296400_4297258_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	1.5e-23
>prophage 306
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4308484	4312792	6174401		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_014839067.1|4308484_4309951_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	6.6e-43
WP_014230172.1|4310069_4311047_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_025106743.1|4311082_4311796_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004122922.1|4312222_4312792_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
>prophage 307
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4318551	4401447	6174401	transposase,protease,plate	Vibrio_phage(10.53%)	65	NA	NA
WP_014230176.1|4318551_4320141_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.1	4.0e-17
WP_004122937.1|4320144_4320489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230177.1|4320819_4322016_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
WP_014230178.1|4322012_4322732_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_032693688.1|4322880_4324638_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	5.8e-102
WP_004114143.1|4324775_4325060_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_032693687.1|4325121_4325715_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014230181.1|4325795_4326554_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004122954.1|4326603_4327611_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
WP_004133900.1|4327789_4328017_+	YejL family protein	NA	NA	NA	NA	NA
WP_014230182.1|4328036_4329797_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_070082975.1|4330244_4330697_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014230185.1|4330689_4331226_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032693684.1|4331206_4332310_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014839078.1|4332264_4334028_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032693683.1|4334051_4334786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230189.1|4334850_4335045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230191.1|4335396_4338816_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014230192.1|4338802_4339963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230193.1|4339966_4340233_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014230194.1|4340262_4340943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230195.1|4340939_4342844_-	LysM peptidoglycan-binding domain-containing protein	NA	S6BFI4	Thermus_phage	53.5	3.2e-05
WP_014230196.1|4342852_4343392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839083.1|4343384_4346000_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_014230199.1|4346291_4346933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839086.1|4348543_4349035_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_171817012.1|4349039_4350764_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014839088.1|4350767_4351421_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014839089.1|4351417_4352755_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_187418267.1|4352773_4354318_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014230205.1|4354360_4354858_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075208269.1|4355170_4355497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653963.1|4355839_4356946_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014230206.1|4357148_4357640_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_014230207.1|4357684_4359319_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_162097206.1|4359688_4360846_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.6	9.4e-77
WP_014230209.1|4360808_4362245_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014230210.1|4362413_4364057_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014230211.1|4364133_4364784_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014230212.1|4364783_4365848_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014230213.1|4365920_4366973_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014230214.1|4367075_4368194_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
WP_014230215.1|4368965_4371626_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_004103995.1|4371642_4372293_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_014230216.1|4372337_4375184_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
WP_004852752.1|4375314_4377948_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.6e-92
WP_014230217.1|4378133_4378862_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839096.1|4379206_4381492_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_004852757.1|4381595_4382726_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_004104002.1|4382725_4382980_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_014230219.1|4383172_4384717_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	28.3	3.0e-38
WP_014230220.1|4384761_4385718_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230221.1|4385722_4386790_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
WP_014230222.1|4386799_4388146_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_032694817.1|4388417_4390040_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_032694818.1|4390029_4391289_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_032694820.1|4391285_4392464_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_032694821.1|4392486_4393290_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_032694822.1|4393304_4394594_-	MFS transporter	NA	NA	NA	NA	NA
WP_014839100.1|4394646_4395852_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
WP_004852774.1|4395865_4396648_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230228.1|4396852_4398049_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_070082977.1|4398145_4398688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230229.1|4398957_4400406_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_014230230.1|4400454_4401447_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.3	2.7e-72
>prophage 308
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4423015	4423567	6174401	integrase	Escherichia_phage(100.0%)	1	4413079:4413092	4424605:4424618
4413079:4413092	attL	CGAGACCAGCCAGC	NA	NA	NA	NA
WP_014839116.1|4423015_4423567_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014839116.1|4423015_4423567_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
4424605:4424618	attR	CGAGACCAGCCAGC	NA	NA	NA	NA
>prophage 309
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4442558	4443158	6174401		Salmonella_phage(100.0%)	1	NA	NA
WP_004852850.1|4442558_4443158_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 310
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4454974	4455994	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032694831.1|4454974_4455994_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	3.6e-19
>prophage 311
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4460260	4462465	6174401		Salmonella_phage(66.67%)	4	NA	NA
WP_032694834.1|4460260_4460515_+	hypothetical protein	NA	J9Q735	Salmonella_phage	44.7	8.3e-10
WP_032694836.1|4460518_4461085_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	61.3	1.2e-45
WP_046877205.1|4461152_4461650_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004852881.1|4461691_4462465_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
>prophage 312
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4466758	4468276	6174401		Mollivirus(100.0%)	1	NA	NA
WP_004123211.1|4466758_4468276_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 313
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4474698	4475835	6174401		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_070082978.1|4474698_4475835_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.5e-21
>prophage 314
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4484248	4485337	6174401		Pandoravirus(100.0%)	1	NA	NA
WP_014230282.1|4484248_4485337_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 315
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4494456	4499413	6174401		Enterobacteria_phage(33.33%)	5	NA	NA
WP_032694845.1|4494456_4495353_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	78.2	8.5e-126
WP_014230292.1|4495580_4495916_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004852922.1|4496586_4496841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694846.1|4497436_4498300_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	25.2	4.5e-07
WP_014230296.1|4498480_4499413_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	6.1e-10
>prophage 316
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4504574	4505318	6174401		Clostridioides_phage(100.0%)	1	NA	NA
WP_032694853.1|4504574_4505318_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	9.5e-14
>prophage 317
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4523244	4533119	6174401		Lactobacillus_phage(25.0%)	9	NA	NA
WP_032693079.1|4523244_4524171_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	8.8e-09
WP_004852990.1|4524260_4525259_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004123346.1|4525255_4525474_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_032693084.1|4525466_4527491_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.1	6.8e-147
WP_032693086.1|4527565_4528585_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_009654873.1|4528815_4529577_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032693088.1|4529736_4530708_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	1.1e-75
WP_002913505.1|4531089_4531347_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_032693091.1|4531391_4533119_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	3.3e-17
>prophage 318
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4537367	4545960	6174401		Streptococcus_phage(25.0%)	10	NA	NA
WP_014230319.1|4537367_4538279_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.0e-57
WP_014230320.1|4538345_4539440_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-29
WP_014230321.1|4539429_4540305_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004123378.1|4540304_4541138_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_014230322.1|4541137_4542154_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_032693095.1|4542379_4543279_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
WP_014839169.1|4543372_4543948_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004853030.1|4544011_4544461_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_004853033.1|4544447_4544873_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004870750.1|4545084_4545960_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
>prophage 319
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4579449	4581149	6174401		Rhodococcus_phage(50.0%)	2	NA	NA
WP_014839185.1|4579449_4580316_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
WP_004104417.1|4580435_4581149_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
>prophage 320
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4588415	4589705	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004853099.1|4588415_4589705_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
>prophage 321
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4593208	4594884	6174401		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004853107.1|4593208_4594246_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.4e-71
WP_014230347.1|4594242_4594884_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
>prophage 322
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4607324	4607516	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_009654356.1|4607324_4607516_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	73.0	1.1e-17
>prophage 323
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4611496	4614498	6174401		Klosneuvirus(50.0%)	2	NA	NA
