The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011510	Mycobacterium tuberculosis strain Beijing, complete genome	4378588	225441	270470	4378588	transposase,integrase,tRNA	Burkholderia_virus(33.33%)	48	242571:242589	260574:260592
WP_003899508.1|225441_227190_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003414522.1|227190_227679_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_003414516.1|227675_228221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899507.1|228415_228967_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003414511.1|228963_230007_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003414510.1|230133_230433_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003899505.1|230518_233221_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
WP_003414508.1|233220_233772_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003905944.1|233746_234757_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003414506.1|234763_236083_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003414505.1|236169_237081_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003414504.1|237077_237905_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003414501.1|237907_239218_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003414499.1|239210_240293_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
WP_003902358.1|240371_241121_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003414495.1|241167_241383_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003414492.1|241379_241772_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003912856.1|241792_242062_+	DUF2277 family protein	NA	NA	NA	NA	NA
WP_014584866.1|242058_242604_+	DUF1802 family protein	NA	NA	NA	NA	NA
242571:242589	attL	GGTCGCCGCCCGGGTCCGC	NA	NA	NA	NA
WP_003899496.1|242781_243726_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_003900580.1|243722_246161_+	type III-A CRISPR-associated protein Cas10/Csm1	NA	NA	NA	NA	NA
WP_003414296.1|246157_246532_+	type III-A CRISPR-associated protein Csm2	NA	NA	NA	NA	NA
WP_069984899.1|246541_247252_+	type III-A CRISPR-associated RAMP protein Csm3	NA	NA	NA	NA	NA
WP_087902221.1|247615_248877_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_087902221.1|249506_250768_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899491.1|251635_252448_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003414198.1|252444_253854_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003414195.1|253924_254533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414190.1|254952_255264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899489.1|255368_255626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899488.1|255859_257014_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003414184.1|257212_257404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414181.1|257400_257805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003917684.1|257952_258207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003911993.1|258382_258658_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003414172.1|258848_259892_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_003901465.1|259934_260165_+	antitoxin MazE	NA	NA	NA	NA	NA
WP_003414166.1|260148_260505_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003899485.1|260606_262256_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
260574:260592	attR	GGTCGCCGCCCGGGTCCGC	NA	NA	NA	NA
WP_003414158.1|262274_262904_-	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
WP_003414157.1|263034_263361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414155.1|263364_265053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900574.1|265052_265616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003414151.1|265760_266735_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003414149.1|266731_267415_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_003414147.1|267411_268308_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003414146.1|268509_269091_+|transposase	IS607-like element IS1602 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
WP_003899482.1|269090_270470_+|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
>prophage 2
NZ_CP011510	Mycobacterium tuberculosis strain Beijing, complete genome	4378588	385823	398569	4378588	capsid,protease,head,terminase,integrase	Mycobacterium_phage(57.14%)	21	389480:389507	399104:399131
WP_003413845.1|385823_386582_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
WP_003899423.1|387497_387779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085334930.1|387956_388130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413719.1|388126_388381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413717.1|388391_388625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900544.1|388723_388996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079121809.1|388901_389291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899421.1|389287_389515_+	hypothetical protein	NA	NA	NA	NA	NA
389480:389507	attL	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
WP_003899420.1|389659_390787_+|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
WP_003900543.1|390789_391152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899418.1|391168_391429_+	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003899417.1|391425_391818_+	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899416.1|391819_393247_+	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899415.1|393243_393489_+	antitoxin	NA	NA	NA	NA	NA
WP_003899414.1|393568_393892_+	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899413.1|393923_394550_+|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899412.1|394702_395236_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003901443.1|395243_396683_+|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003908028.1|396853_397105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900539.1|397092_397557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|397570_398569_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
399104:399131	attR	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
