The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	118792	127535	4830073	integrase	Morganella_phage(50.0%)	12	109197:109210	132163:132176
109197:109210	attL	GTGCTCCCCGCCAT	NA	NA	NA	NA
WP_001355493.1|118792_121144_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.2	2.2e-72
WP_001058745.1|121156_121759_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.9	3.6e-27
WP_000181940.1|121751_121973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|121969_122233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|122229_122424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001419054.1|122416_123484_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_000476150.1|123477_123660_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001395037.1|123652_124486_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	48.3	1.8e-21
WP_000412532.1|124498_124930_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_024169704.1|124929_125148_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001059729.1|125619_126270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355495.1|126266_127535_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	2.3e-193
132163:132176	attR	ATGGCGGGGAGCAC	NA	NA	NA	NA
>prophage 2
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	1103901	1117082	4830073		Escherichia_phage(50.0%)	11	NA	NA
WP_001295182.1|1103901_1104663_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1104656_1105283_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1105422_1106562_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1106624_1107617_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001136934.1|1109161_1109938_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1109942_1110581_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1110577_1111840_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1111836_1112745_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1112940_1113708_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1113758_1114415_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272895.1|1114520_1117082_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 3
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	1314872	1351461	4830073	tail,holin,integrase	Escherichia_phage(58.97%)	44	1317971:1317987	1349607:1349623
WP_001299507.1|1314872_1316339_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|1316407_1317985_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1317971:1317987	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000954554.1|1318177_1319428_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.8	8.8e-238
WP_001077941.1|1319431_1319626_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	100.0	1.9e-27
WP_000163467.1|1319622_1320273_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	98.6	5.6e-127
WP_001335975.1|1320265_1320517_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|1320674_1320923_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_044316667.1|1320972_1321914_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.4	1.1e-176
WP_044316666.1|1321910_1322732_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	98.9	5.2e-162
WP_044316665.1|1322728_1323028_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.7e-46
WP_001198620.1|1323030_1323183_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_000836293.1|1323336_1323921_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001282457.1|1324075_1324306_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
WP_000402896.1|1324456_1324657_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001559621.1|1324672_1325488_+	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	96.4	3.2e-119
WP_001406039.1|1325484_1326270_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_047608207.1|1326502_1326700_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	98.4	1.7e-07
WP_000852414.1|1326714_1328394_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000133160.1|1328390_1328687_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_044316663.1|1328689_1329385_+	peptidase	NA	G9L6C4	Escherichia_phage	98.3	1.9e-93
WP_044316662.1|1329399_1330386_+	phage protein	NA	G9L6C5	Escherichia_phage	98.8	1.4e-185
WP_044316661.1|1330437_1330875_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	93.1	3.6e-69
WP_044316660.1|1330885_1331221_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	3.8e-55
WP_000424489.1|1331271_1331595_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
WP_000179261.1|1331594_1332200_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	100.0	2.1e-112
WP_044316659.1|1334370_1336884_+	bacteriophage protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.7	0.0e+00
WP_044316658.1|1336880_1338683_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
WP_044316657.1|1338688_1341163_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	95.6	0.0e+00
WP_024203028.1|1341359_1341656_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	5.6e-50
WP_000708858.1|1341687_1341849_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000671196.1|1341942_1342386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000125783.1|1342406_1342574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095033715.1|1342667_1343282_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	85.4	3.1e-95
WP_044316655.1|1343277_1343562_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_044316654.1|1343754_1344483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546908.1|1344505_1344763_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_044316653.1|1347706_1348111_+	membrane protein	NA	G9L6E6	Escherichia_phage	91.0	2.0e-58
WP_001546697.1|1348097_1348406_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_025651158.1|1348395_1349025_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	2.0e-113
WP_044316652.1|1349021_1349519_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	65.8	2.3e-48
WP_000755173.1|1349713_1350253_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
1349607:1349623	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_001295476.1|1350268_1350787_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|1351099_1351291_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|1351308_1351461_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 4
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	1747390	1756831	4830073		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1747390_1748317_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783115.1|1748321_1749053_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1749033_1749141_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1749200_1749932_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1750153_1751839_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1751835_1752555_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1752601_1753072_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1753111_1753573_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001355588.1|1753697_1755698_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001333512.1|1755694_1756831_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 5