WP_014230355.1|4611496_4612963_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
WP_032693140.1|4613121_4614498_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
>prophage 324
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4627939	4628371	6174401		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004114414.1|4627939_4628371_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 325
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4640542	4646900	6174401		Mycoplasma_phage(20.0%)	8	NA	NA
WP_014230371.1|4640542_4641829_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
WP_004104502.1|4641935_4642136_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004104503.1|4642137_4642473_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_014230372.1|4642474_4644325_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	1.9e-103
WP_004104505.1|4644340_4644856_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004104506.1|4644929_4645253_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|4645272_4645659_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004134936.1|4645685_4646900_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 326
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4661222	4676856	6174401	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_009654385.1|4661222_4662476_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_032693157.1|4662801_4663992_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|4664050_4664389_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_014230390.1|4664454_4665792_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_032693159.1|4665778_4666483_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_148673421.1|4666496_4667933_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.0	1.3e-11
WP_032693171.1|4668495_4672383_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	1.0e-130
WP_014839219.1|4672557_4674174_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071846082.1|4674170_4674716_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
WP_004853258.1|4674735_4675371_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_014230398.1|4675580_4676429_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114478.1|4676595_4676856_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
>prophage 327
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4679863	4683560	6174401		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_004104573.1|4679863_4680544_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
WP_014230401.1|4680770_4681745_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004853275.1|4681760_4683560_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
>prophage 328
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4689337	4694487	6174401	transposase,tRNA	Cafeteria_roenbergensis_virus(20.0%)	6	NA	NA
WP_004853282.1|4689337_4690669_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
WP_004104596.1|4690714_4691098_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_014230405.1|4691409_4692099_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
WP_014228411.1|4692182_4692617_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_004123719.1|4692784_4693858_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_004104599.1|4694061_4694487_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
>prophage 329
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4699786	4701814	6174401		Burkholderia_virus(50.0%)	2	NA	NA
WP_004853296.1|4699786_4701085_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.1e-44
WP_032694273.1|4701358_4701814_-	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.3	4.7e-32
>prophage 330
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4707750	4710324	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014226431.1|4707750_4710324_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
>prophage 331
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4717127	4718198	6174401		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_014226435.1|4717127_4718198_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
>prophage 332
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4723135	4792481	6174401	holin,terminase,tRNA,head,protease,transposase,portal,capsid,tail	Klebsiella_phage(15.69%)	75	NA	NA
WP_004104636.1|4723135_4723903_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014226441.1|4723948_4724497_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004123777.1|4724515_4724764_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004123779.1|4725000_4726368_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004853326.1|4726532_4727324_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_014839241.1|4727342_4728632_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004853330.1|4728696_4729287_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004123797.1|4729412_4730291_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_032694810.1|4730377_4732039_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_032694809.1|4732186_4732528_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014226445.1|4732594_4732885_-	RnfH family protein	NA	NA	NA	NA	NA
WP_029946935.1|4732874_4733351_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004104655.1|4733461_4733944_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
WP_070082982.1|4734741_4735947_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_070082983.1|4736498_4737539_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	87.6	5.2e-183
WP_070082984.1|4737604_4738246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082985.1|4739554_4739974_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	2.1e-34
WP_064411098.1|4740052_4740295_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.9	1.2e-29
WP_064411099.1|4740294_4740537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082986.1|4740666_4741170_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	72.6	1.4e-53
WP_070082987.1|4745367_4748445_-	kinase	NA	A0A286S259	Klebsiella_phage	61.4	0.0e+00
WP_049100207.1|4748441_4748822_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	79.4	7.2e-58
WP_049100206.1|4748834_4749311_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	1.1e-50
WP_004177132.1|4749297_4749771_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_070082988.1|4749791_4753400_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	53.6	2.0e-213
WP_049100202.1|4753459_4753801_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	45.2	9.7e-06
WP_070082989.1|4753855_4754194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082990.1|4754227_4754485_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	67.1	2.7e-24
WP_049083362.1|4754487_4755243_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	48.4	3.2e-57
WP_016809743.1|4755429_4755735_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.0	6.2e-28
WP_070082991.1|4755737_4756142_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.7	2.5e-32
WP_049083363.1|4756172_4756877_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.8	1.5e-80
WP_042947699.1|4756933_4757281_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
WP_070082992.1|4757277_4757727_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	5.1e-63
WP_048258044.1|4757723_4758062_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_064411111.1|4758411_4758666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047934992.1|4758711_4759932_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.5	3.4e-141
WP_014838140.1|4759941_4760649_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_064411112.1|4760624_4761944_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	2.2e-138
WP_077253184.1|4761950_4763687_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.1e-137
WP_014838137.1|4763640_4764105_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_032734579.1|4764222_4764564_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	2.7e-48
WP_049106544.1|4764618_4764864_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.5	4.7e-18
WP_064392801.1|4764928_4765129_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	5.9e-19
WP_014228564.1|4765279_4765465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108059.1|4765589_4765883_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	6.8e-32
WP_014837907.1|4766020_4766305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064404667.1|4766540_4766816_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.8	3.7e-24
WP_025108061.1|4766823_4767450_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.3	1.5e-89
WP_014228560.1|4767449_4767728_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	76.1	4.0e-34
WP_004139418.1|4767717_4768107_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	80.3	2.4e-48
WP_187418268.1|4769594_4769804_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	65.4	1.2e-09
WP_077270227.1|4769935_4770058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070082994.1|4770045_4770435_-	HNH endonuclease	NA	A0A1B1PE63	Salmonella_phage	43.0	8.2e-17
WP_070082995.1|4775169_4775568_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	69.7	6.6e-46
WP_070082996.1|4775564_4776041_-|protease	SOS-response repressor and protease LexA	protease	A0A291AWY9	Escherichia_phage	63.9	2.0e-17
WP_070082997.1|4776037_4778020_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.8	2.5e-194
WP_187418275.1|4778012_4778894_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.0	4.9e-126
WP_048258063.1|4779144_4779603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064349867.1|4780499_4780679_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.5	5.6e-13
WP_049099518.1|4780851_4781400_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	54.9	1.2e-45
WP_139134449.1|4781442_4781874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049099516.1|4781939_4782140_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	81.5	6.7e-23
WP_049099515.1|4782227_4782902_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.5	1.5e-114
WP_049099514.1|4783075_4783309_+	hypothetical protein	NA	Q56BD7	Escherichia_virus	38.4	5.1e-06
WP_001515608.1|4784762_4785134_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
WP_070082999.1|4785190_4786018_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	84.7	2.4e-130
WP_070083000.1|4786150_4786678_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	2.4e-64
WP_070083001.1|4786677_4786875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083002.1|4786871_4787354_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.2	6.1e-70
WP_070083003.1|4787350_4787575_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	1.4e-13
WP_032693613.1|4788359_4788692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083004.1|4788688_4789375_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	58.3	6.9e-19
WP_070083005.1|4790514_4791081_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	72.6	2.4e-78
WP_070083006.1|4791290_4792481_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.0e-146
>prophage 333
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4802072	4805252	6174401		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_032694798.1|4802072_4805252_-	transporter substrate-binding domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	21.6	2.9e-19
>prophage 334
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4813484	4815005	6174401		Pithovirus(100.0%)	1	NA	NA
WP_032694794.1|4813484_4815005_+	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	3.9e-14
>prophage 335
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4822374	4823016	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_032694815.1|4822374_4823016_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	23.9	2.6e-12
>prophage 336
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4826080	4829566	6174401		Mollivirus(50.0%)	4	NA	NA
WP_014839276.1|4826080_4826857_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
