The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015934	Legionella pneumophila strain C3_O chromosome, complete genome	3453407	957202	964042	3453407		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|957202_957979_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|957971_959006_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|958983_959562_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|959595_960321_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|960317_960827_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|960807_961377_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|961373_961901_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|961914_962877_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|963244_964042_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015934	Legionella pneumophila strain C3_O chromosome, complete genome	3453407	1346674	1352611	3453407		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1346674_1347748_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1347732_1348347_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1348343_1349552_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1349559_1350027_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1350152_1351790_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1351786_1352611_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015934	Legionella pneumophila strain C3_O chromosome, complete genome	3453407	2256149	2266273	3453407		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2256149_2257838_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2257969_2258977_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2259100_2260426_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2260444_2261593_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2261801_2262914_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2263009_2264149_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2264338_2266273_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015934	Legionella pneumophila strain C3_O chromosome, complete genome	3453407	2308101	2363125	3453407	integrase,transposase	Wolbachia_phage(25.0%)	53	2316359:2316374	2366903:2366918
WP_010947782.1|2308101_2309553_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_070065721.1|2309623_2311144_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2311991_2312366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2312563_2314171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2314173_2314665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2314675_2315512_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2316104_2317196_-	DUF4917 family protein	NA	NA	NA	NA	NA
2316359:2316374	attL	AAGTAGATAAAGCATT	NA	NA	NA	NA
WP_010947790.1|2317427_2323373_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2323393_2325286_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2325350_2325815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2325818_2328539_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2328544_2329930_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2329926_2330349_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2330338_2331121_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2331113_2332925_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2332924_2333593_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2333608_2334604_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2334600_2335209_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_027223818.1|2335205_2335547_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2335533_2338086_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2338097_2338448_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2338461_2339748_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2339749_2340463_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2340465_2341029_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2341032_2341326_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2341327_2341630_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2341644_2341881_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2341894_2342272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2342219_2343104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2343276_2343957_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2344105_2344780_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2345228_2345801_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2345784_2346282_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2346274_2346862_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2346866_2349002_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2349020_2349902_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2350008_2350155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2350346_2350523_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2350692_2351190_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2351179_2351959_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2351951_2352806_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2352820_2353114_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2353303_2353825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2354129_2354588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2355161_2355389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2355546_2356068_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2356239_2356794_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2357227_2357428_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2357521_2357905_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2357958_2358912_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2359421_2360840_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2360872_2362048_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_070065730.1|2362081_2363125_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2366903:2366918	attR	AAGTAGATAAAGCATT	NA	NA	NA	NA
>prophage 5
NZ_CP015934	Legionella pneumophila strain C3_O chromosome, complete genome	3453407	2666316	2723541	3453407	integrase,protease,transposase	Erysipelothrix_phage(25.0%)	52	2666180:2666226	2722212:2722258
2666180:2666226	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2666316_2667444_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2667824_2668010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2668002_2668779_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2668912_2669728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2669769_2671080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2671209_2672691_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2672844_2673087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2673321_2673516_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2673543_2676819_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2676811_2677474_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2677493_2679449_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2679466_2682499_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2682574_2684374_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2684370_2685054_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2685255_2686140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2686159_2686471_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2686487_2686760_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2686787_2687753_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2687764_2688142_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2688138_2688438_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2688434_2690969_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2690965_2691664_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2691660_2692536_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2692538_2692946_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2692951_2694199_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2694210_2694951_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2694973_2695186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2695190_2696573_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2696569_2698459_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2698455_2699001_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2698997_2699162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2699154_2701341_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2701470_2703066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070065722.1|2703375_2705238_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2705234_2705588_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2705981_2706326_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2706325_2707051_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2707050_2707488_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2707735_2708797_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2709219_2710854_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2710808_2711201_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2711682_2711925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2712167_2714108_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2714187_2715039_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2715035_2715644_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2716451_2716856_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2716813_2716939_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2717063_2718116_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2718122_2719340_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2719369_2720416_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2720417_2721482_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2722365_2723541_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2722212:2722258	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