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	1885246	1936305	4830073	plate,transposase,capsid,tail,holin	Burkholderia_virus(34.04%)	67	NA	NA
WP_001295213.1|1885246_1886269_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001297096.1|1886268_1887048_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000132739.1|1887271_1887463_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001751388.1|1888720_1890559_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.7	9.6e-249
WP_001334102.1|1890583_1890952_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	2.9e-64
WP_000821222.1|1891090_1891510_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_000090241.1|1891526_1891778_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000677939.1|1891868_1892030_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_001084293.1|1892098_1893001_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	99.3	1.8e-171
WP_094323891.1|1896403_1897632_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_032145576.1|1897705_1898869_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	9.7e-223
WP_001394439.1|1898987_1899461_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200905.1|1899658_1900717_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1900888_1901218_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_024169664.1|1901318_1901501_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_000904922.1|1902049_1902622_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_074483020.1|1902681_1903170_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.4	1.3e-43
WP_014639621.1|1903178_1903640_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072167.1|1903646_1904261_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_077890482.1|1904260_1906192_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.8	4.1e-40
WP_000138756.1|1906194_1906773_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219102.1|1906765_1907869_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000859111.1|1907859_1908207_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_044316705.1|1908261_1908858_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	2.4e-36
WP_000808006.1|1908854_1910009_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	3.2e-85
WP_000478224.1|1909996_1910209_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_044316706.1|1910208_1911093_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	3.1e-51
WP_044316887.1|1911092_1914044_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	5.4e-84
WP_085959828.1|1914119_1914278_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084214.1|1914201_1914537_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_021537392.1|1914634_1914916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173424385.1|1914918_1915443_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.1	2.3e-67
WP_001555964.1|1915439_1916867_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.1	1.0e-213
WP_000666499.1|1916856_1917108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1917107_1917572_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1917571_1918018_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_044316889.1|1918019_1918358_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1918367_1919321_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1919335_1920451_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1920665_1921124_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_044316707.1|1921126_1921948_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	9.0e-98
WP_000090680.1|1921928_1923422_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	60.1	2.3e-168
WP_044316708.1|1923421_1924945_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	1.1e-184
WP_000533684.1|1924941_1925484_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|1925486_1925798_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|1925797_1926124_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_001299256.1|1926120_1926732_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_001104438.1|1926760_1927498_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|1927500_1927851_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|1927981_1928725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|1928700_1929102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1929103_1929319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1929509_1930274_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1930390_1930747_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1930840_1931029_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1931081_1931390_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1931400_1932321_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000631819.1|1932482_1932713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123379.1|1932702_1932918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573929.1|1932910_1933360_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_001281696.1|1933331_1933730_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_000460689.1|1933844_1934477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001571575.1|1934480_1934642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1934862_1934976_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988599.1|1934988_1935183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285585.1|1935641_1936010_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|1936083_1936305_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 6
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	1988706	2052403	4830073	tail,plate,transposase,integrase	Enterobacteria_phage(62.5%)	68	2008484:2008543	2061812:2061936
WP_001355499.1|1988706_1989915_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_000334609.1|1989954_1990626_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000789493.1|1990734_1990968_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118901.1|1990964_1992170_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|1992356_1992770_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|1992803_1994291_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015023.1|1994368_1994734_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000287768.1|1994733_1995144_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146098.1|1995158_1996571_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079829.1|1996825_1998400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087467.1|1998564_1999284_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001301374.1|1999329_1999881_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001295643.1|1999968_2000769_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128219.1|2000873_2001860_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2001874_2002543_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|2002539_2003292_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001154273.1|2003521_2004244_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2004311_2004536_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001302050.1|2004522_2004699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611338.1|2004994_2005651_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2005647_2007480_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2007536_2008085_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2008484:2008543	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_071529678.1|2009079_2009361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|2009550_2009691_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|2009880_2010141_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|2010183_2011293_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_001397420.1|2011450_2012635_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	5.8e-223