WP_014839277.1|4827002_4827923_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032694789.1|4827962_4828736_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032694788.1|4828771_4829566_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	28.6	3.5e-06
>prophage 337
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4845504	4850795	6174401		Gordonia_phage(25.0%)	5	NA	NA
WP_004853449.1|4845504_4845750_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
WP_004104769.1|4845746_4846157_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_032694780.1|4846129_4848274_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.0e-189
WP_014839293.1|4848284_4849247_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.8	1.2e-130
WP_014226499.1|4849592_4850795_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
>prophage 338
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4865678	4873995	6174401	tRNA	Vibrio_phage(20.0%)	9	NA	NA
WP_000906486.1|4865678_4865864_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_032694773.1|4866102_4868730_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
WP_014226510.1|4868860_4869361_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004104808.1|4869432_4870491_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
WP_014226512.1|4870571_4871069_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	1.3e-27
WP_014226513.1|4871273_4871501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694771.1|4871537_4872416_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014226515.1|4872424_4873288_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_162557671.1|4873284_4873995_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	6.3e-07
>prophage 339
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4879570	4880536	6174401		Tetraselmis_virus(100.0%)	1	NA	NA
WP_014226519.1|4879570_4880536_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	4.0e-36
>prophage 340
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4922121	4922943	6174401		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014226545.1|4922121_4922943_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 341
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4930912	4934242	6174401		Cedratvirus(33.33%)	3	NA	NA
WP_032694640.1|4930912_4931692_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.8	1.3e-10
WP_014226554.1|4931883_4933137_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	Q6A202	Oenococcus_phage	30.9	1.3e-44
WP_032694641.1|4933474_4934242_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.9	1.4e-20
>prophage 342
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4947074	4952286	6174401		Planktothrix_phage(66.67%)	3	NA	NA
WP_070083007.1|4947074_4949018_-	ABC transporter permease	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-30
WP_014226569.1|4949017_4950178_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_032694648.1|4950174_4952286_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	1.5e-16
>prophage 343
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4969599	4976934	6174401	integrase	Cellulophaga_phage(25.0%)	5	4970242:4970256	4977194:4977208
WP_032694658.1|4969599_4970109_+	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	48.8	2.4e-40
4970242:4970256	attL	CATGCTAACAAAATA	NA	NA	NA	NA
WP_070083009.1|4970375_4971959_-	hypothetical protein	NA	P79669	Escherichia_phage	32.5	4.7e-79
WP_032694660.1|4972161_4972743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694661.1|4972752_4974207_-|integrase	integrase	integrase	A0A0R6PHE0	Moraxella_phage	28.7	4.4e-23
WP_032694732.1|4974366_4976934_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.5	3.9e-30
4977194:4977208	attR	TATTTTGTTAGCATG	NA	NA	NA	NA
>prophage 344
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4983043	4986818	6174401		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004104962.1|4983043_4984036_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_032694666.1|4984195_4985314_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
WP_009651549.1|4985436_4986063_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
WP_032694667.1|4986056_4986818_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.2e-58
>prophage 345
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	4989891	4991924	6174401		Tupanvirus(50.0%)	2	NA	NA
WP_004853621.1|4989891_4990497_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	6.1e-27
WP_014226587.1|4990496_4991924_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	3.9e-32
>prophage 346
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5000105	5001254	6174401		unidentified_phage(100.0%)	1	NA	NA
WP_025106434.1|5000105_5001254_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.3	2.3e-35
>prophage 347
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5007925	5013250	6174401		Vibrio_phage(33.33%)	4	NA	NA
WP_004124321.1|5007925_5008597_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
WP_025106430.1|5009057_5010167_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004124327.1|5010233_5011532_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	2.8e-130
WP_004105009.1|5011612_5013250_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
>prophage 348
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5016672	5022081	6174401		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_014226597.1|5016672_5018016_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	1.4e-34
WP_014226598.1|5018138_5020892_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	2.0e-48
WP_014226599.1|5020941_5022081_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
>prophage 349
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5029522	5030368	6174401		Vibrio_phage(100.0%)	1	NA	NA
WP_004853651.1|5029522_5030368_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 350
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5042766	5043522	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_025108014.1|5042766_5043522_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 351
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5054241	5056816	6174401	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_014226621.1|5054241_5055447_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	4.4e-69
WP_014839393.1|5055446_5055884_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_009651598.1|5056006_5056816_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
>prophage 352
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5061849	5062665	6174401		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_014226625.1|5061849_5062665_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	2.5e-07
>prophage 353
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5096616	5107730	6174401		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
WP_014226651.1|5096616_5097870_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	5.0e-15
WP_004853841.1|5098097_5099429_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_014839419.1|5099470_5101306_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	42.5	2.6e-04
WP_064388452.1|5101302_5104848_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.9	8.0e-10
WP_032694699.1|5104844_5107730_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.7	9.9e-59
>prophage 354
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5113204	5132200	6174401		Geobacillus_virus(16.67%)	16	NA	NA
WP_004124584.1|5113204_5113999_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	2.6e-118
WP_014226659.1|5114005_5114881_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_014226660.1|5115176_5117423_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
WP_004124593.1|5117435_5117966_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_014226661.1|5118648_5119344_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004105253.1|5119425_5120139_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
WP_004105255.1|5120263_5120482_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_014226662.1|5120719_5121760_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_032694706.1|5121859_5123053_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_032694707.1|5123045_5125205_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
WP_014226665.1|5125827_5126844_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_032694708.1|5126804_5127284_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004105268.1|5127280_5128054_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032694709.1|5128122_5129550_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	4.5e-36
WP_032694710.1|5129557_5130895_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_162097180.1|5131198_5132200_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.6	9.8e-30
>prophage 355
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5143594	5144722	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_014226681.1|5143594_5144722_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 356
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5152801	5155293	6174401		Aichi_virus(50.0%)	2	NA	NA
WP_014226687.1|5152801_5154220_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.2	1.6e-25
WP_004124661.1|5154531_5155293_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
>prophage 357
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5186337	5190184	6174401		Acinetobacter_phage(50.0%)	3	NA	NA
WP_004124798.1|5186337_5187891_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	6.6e-158
WP_014226713.1|5188388_5188811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654966.1|5189410_5190184_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
>prophage 358
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5197482	5199039	6174401		Catovirus(100.0%)	1	NA	NA
WP_014226721.1|5197482_5199039_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 359
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5206401	5207577	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_032694028.1|5206401_5207577_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	7.7e-42
>prophage 360
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5212719	5214854	6174401		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_014839481.1|5212719_5213145_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.2e-50
WP_014839482.1|5213158_5214451_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	7.4e-171
WP_014839483.1|5214503_5214854_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.4	1.3e-24
>prophage 361
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5220144	5220825	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_032694024.1|5220144_5220825_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.0e-30
>prophage 362
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5227127	5227979	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032694017.1|5227127_5227979_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.9	6.8e-48
>prophage 363
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5230985	5238108	6174401	integrase	Erwinia_phage(25.0%)	5	5221172:5221185	5243778:5243791
5221172:5221185	attL	AAGGCTTTAATAAA	NA	NA	NA	NA
WP_032694013.1|5230985_5231237_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	57.7	1.5e-08
WP_032694012.1|5232286_5233528_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_032694052.1|5233635_5234820_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	59.3	9.2e-136
WP_032694011.1|5235102_5236308_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BVE3	unidentified_phage	33.6	3.7e-07
WP_032694010.1|5236320_5238108_-	hypothetical protein	NA	A0A291LB80	Escherichia_phage	34.2	1.9e-39
5243778:5243791	attR	TTTATTAAAGCCTT	NA	NA	NA	NA
>prophage 364
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5242179	5242815	6174401		Enterobacteria_phage(100.0%)	1	NA	NA
WP_050595140.1|5242179_5242815_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	50.3	3.7e-43
