The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015925	Legionella pneumophila strain E10_P chromosome, complete genome	3415559	921019	927859	3415559		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|921019_921796_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|921788_922823_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|922800_923379_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|923412_924138_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|924134_924644_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|924624_925194_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|925190_925718_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|925731_926694_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|927061_927859_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015925	Legionella pneumophila strain E10_P chromosome, complete genome	3415559	1310416	1316353	3415559		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1310416_1311490_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1311474_1312089_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1312085_1313294_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1313301_1313769_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1313894_1315532_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1315528_1316353_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015925	Legionella pneumophila strain E10_P chromosome, complete genome	3415559	2219891	2230015	3415559		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2219891_2221580_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2221711_2222719_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2222842_2224168_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2224186_2225335_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_070065786.1|2225543_2226656_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	1.9e-50
WP_010947740.1|2226751_2227891_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2228080_2230015_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015925	Legionella pneumophila strain E10_P chromosome, complete genome	3415559	2271843	2326868	3415559	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2271843_2273295_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2273365_2274886_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2275733_2276108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2276305_2277913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2277915_2278407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2278417_2279254_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2279846_2280938_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2281169_2287115_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2287135_2289028_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2289092_2289557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2289560_2292281_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2292286_2293672_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2293668_2294091_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2294080_2294863_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2294855_2296667_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2296666_2297335_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2297350_2298346_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2298342_2298951_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2298947_2299283_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2299275_2301828_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2301839_2302190_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2302203_2303490_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2303491_2304205_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2304207_2304771_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2304774_2305068_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2305069_2305372_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2305386_2305623_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2305636_2306014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2305961_2306846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2307018_2307699_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2307847_2308522_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2308970_2309543_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2309526_2310024_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2310016_2310604_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2310608_2312744_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2312762_2313644_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2313750_2313897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2314088_2314265_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2314434_2314932_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2314921_2315701_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2315693_2316548_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2316562_2316856_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2317045_2317567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2317871_2318330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2318903_2319131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2319288_2319810_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2319981_2320536_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2320969_2321170_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2321263_2321647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2321700_2322654_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2323163_2324582_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2324614_2325790_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2325842_2326868_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015925	Legionella pneumophila strain E10_P chromosome, complete genome	3415559	2624016	2687285	3415559	tRNA,integrase,protease,transposase	Erysipelothrix_phage(18.75%)	57	2629924:2629970	2685956:2686002
WP_010948063.1|2624016_2625018_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2625222_2625462_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2625664_2626108_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2626116_2627850_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2627936_2629802_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2629924:2629970	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2630060_2631188_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2631568_2631754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2631746_2632523_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2632656_2633472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2633513_2634824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2634953_2636435_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2636588_2636831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2637065_2637260_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2637287_2640563_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2640555_2641218_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2641237_2643193_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2643210_2646243_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2646318_2648118_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2648114_2648798_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2648999_2649884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2649903_2650215_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2650231_2650504_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2650531_2651497_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2651508_2651886_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2651882_2652182_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2652178_2654713_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2654709_2655408_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2655404_2656280_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2656282_2656690_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2656695_2657943_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2657954_2658695_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2658717_2658930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2658934_2660317_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2660313_2662203_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2662199_2662745_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2662741_2662906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2662898_2665085_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2665214_2666810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2667119_2668982_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2668978_2669332_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2669725_2670070_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2670069_2670795_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2670794_2671232_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2671479_2672541_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2672963_2674598_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2674552_2674945_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2675426_2675669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2675911_2677852_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2677931_2678783_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2678779_2679388_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2680195_2680600_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2680557_2680683_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2680807_2681860_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2681866_2683084_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2683113_2684160_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2684161_2685226_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2686109_2687285_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2685956:2686002	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