WP_000290450.1|2012634_2013147_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2013201_2013567_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333495.1|2013575_2013731_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_001394249.1|2013717_2016525_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.6	0.0e+00
WP_000979954.1|2016537_2017026_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_001418511.1|2017206_2017752_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_001397298.1|2017715_2018333_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.3	1.3e-85
WP_001397297.1|2018332_2020990_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.1	1.4e-280
WP_024170200.1|2021000_2021528_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	87.0	4.0e-83
WP_001372397.1|2021520_2021793_-|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.9	5.5e-44
WP_044307800.1|2023507_2026330_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000599382.1|2026336_2026702_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_157835959.1|2026698_2027316_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	2.3e-05
WP_000104305.1|2027327_2027627_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001397288.1|2027623_2027890_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	4.4e-30
WP_000985157.1|2027886_2028090_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000021655.1|2028623_2028737_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514274.1|2028733_2028976_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_001397286.1|2028987_2029266_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	4.8e-35
WP_001397285.1|2029276_2029627_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	80.2	7.3e-49
WP_000014504.1|2029648_2029852_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2029923_2030061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2030151_2030556_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|2030571_2031222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2031251_2031599_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2031604_2032606_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000440337.1|2032867_2033749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172375.1|2033829_2035029_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000054834.1|2035454_2035769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|2035794_2036328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001194747.1|2036400_2036835_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_000710651.1|2037445_2038264_-	DUF726 domain-containing protein	NA	NA	NA	NA	NA
WP_000515817.1|2038325_2039228_-	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	31.5	9.7e-37
WP_000173147.1|2040010_2041108_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779018.1|2041104_2041788_+	YecA family protein	NA	NA	NA	NA	NA
WP_001077331.1|2041840_2045125_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	4.7e-65
WP_001290569.1|2045121_2045877_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001419185.1|2046534_2047986_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000995973.1|2047978_2050021_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001751359.1|2050601_2051381_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_001295213.1|2051380_2052403_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
2061812:2061936	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	2394806	2414352	4830073	transposase	Salmonella_phage(28.57%)	19	NA	NA
WP_000041677.1|2394806_2397233_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001300836.1|2397431_2397737_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2397844_2398555_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2398557_2399118_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2399152_2399494_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2399628_2399955_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001355548.1|2400160_2401375_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_001394316.1|2401386_2402406_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|2402463_2402592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876998.1|2402593_2403874_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	7.8e-157
WP_032338454.1|2403908_2404124_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	1.7e-11
WP_040036049.1|2405009_2407466_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_149025660.1|2407537_2408699_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000887491.1|2409815_2410028_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001325325.1|2410486_2410765_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_001265274.1|2410766_2411816_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_001204786.1|2411833_2412211_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	6.9e-53
WP_000836768.1|2413936_2414170_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2414238_2414352_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 8
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	3436496	3446114	4830073	lysis,integrase	Enterobacteria_phage(66.67%)	15	3423529:3423588	3447898:3448666
3423529:3423588	attL	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_000235988.1|3436496_3437201_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_000654156.1|3437210_3437492_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001395371.1|3437488_3438181_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000453611.1|3438591_3439137_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|3439525_3439720_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|3440079_3440373_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3440463_3440646_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|3440862_3441360_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|3441359_3441575_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737293.1|3442163_3443246_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
WP_001204791.1|3443435_3443819_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001393963.1|3443904_3444045_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001099705.1|3444041_3444404_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000488419.1|3444473_3444752_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000051902.1|3444950_3446114_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