>prophage 365
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5249273	5249999	6174401		Clostridium_phage(100.0%)	1	NA	NA
WP_004854045.1|5249273_5249999_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
>prophage 366
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5254657	5260740	6174401	tRNA	Catovirus(25.0%)	5	NA	NA
WP_004134430.1|5254657_5256175_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	7.7e-87
WP_100248296.1|5256184_5257283_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_032693806.1|5257368_5259102_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	1.2e-59
WP_032693807.1|5259107_5259821_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004105555.1|5259843_5260740_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 367
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5272986	5278888	6174401		Pandoravirus(50.0%)	4	NA	NA
WP_025105966.1|5272986_5274420_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.5e-31
WP_004854083.1|5274610_5275102_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032693812.1|5275210_5275954_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032693813.1|5276014_5278888_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.5	5.7e-264
>prophage 368
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5287065	5288298	6174401		Catovirus(100.0%)	1	NA	NA
WP_004115297.1|5287065_5288298_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 369
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5305791	5306448	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_032693819.1|5305791_5306448_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.4	5.3e-08
>prophage 370
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5313724	5314879	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226830.1|5313724_5314879_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 371
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5332895	5333978	6174401		Geobacillus_virus(100.0%)	1	NA	NA
WP_014226844.1|5332895_5333978_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 372
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5340374	5340581	6174401		Vibrio_phage(100.0%)	1	NA	NA
WP_032692858.1|5340374_5340581_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	61.2	8.1e-16
>prophage 373
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5349130	5350501	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_025105933.1|5349130_5350501_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	35.4	3.3e-44
>prophage 374
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5372423	5382366	6174401		Staphylococcus_phage(20.0%)	8	NA	NA
WP_025105927.1|5372423_5373251_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	2.1e-62
WP_025105926.1|5373349_5373805_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.9e-21
WP_025105925.1|5373899_5376083_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	4.5e-104
WP_004854230.1|5376203_5377616_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_004125254.1|5377700_5378438_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_014226868.1|5378630_5380889_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.7e-86
WP_009651841.1|5381011_5381881_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839568.1|5381958_5382366_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
>prophage 375
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5385657	5387553	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_004854242.1|5385657_5387553_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.4e-90
>prophage 376
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5391875	5398856	6174401		Erwinia_phage(25.0%)	8	NA	NA
WP_004125303.1|5391875_5392544_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
WP_025105920.1|5392549_5393710_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.3e-89
WP_014226877.1|5393756_5394548_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_025105919.1|5394741_5395512_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_004854262.1|5395573_5396227_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
WP_004854265.1|5396604_5396886_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004854266.1|5396939_5397149_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_014226884.1|5397422_5398856_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	5.1e-40
>prophage 377
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5403966	5405208	6174401		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_014226887.1|5403966_5405208_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 378
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5414593	5420158	6174401	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_032692889.1|5414593_5415607_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.5e-107
WP_001144069.1|5415844_5416060_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014226898.1|5416294_5418040_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	4.1e-76
WP_004105908.1|5418313_5420158_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 379
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5433358	5439920	6174401	tRNA	Klosneuvirus(50.0%)	4	NA	NA
WP_004854393.1|5433358_5434738_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	9.0e-34
WP_014226909.1|5434775_5435108_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_014226910.1|5435327_5436311_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_032693225.1|5436827_5439920_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.6	4.1e-159
>prophage 380
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5451284	5452772	6174401		Bacillus_phage(100.0%)	1	NA	NA
WP_014226925.1|5451284_5452772_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.6	1.6e-07
>prophage 381
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5465200	5466169	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_032693241.1|5465200_5466169_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.6	2.2e-39
>prophage 382
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5482405	5483551	6174401		Streptococcus_phage(100.0%)	1	NA	NA
WP_014226948.1|5482405_5483551_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	2.2e-46
>prophage 383
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5499777	5509939	6174401		Escherichia_phage(16.67%)	12	NA	NA
WP_014226962.1|5499777_5500551_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	2.6e-22
WP_014226964.1|5501620_5502484_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	2.1e-49
WP_032693253.1|5502547_5504629_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_014226966.1|5504586_5504973_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|5504995_5505586_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_004125578.1|5505595_5506171_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_032693254.1|5506278_5507319_-	permease	NA	NA	NA	NA	NA
WP_032693255.1|5507388_5508039_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_004854517.1|5508167_5508686_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
WP_014226969.1|5508665_5509109_-	YhbP family protein	NA	NA	NA	NA	NA
WP_014226970.1|5509164_5509449_+	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	50.6	5.8e-12
WP_032693256.1|5509435_5509939_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
>prophage 384
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5515132	5517094	6174401		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_014839626.1|5515132_5517094_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 385
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5522495	5534136	6174401	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
WP_004106093.1|5522495_5525186_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
WP_004854539.1|5525210_5526698_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004125659.1|5526725_5527178_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004106101.1|5527769_5529113_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
WP_004106103.1|5529365_5529695_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014226977.1|5529924_5531262_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014226978.1|5531254_5532103_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
WP_004854549.1|5532201_5534136_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 386
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5540724	5542166	6174401		Indivirus(50.0%)	2	NA	NA
WP_004854564.1|5540724_5541696_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
WP_004854566.1|5541893_5542166_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
>prophage 387
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5546225	5560208	6174401		Staphylococcus_phage(28.57%)	16	NA	NA
WP_032693262.1|5546225_5547038_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	4.8e-19
WP_032693263.1|5547247_5548225_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004854583.1|5548239_5549226_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.5e-40
WP_004854584.1|5549240_5549807_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
WP_004854587.1|5549803_5550379_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004125703.1|5550347_5550893_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004125705.1|5550899_5551625_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_004854591.1|5551672_5553106_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004106167.1|5553128_5553416_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004854593.1|5553481_5553970_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004106169.1|5554015_5554870_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004106170.1|5554866_5555139_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_014226984.1|5555191_5555917_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_014226985.1|5555913_5556567_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_014839635.1|5556801_5559141_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
WP_032693264.1|5559272_5560208_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
>prophage 388
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5568916	5572912	6174401	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_032693265.1|5568916_5570404_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	1.3e-09
WP_014839641.1|5570510_5571404_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032693266.1|5571523_5572330_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_014226996.1|5572423_5572912_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 389
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5576816	5578184	6174401	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014226999.1|5576816_5578184_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
>prophage 390
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5585329	5586598	6174401		Oenococcus_phage(100.0%)	1	NA	NA
WP_032694499.1|5585329_5586598_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.7	3.0e-60
>prophage 391
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5605491	5606535	6174401		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|5605491_5606535_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 392
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5635436	5636908	6174401	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_004854751.1|5635436_5635946_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_032693886.1|5635960_5636908_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.8	1.7e-07
>prophage 393
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5656789	5662361	6174401		Tupanvirus(33.33%)	7	NA	NA
WP_004097636.1|5656789_5657974_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004115957.1|5658044_5660159_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
WP_004106370.1|5660255_5660726_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002920115.1|5660821_5661196_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_025107828.1|5661320_5661608_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004854839.1|5661615_5661975_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_014227040.1|5661974_5662361_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.2e-20
>prophage 394
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5667996	5680848	6174401		Tupanvirus(14.29%)	12	NA	NA
WP_004854860.1|5667996_5669901_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.8e-75
WP_032693747.1|5669962_5671453_-	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	49.9	9.1e-141
WP_032693737.1|5671457_5672327_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	2.4e-48
WP_032693738.1|5672523_5673243_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.3	7.3e-19
WP_160741663.1|5673348_5674347_+	hydrolase	NA	NA	NA	NA	NA
WP_004125965.1|5674343_5674562_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
WP_004854874.1|5674597_5675470_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_004854875.1|5675513_5675918_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|5676222_5676855_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_014839675.1|5676906_5678985_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
WP_014839676.1|5678974_5680195_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014227049.1|5680284_5680848_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
>prophage 395
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5693163	5693991	6174401		Vibrio_phage(100.0%)	1	NA	NA
WP_014227055.1|5693163_5693991_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	1.2e-70
>prophage 396
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5708922	5715729	6174401		Staphylococcus_phage(50.0%)	3	NA	NA
WP_032693746.1|5708922_5710545_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	4.5e-141
WP_014227067.1|5711234_5713328_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_009654839.1|5713338_5715729_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
>prophage 397
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5719219	5719978	6174401		Escherichia_phage(100.0%)	1	NA	NA
WP_004106478.1|5719219_5719978_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.0e-23
>prophage 398
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5722989	5725437	6174401		Dickeya_phage(100.0%)	1	NA	NA
WP_014227071.1|5722989_5725437_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 399
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5743132	5744940	6174401		Enterococcus_phage(50.0%)	2	NA	NA
WP_014227082.1|5743132_5743873_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
WP_025107858.1|5743869_5744940_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 400
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5753279	5754778	6174401		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_004126158.1|5753279_5753993_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
WP_004855045.1|5754010_5754778_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
>prophage 401
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5764038	5769799	6174401		Klosneuvirus(25.0%)	5	NA	NA
WP_014839711.1|5764038_5765304_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	3.7e-26
WP_014839712.1|5765421_5766936_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	1.5e-13
WP_004106554.1|5766968_5767823_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_025106848.1|5768079_5769138_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004106557.1|5769130_5769799_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 402
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5772892	5776958	6174401		Dickeya_phage(50.0%)	4	NA	NA
WP_004855080.1|5772892_5773519_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
WP_032694227.1|5773597_5775802_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.0	4.2e-118
WP_004106582.1|5775880_5776126_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_004126198.1|5776292_5776958_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	6.2e-57
>prophage 403
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5799550	5803657	6174401		Tupanvirus(66.67%)	3	NA	NA
WP_032694218.1|5799550_5801536_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
WP_004126208.1|5801532_5802516_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
WP_004855110.1|5802517_5803657_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
>prophage 404
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5810210	5810981	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_032694213.1|5810210_5810981_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.9	2.5e-17
>prophage 405
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5814148	5815102	6174401		Cedratvirus(100.0%)	1	NA	NA
WP_025106833.1|5814148_5815102_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 406
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5827286	5829329	6174401		Indivirus(100.0%)	1	NA	NA
WP_032694209.1|5827286_5829329_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	1.3e-44
>prophage 407
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5840308	5842386	6174401		Bacillus_phage(100.0%)	2	NA	NA
WP_001157751.1|5840308_5841028_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_004855221.1|5841024_5842386_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
>prophage 408
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5873193	5874306	6174401	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_032694189.1|5873193_5874306_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	88.6	9.4e-191
>prophage 409
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5890406	5896618	6174401		Bacillus_virus(66.67%)	5	NA	NA
WP_050595143.1|5890406_5892518_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	3.3e-35
WP_014227183.1|5892538_5893342_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_032694180.1|5893332_5893911_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_014227185.1|5894624_5895638_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
WP_032694179.1|5895634_5896618_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	2.4e-12
>prophage 410
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5914333	5915305	6174401		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_009652700.1|5914333_5915305_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.4e-17
>prophage 411
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5918663	5920595	6174401		Morganella_phage(50.0%)	2	NA	NA
WP_004126446.1|5918663_5918876_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
WP_014227198.1|5918975_5920595_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.4	2.8e-26
>prophage 412
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5924982	5925978	6174401		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_032692958.1|5924982_5925978_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	6.6e-10
>prophage 413
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5930919	5932461	6174401		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032692959.1|5930919_5932461_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.3e-17
>prophage 414
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5954057	5955899	6174401		Tupanvirus(100.0%)	1	NA	NA
WP_014227224.1|5954057_5955899_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	2.0e-12
>prophage 415
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5973332	5982606	6174401		Rhizobium_phage(20.0%)	9	NA	NA
WP_004106850.1|5973332_5973584_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
WP_032695101.1|5973695_5974127_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014227235.1|5974372_5975917_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_025107808.1|5975926_5977198_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
WP_032695102.1|5977201_5978137_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032695103.1|5978133_5978931_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004855475.1|5979092_5980118_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
WP_032695104.1|5980127_5981321_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	1.7e-36
WP_014227239.1|5981661_5982606_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
>prophage 416
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	5995468	6000207	6174401		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_004106901.1|5995468_5995945_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
WP_014227251.1|5996068_5996878_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
WP_003024094.1|5997077_5997245_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002436699.1|5997265_5997502_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004126657.1|5997718_5998384_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014227252.1|5998559_5999771_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.8	5.8e-45
WP_032695107.1|5999748_6000207_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	62.6	5.3e-47
>prophage 417
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6005774	6010801	6174401		Pseudomonas_phage(33.33%)	4	NA	NA
WP_032695110.1|6005774_6007451_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.0	9.6e-22
WP_004126677.1|6007708_6008332_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
WP_004106927.1|6008386_6008662_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004855514.1|6008680_6010801_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 418
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6021917	6022769	6174401		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004855525.1|6021917_6022769_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 419
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6026374	6027766	6174401		environmental_Halophage(100.0%)	1	NA	NA
WP_004855527.1|6026374_6027766_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 420
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6050019	6055098	6174401		Wolbachia_phage(50.0%)	6	NA	NA
WP_071886348.1|6050019_6051048_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.6	3.8e-77
WP_032695123.1|6051203_6051809_-	shikimate kinase	NA	NA	NA	NA	NA
WP_014227279.1|6051996_6052464_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_032695124.1|6052576_6053584_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004855548.1|6053585_6053888_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014227281.1|6054048_6055098_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
>prophage 421
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6070688	6071855	6174401		Salmonella_phage(100.0%)	1	NA	NA
WP_014227296.1|6070688_6071855_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	6.5e-25
>prophage 422
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6076342	6077308	6174401	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_038423881.1|6076342_6077308_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.0e-68
>prophage 423
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6084594	6085707	6174401		Bacillus_virus(100.0%)	1	NA	NA
WP_014227307.1|6084594_6085707_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.5	8.6e-27
>prophage 424
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6098055	6103397	6174401		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_004855639.1|6098055_6099744_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	6.9e-60
WP_004107123.1|6099846_6099942_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004107126.1|6100523_6100613_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_004855646.1|6100684_6101131_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014227319.1|6101201_6102035_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004855651.1|6102212_6103397_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.9e-12
>prophage 425