3447898:3448666	attR	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGTGACTTCCGTCCCAGCCTTGCCAGATGTTGTCTCAGATTCAGATTATGTCGCTCAATGCGCTGAGTGTAACGCTTGCTGATAACGTGCAGCTTTCCCTTCAGGCGTGATTCATACAGCGGCCAGCCATCCGTCATCCATACCACGACCTCAAAGGCCGACAGCAGGCTCAGAAGACGCGCCAGTGTGGCCAGAGTGCGTTCACCGAAAACGTGCGCCACAACTGTCCTCCGTATCCTGTCATACGCGTAAAACAGCCAGCGCTGACGTGATTTAGCACCGACGTAGCCCCACTGTTCGTCCATTTCCGCGCAGACAATCACATCACTGCCCGGTTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAACCGTGTTGAGGCCAACGCCCATAATGCGGGCAGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCC	NA	NA	NA	NA
>prophage 9
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	3668078	3734062	4830073	tail,integrase,transposase,holin	Shigella_phage(39.39%)	57	3716850:3716909	3730147:3730206
WP_000131066.1|3668078_3670112_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.4e-21
WP_001335745.1|3670240_3670828_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3670841_3672314_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3672327_3673998_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3674210_3674879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3675121_3675817_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023929.1|3675809_3677237_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3677247_3677967_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339609.1|3678493_3679348_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3679573_3680899_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3681007_3681244_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3681255_3681849_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621008.1|3682438_3683272_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3689574_3689676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187655779.1|3690095_3690224_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_069985293.1|3690475_3690643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044815736.1|3692194_3692734_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3692791_3693460_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_023486803.1|3693485_3696011_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001350485.1|3697613_3698324_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3698636_3698966_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070699.1|3700244_3700934_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3700930_3701887_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667035.1|3701883_3704082_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.9e-38
WP_000121346.1|3704091_3705048_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3705026_3705437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000246061.1|3706097_3706841_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|3707668_3708442_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000904963.1|3708535_3709054_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	86.0	1.8e-80
WP_001417638.1|3709083_3709416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000289819.1|3709417_3709846_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.0	3.1e-25
WP_000805537.1|3709817_3710411_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.7	1.5e-54
WP_001396532.1|3710410_3710905_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	94.8	6.0e-81
WP_044316919.1|3710934_3711489_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	4.8e-87
WP_001394806.1|3712011_3716466_+	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
3716850:3716909	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAAG	NA	NA	NA	NA
WP_000381401.1|3717717_3719289_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|3719308_3719656_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001704819.1|3719655_3720333_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000210155.1|3720660_3720987_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_149025663.1|3720983_3721331_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	5.7e-62
WP_001314911.1|3721315_3721636_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.8e-47
WP_072146855.1|3721635_3722130_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	7.3e-87
WP_000104967.1|3722126_3723068_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_001250269.1|3723057_3723237_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|3723412_3723964_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|3723956_3724217_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|3724314_3725007_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|3725284_3725581_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|3726181_3726544_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|3726609_3727434_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000008202.1|3727561_3728098_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|3728088_3728451_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206733.1|3728450_3728756_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_000051888.1|3728982_3730146_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	2.6e-228
WP_000893277.1|3730350_3731604_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
3730147:3730206	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3731615_3732719_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3733006_3734062_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 10
NZ_CP013190	Escherichia coli strain FORC_031 chromosome, complete genome	4830073	4137181	4184309	4830073	transposase	Stx2-converting_phage(44.44%)	44	NA	NA
WP_155105063.1|4137181_4138409_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	5.4e-171
WP_000854753.1|4138546_4138921_-	toxin	NA	NA	NA	NA	NA
WP_001540478.1|4139010_4139379_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692311.1|4139541_4139763_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186786.1|4139825_4140302_-	RadC family protein	NA	NA	NA	NA	NA
WP_001508976.1|4140317_4140800_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.6	6.8e-13
WP_001508975.1|4140891_4141710_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	2.7e-46
WP_001323397.1|4141864_4142023_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000422741.1|4142127_4142553_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4142549_4142900_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|4142930_4144544_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_044316743.1|4144648_4147495_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001407301.1|4147866_4148739_-	GTPase family protein	NA	NA	NA	NA	NA
WP_023143234.1|4148823_4149741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813436.1|4150940_4151543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235221.1|4151637_4151844_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840364.1|4151984_4152251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016234078.1|4152552_4152729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381416.1|4153394_4154966_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.2	1.5e-170