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6114793	6115754	6174401		Synechococcus_phage(50.0%)	2	NA	NA
WP_032694291.1|6114793_6115222_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	3.2e-14
WP_004126917.1|6115340_6115754_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
>prophage 426
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6119251	6120400	6174401		Oenococcus_phage(100.0%)	1	NA	NA
WP_014227329.1|6119251_6120400_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	4.7e-52
>prophage 427
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6125832	6133361	6174401		Bacillus_virus(33.33%)	7	NA	NA
WP_004126944.1|6125832_6128247_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
WP_032694288.1|6128275_6129349_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004107206.1|6129497_6130598_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
WP_004871826.1|6130602_6132003_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004871828.1|6132624_6132765_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004871829.1|6132780_6133140_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004871831.1|6133103_6133361_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 428
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6140837	6142175	6174401		Moraxella_phage(100.0%)	1	NA	NA
WP_014839859.1|6140837_6142175_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	36.4	5.8e-62
>prophage 429
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6148054	6155657	6174401		Bacillus_phage(25.0%)	6	NA	NA
WP_004855746.1|6148054_6148828_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
WP_032694282.1|6148875_6149766_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004107261.1|6149765_6150725_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004127017.1|6150917_6151958_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
WP_014227346.1|6152274_6154104_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
WP_032694281.1|6154286_6155657_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	9.6e-36
>prophage 430
NZ_CP017450	Klebsiella sp. LTGPAF-6F chromosome, complete genome	6174401	6170238	6171231	6174401		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_032694277.1|6170238_6171231_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	7.1e-49
>prophage 1
NZ_CP017451	Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence	526446	4708	73929	526446	transposase,protease	Caulobacter_phage(16.67%)	49	NA	NA
WP_004210251.1|4708_5788_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
WP_004181732.1|5789_6563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049125915.1|6555_7698_-	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.0	8.3e-33
WP_016947105.1|7709_8768_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004210240.1|9079_9664_+	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_025368659.1|9660_10812_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|10834_11290_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_012540178.1|11313_12354_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.1e-71
WP_004026609.1|12392_12971_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026611.1|13057_13633_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_023287203.1|13717_14959_+	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_048293672.1|15295_15943_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_049164977.1|16389_17832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012540119.1|17840_18686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257609.1|18838_18967_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012540175.1|19594_19987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049164966.1|20447_21755_-	IQ calmodulin-binding- domain protein	NA	NA	NA	NA	NA
WP_049164965.1|21751_23908_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	40.6	5.7e-35
WP_048293675.1|26743_27955_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_032413259.1|28041_28995_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.3	1.3e-10
WP_004118155.1|29151_30000_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040216852.1|30023_30695_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_040216854.1|30691_31354_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_049162715.1|31358_32177_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.5e-28
WP_048293677.1|32173_33139_+	DMT family transporter	NA	NA	NA	NA	NA
WP_162550804.1|33407_34085_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016530671.1|36372_36651_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	68.2	4.3e-28
WP_004118901.1|37276_38269_-	DsbA family protein	NA	NA	NA	NA	NA
WP_032413277.1|38265_39855_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.0	4.7e-34
WP_048293679.1|39891_41298_-	cytosine permease	NA	NA	NA	NA	NA
WP_001138082.1|42264_45150_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000904906.1|45275_45890_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001082319.1|45955_46759_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|46758_47595_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_048293680.1|49805_51173_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_032413289.1|51271_52033_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_004118884.1|52029_52587_+	HutD family protein	NA	NA	NA	NA	NA
WP_004118873.1|56990_58382_+	cytosine permease	NA	NA	NA	NA	NA
WP_004118868.1|58393_59602_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_004118865.1|59594_60404_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_077255438.1|62676_64275_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.4	8.6e-20
WP_077253754.1|64366_64480_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	4.7e-10
WP_004181719.1|65954_67226_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_032455404.1|67408_67903_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.2	6.1e-17
WP_004181718.1|68013_68832_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_070083037.1|69235_69634_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001567369.1|70220_70853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|70881_72285_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|72396_73929_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
>prophage 2
NZ_CP017451	Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence	526446	85760	145011	526446	transposase,protease	uncultured_Caudovirales_phage(16.67%)	54	NA	NA
WP_000227969.1|85760_86837_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|87378_88887_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_004196338.1|91904_92261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181922.1|93149_93455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196345.1|93505_97474_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004026310.1|97475_98885_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_070083040.1|98874_99912_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_004196331.1|100277_100820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032438005.1|100836_101361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196341.1|101553_102309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|102906_103371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196318.1|103370_104159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045289281.1|104172_107121_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_045289280.1|107110_109237_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_042935923.1|109239_110337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026331.1|110349_111024_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004883400.1|111032_112169_+	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.2	5.7e-10
WP_042935920.1|112171_112945_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	46.7	1.5e-09
WP_042935918.1|112998_113355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042935952.1|113896_114130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042935949.1|114208_114556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045289278.1|114711_115779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094313394.1|115847_116144_-	hydrogenase expression/formation protein HypD	NA	NA	NA	NA	NA
WP_045289277.1|116470_116848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196336.1|117045_118020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181898.1|118625_118784_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000323025.1|118855_119143_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_004196370.1|119142_119382_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
WP_009651956.1|119632_119998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|120041_120779_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_004196322.1|120792_121482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196363.1|121512_122889_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
WP_004196334.1|122845_123823_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_004196359.1|124169_124541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|124603_125524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196325.1|125577_126336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196314.1|126569_127868_+	MFS transporter	NA	NA	NA	NA	NA
WP_004196355.1|127973_128243_+	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196366.1|128255_129386_+	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_032072095.1|129547_129970_+	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196353.1|130225_131566_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|131640_133173_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_070083041.1|134600_134861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083042.1|134971_135442_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004181895.1|135438_135882_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004197886.1|135982_137254_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	5.1e-140
WP_004181893.1|137253_137676_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
WP_167877429.1|139170_140399_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	89.4	4.7e-159
WP_070083044.1|140591_141590_+	nitrilase family protein	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	36.4	1.5e-14
WP_033128602.1|141677_142076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077270230.1|142086_142383_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_070083045.1|142505_143537_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_023283488.1|143609_144209_-	LysE family translocator	NA	NA	NA	NA	NA
WP_070083046.1|144402_145011_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.0	4.0e-26
>prophage 3
NZ_CP017451	Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence	526446	151615	200531	526446	transposase	Stx2-converting_phage(35.71%)	40	NA	NA
WP_070083054.1|151615_153154_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
WP_070083055.1|153874_155077_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_070083056.1|155084_155765_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	34.7	2.9e-25
WP_021571251.1|156024_157074_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172970609.1|157324_158491_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060544634.1|158505_159186_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.7e-30
WP_060544649.1|159201_160659_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	1.4e-21
WP_060544635.1|160723_161203_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_060544636.1|161180_161942_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_060544637.1|161951_162536_+	flavodoxin	NA	NA	NA	NA	NA
WP_070083058.1|162643_163708_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060544639.1|163951_164803_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.6	1.5e-47
WP_070083059.1|164829_165819_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060544641.1|165853_166747_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060544642.1|166895_167681_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001067855.1|167911_168616_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_070083060.1|169549_169903_+	glycerol dehydratase reactivase beta/small subunit family protein	NA	NA	NA	NA	NA
WP_070083061.1|169903_170434_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_070083109.1|170411_172337_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_070083062.1|172426_173524_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_016243888.1|174084_175743_+	glycerone kinase	NA	NA	NA	NA	NA
WP_047935058.1|175783_176938_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.4	3.9e-83
WP_000349485.1|177625_177940_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070083063.1|178051_179086_+	permease	NA	NA	NA	NA	NA
WP_070083064.1|179098_180376_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	6.1e-85
WP_070083065.1|180542_180776_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_077270243.1|180863_181799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944388.1|181851_182067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165821571.1|182078_182222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944385.1|182223_182937_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_042944383.1|183197_184073_-	GTPase family protein	NA	NA	NA	NA	NA
WP_077270231.1|184352_184736_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.9	4.6e-12
WP_032670757.1|186530_189293_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	32.1	4.8e-119
WP_032669192.1|189307_191353_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_032416088.1|191345_192524_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015632445.1|193106_193514_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_032414478.1|193510_193861_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_060415438.1|193890_195480_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.1	1.8e-182
WP_040210162.1|198394_199474_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
WP_001567384.1|199526_200531_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017451	Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence	526446	242585	298358	526446	integrase,transposase	Enterobacteria_phage(22.22%)	54	288772:288831	303041:303232
WP_148722765.1|242585_243812_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	82.1	1.3e-145
WP_004196657.1|244579_245758_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	33.0	9.1e-19
WP_070083074.1|245885_246650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386506.1|246705_247374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032437932.1|247518_247833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026504.1|248648_249017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024198097.1|249118_249421_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_004196647.1|249439_250300_+	traE family protein	NA	NA	NA	NA	NA
WP_004026506.1|250301_251471_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_014386508.1|251467_251986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437928.1|251945_253316_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_004181799.1|253318_253783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368610.1|253785_254637_+	disulfide isomerase	NA	NA	NA	NA	NA
WP_004181797.1|254646_255384_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_004196678.1|255428_258146_+	TraC family protein	NA	NA	NA	NA	NA
WP_014386510.1|258172_258589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196661.1|258560_259061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040209781.1|259047_259764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386512.1|259753_260557_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_004196672.1|261240_261699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437918.1|261673_262078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181791.1|262065_262602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083075.1|262729_266971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026522.1|267108_267633_+	signal peptidase I	NA	NA	NA	NA	NA
WP_070083076.1|267619_268981_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_070083077.1|268977_270015_+	IncHI-type conjugal transfer protein TrhU	NA	NA	NA	NA	NA
WP_070083078.1|270024_273210_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_064794295.1|273258_274107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040209642.1|275806_276994_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.0	3.5e-143
WP_077257669.1|277029_277458_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.6	1.6e-34
WP_040209639.1|278031_279258_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	76.9	1.7e-153
WP_004181778.1|279411_279696_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_004181777.1|279685_279934_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181776.1|280224_282024_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.1	1.8e-26
WP_025368599.1|282357_283344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|283488_283842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181772.1|283903_284725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181771.1|284752_285805_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_070083079.1|285900_286977_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_070082752.1|287914_288895_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
288772:288831	attL	CGATGACAGCGGTCATATTCTGCCATGGCAGAATCTGCTCCATGCGGGAGAGGAAAATCT	NA	NA	NA	NA
WP_077270233.1|289446_290223_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004181768.1|290294_290525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|290635_291880_+	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181766.1|291948_292488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|292632_292851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181764.1|292843_293452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|293438_293681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|293728_294193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|294202_294610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083082.1|294652_295612_+	DNA replication protein	NA	NA	NA	NA	NA
WP_070083083.1|295608_296367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186935.1|296363_296687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026552.1|296838_297156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186933.1|297221_298358_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
303041:303232	attR	CGATGACAGCGGTCATATTCTGCCATGGCAGAATCTGCTCCATGCGGGAGAGGAAAATCTCTTTTCGGGTCTGACGGCGCTTAGTGCTGAATTCACTATCGGCGAAGGTGAGTTGATGGCTCATGATGTCCCTCTGGGATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCC	NA	NA	NA	NA
>prophage 5
NZ_CP017451	Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence	526446	302272	358795	526446	integrase,transposase	Escherichia_phage(50.0%)	55	306737:306796	334765:335584
WP_001067855.1|302272_302977_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016241603.1|303563_303854_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_070083085.1|304026_305007_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.2	5.7e-184
WP_023336801.1|305364_306528_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
306737:306796	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_059331711.1|306799_307504_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_071532009.1|307394_308294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372351.1|308427_309522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000174662.1|309541_310306_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.4	1.9e-25
WP_000182008.1|310770_311448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071437.1|311478_312102_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_070083086.1|312632_313328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077270244.1|313503_313761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981293.1|313787_314615_-	ParA family protein	NA	J9QE36	Clostridium_phage	27.4	2.0e-12
WP_000151478.1|314793_315729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646501.1|316623_316953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215804.1|319474_322162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270901.1|322313_323144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954987.1|323259_323448_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_070082752.1|323989_324970_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
WP_001120775.1|325772_326048_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842119.1|326106_327216_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.3	1.8e-32
WP_000070400.1|327266_327665_+	VOC family protein	NA	NA	NA	NA	NA
WP_000664785.1|327822_329157_+	DUF3422 family protein	NA	NA	NA	NA	NA
WP_000440264.1|329204_330035_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000233327.1|330052_331363_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000038427.1|331566_334218_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.8	2.1e-156
WP_070083089.1|334409_334781_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_059331711.1|334827_335532_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001141269.1|336033_336309_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
334765:335584	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGGCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_007372360.1|336994_338146_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000859348.1|338306_338453_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_007372361.1|338478_339489_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_007372362.1|339488_340898_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_007372363.1|341877_342258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372364.1|342789_343080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057068510.1|343076_343697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|343687_344392_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_070083090.1|344425_344998_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	87.8	8.3e-50
WP_003132006.1|345128_346118_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003132004.1|346114_346351_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995360.1|346347_346713_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003156770.1|346730_348416_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	5.5e-41
WP_003131987.1|348487_348763_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003131974.1|348775_349126_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131969.1|349197_349632_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427623.1|349710_350715_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001247892.1|352649_352940_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|352936_353338_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|353327_353684_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|353938_354253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057066695.1|354425_354959_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	4.4e-21
WP_012561144.1|354958_355954_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_012561145.1|355995_357156_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_176551401.1|357155_358043_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_059331711.1|358090_358795_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
>prophage 6
NZ_CP017451	Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence	526446	368989	481649	526446	lysis,integrase,transposase,protease	uncultured_Caudovirales_phage(35.71%)	110	397743:397757	419347:419361
WP_096913407.1|368989_370191_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	82.2	4.3e-141