WP_000624622.1|4154985_4155333_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4155332_4156010_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000221544.1|4156180_4156750_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001295213.1|4157900_4158923_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_047660830.1|4158978_4159368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221620.1|4159355_4159790_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001171523.1|4160144_4160525_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612632.1|4160521_4160869_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_001763674.1|4160918_4162304_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.9	5.9e-259
WP_000823243.1|4162542_4163901_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4164633_4164891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4166632_4167154_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4167150_4168104_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001395291.1|4168190_4170515_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879152.1|4170559_4171462_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_001395290.1|4171458_4172457_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_001395289.1|4172453_4173410_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.4	5.7e-19
WP_000175457.1|4173410_4174178_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_001417294.1|4174734_4174992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|4175643_4177152_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001393519.1|4179255_4180038_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4180343_4181264_+	ribokinase	NA	NA	NA	NA	NA
WP_000998350.1|4181291_4182608_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|4182619_4183633_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001327567.1|4184054_4184309_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 1
NZ_CP013191	Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence	106519	9236	82853	106519	transposase,integrase	Stx2-converting_phage(35.71%)	65	36139:36198	84241:84318
WP_164968891.1|9236_10470_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.1e-167
WP_013188496.1|10611_10968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|11441_12603_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001416764.1|12872_14117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124092.1|16989_17355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001393122.1|18240_20052_+	two-partner secretion system transporter EtpB	NA	NA	NA	NA	NA
WP_069985299.1|20141_24692_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000894830.1|24716_24902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393184.1|24973_26887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001203081.1|26883_27378_+	DUF2919 family protein	NA	NA	NA	NA	NA
WP_044307862.1|27770_27944_-|transposase	transposase domain-containing protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
WP_000343720.1|27940_29149_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_001295213.1|29373_30396_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001297096.1|30395_31175_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_069985300.1|31184_32240_-|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000959870.1|32706_33669_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001393279.1|33671_34022_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000710536.1|34088_35033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780221.1|35355_35637_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000471255.1|35617_35947_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
36139:36198	attL	CGATTTCACTGGCTGATACTTGTCGTGTACAGAGTGCCATGACAGCCTGACGTTTGACTT	NA	NA	NA	NA
WP_013188501.1|36935_37154_+	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_001189123.1|39504_41013_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000019162.1|43446_43719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001378495.1|44035_44812_+	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_013188479.1|44808_45183_+	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_001254933.1|46406_47558_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000845954.1|50075_50510_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001751265.1|50506_51226_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|51496_51655_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001272235.1|52569_52872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107522.1|53027_53315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393327.1|53431_54253_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	1.7e-43
WP_013188482.1|54548_55151_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124827.1|55473_55857_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283565.1|56050_56722_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_000089263.1|56858_57086_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001098998.1|57118_57481_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012113.1|57485_57797_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399782.1|57818_58385_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000830836.1|60039_61032_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000412448.1|61058_61367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009090.1|61429_61741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|61740_62418_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|62417_62765_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001751284.1|62784_64356_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	5.4e-168
WP_001388588.1|64446_64659_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001395298.1|64903_65365_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	2.1e-19
WP_001298565.1|65410_65620_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766790.1|65657_66248_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083839.1|66487_66736_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_064716759.1|66981_67056_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000840963.1|67048_68071_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001393437.1|68989_69802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024181021.1|69805_71377_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.9e-169
WP_000624622.1|71396_71744_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001704819.1|71743_72421_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_140159966.1|72461_72689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|73392_74901_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_149025664.1|76318_77055_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	3.0e-129
WP_187415472.1|77220_78455_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q9ZXG3	Shigella_phage	94.1	1.8e-166
WP_122994480.1|78640_78832_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095033723.1|79086_80249_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001171554.1|80540_80921_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|80917_81265_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001394809.1|81314_82853_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	7.6e-292
84241:84318	attR	CGATTTCACTGGCTGATACTTGTCGTGTACAGAGTGCCATGACAGCCTGACGTTTGACTTCTGGTTCAAAGGGCGCAA	NA	NA	NA	NA