WP_070083093.1|370506_371448_-	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_070083094.1|371652_372990_+	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_077270236.1|374328_374781_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_070083096.1|375123_376725_-	carboxylesterase family protein	NA	H2EFI1	Moumouvirus	31.3	3.2e-43
WP_000149830.1|378277_379234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004201.1|379497_379773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578891.1|379817_380408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371933.1|380415_380673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107167.1|380746_381283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001424628.1|381362_381746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119428.1|381836_382799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198595.1|382808_383714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795949.1|384015_385191_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|385360_385573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|385933_387016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|387181_388681_-	kinase	NA	NA	NA	NA	NA
WP_000081060.1|388706_390344_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|390343_391384_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|391468_392107_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|392106_392748_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|392770_393409_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|393871_394339_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|394356_395565_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|395575_396532_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|396531_397611_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|397612_398386_-	hypothetical protein	NA	NA	NA	NA	NA
397743:397757	attL	ACTCCGCGTTCAGCC	NA	NA	NA	NA
WP_001280115.1|398378_399521_-	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|399530_400589_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254137.1|400909_401491_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|401490_402648_+	TerD family protein	NA	NA	NA	NA	NA
WP_070083097.1|402670_403180_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|403148_404189_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|404237_404816_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|404884_405460_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|405888_407130_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000374058.1|407220_407676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|407916_408108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|408199_408541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|409527_409782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|410441_411446_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_010981353.1|411524_411959_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_077269372.1|411888_412242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761850.1|412256_412895_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|413006_413372_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_005413392.1|413368_413605_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010981356.1|413620_413941_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_010981357.1|413979_414594_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_011405615.1|414654_415872_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|415868_416777_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_010791757.1|416779_418462_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_059331711.1|418760_419465_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
419347:419361	attR	ACTCCGCGTTCAGCC	NA	NA	NA	NA
WP_070083098.1|419826_421509_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	3.8e-10
WP_000156887.1|421884_422907_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032951231.1|423412_424891_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	8.4e-195
WP_032951234.1|424908_425736_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	39.9	4.1e-50
WP_032951236.1|425817_426021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048213841.1|426452_427661_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	2.4e-46
WP_070083099.1|427651_427852_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032951239.1|427865_428867_-	permease	NA	NA	NA	NA	NA
WP_050593601.1|429023_429533_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_025714552.1|429683_429866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714553.1|429984_430338_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	2.6e-22
WP_032951254.1|430394_430874_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	52.6	1.5e-36
WP_032951256.1|430898_431264_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_032951359.1|431287_433054_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_032951259.1|433094_434384_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	6.2e-170
WP_025714558.1|434441_434870_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.2e-50
WP_032951261.1|434942_435437_+	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	40.4	1.7e-14
WP_101677559.1|435575_436088_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_032951263.1|436365_437379_+	permease	NA	NA	NA	NA	NA
WP_032951265.1|437481_437805_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032951268.1|437813_438536_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.2	1.1e-96
WP_071698676.1|438773_439148_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	9.9e-28
WP_032951272.1|439231_440521_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	54.7	1.1e-123
WP_009652877.1|440537_440963_-	universal stress protein	NA	NA	NA	NA	NA
WP_032951275.1|440959_441868_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_032951277.1|444474_444903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032951278.1|444943_445375_+	membrane protein	NA	NA	NA	NA	NA
WP_009652868.1|445411_446209_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032951283.1|446676_446997_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_009652880.1|446971_447433_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
WP_109739841.1|447620_448016_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_009652867.1|448130_448607_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
WP_032951288.1|448908_449259_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009652879.1|449419_451078_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032951290.1|453101_453842_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_007372374.1|453851_454475_-	formylmethanofuran dehydrogenase subunit E	NA	NA	NA	NA	NA
WP_009651828.1|456477_456849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007372378.1|456868_457681_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_009651826.1|457795_458437_-	recombinase family protein	NA	NA	NA	NA	NA
WP_070083100.1|458604_461670_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.1e-295
WP_000156887.1|461666_462689_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_187418277.1|463003_463792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|463982_464867_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_004210306.1|466094_466577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083101.1|466819_467134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004210286.1|468109_468322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083102.1|468415_468694_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001567384.1|469040_470045_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_077270239.1|470405_470825_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_032435791.1|470907_472971_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_023313931.1|473027_473288_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_025861851.1|473384_473756_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_077260979.1|473814_474048_-	Hin recombinase	NA	NA	NA	NA	NA
WP_000427623.1|474409_475414_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_071561715.1|476066_476222_-|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_119735215.1|477793_478810_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_001572339.1|479140_480319_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_119735215.1|480632_481649_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
>prophage 1
NZ_CP017452	Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence	89552	12519	52147	89552	integrase,transposase	Escherichia_phage(26.67%)	40	35581:35598	45989:46006
WP_001067855.1|12519_13224_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_005012528.1|13698_14913_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|14946_16350_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_040118526.1|16882_17467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118421.1|17515_18541_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_040118421.1|19153_20179_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_077255425.1|20413_21382_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	3.4e-181
WP_001067855.1|24428_25133_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_021312768.1|25320_25737_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_021312767.1|25733_25964_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006788213.1|26591_26810_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_006788214.1|26811_27117_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_016240356.1|28523_29318_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
WP_006788217.1|29733_29913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946792.1|30032_30659_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.2e-40
WP_004098982.1|31235_32111_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_064357922.1|32522_33794_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	2.9e-151
WP_006796638.1|33793_34225_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
35581:35598	attL	TGTTCAAATATGAACATT	NA	NA	NA	NA
WP_064357924.1|35667_35916_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	50.7	2.1e-10
WP_096807527.1|36601_37279_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	50.5	1.1e-21
WP_032440558.1|37519_38494_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	7.2e-86
WP_032440559.1|38496_38940_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_032440579.1|39381_39627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440560.1|39619_40117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440561.1|40234_40684_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_023285835.1|40728_40995_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023285836.1|41637_41817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083113.1|41889_42750_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
WP_004187354.1|42939_43278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070083114.1|43375_43606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_177952325.1|43904_44141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187342.1|44225_44636_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_004187339.1|44697_45003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187338.1|45203_45644_+	antirestriction protein	NA	NA	NA	NA	NA
WP_032440566.1|45687_45972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064357929.1|47480_47801_+	hypothetical protein	NA	NA	NA	NA	NA
45989:46006	attR	AATGTTCATATTTGAACA	NA	NA	NA	NA
WP_058674280.1|48092_48512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162079.1|48801_49113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064357930.1|49115_51044_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_064357932.1|51193_52147_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.5e-75
