The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012694	Neisseria meningitidis strain 331401, complete genome	2191116	385470	435067	2191116	tRNA,integrase,transposase	Pseudomonas_phage(23.08%)	53	397376:397421	422234:422279
WP_069972273.1|385470_387063_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	3.9e-65
WP_069972274.1|387660_388632_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.5	4.7e-29
WP_002217339.1|388785_389220_+	DUF1018 domain-containing protein	NA	L7P7R1	Pseudomonas_phage	40.8	8.8e-20
WP_002217337.1|389197_389629_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	40.3	1.2e-21
WP_002246180.1|389937_390483_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	48.6	2.0e-37
WP_002219372.1|390479_390686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215782.1|390688_390853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002221081.1|391197_391380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215844.1|391424_391595_-	YegP family protein	NA	NA	NA	NA	NA
WP_002215845.1|391607_391826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222592.1|391822_392161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222591.1|392172_392439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002234862.1|392435_392633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213715.1|392635_393142_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	51.2	2.4e-40
WP_154021285.1|393232_393553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246151.1|393464_394472_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002249650.1|394604_396383_-	adhesin	NA	NA	NA	NA	NA
397376:397421	attL	CCGTACTATTTGTACTGTCTGCGGCTTCGTCGCCTTGTCCTGATTT	NA	NA	NA	NA
WP_002217326.1|397506_397677_-	rubredoxin	NA	NA	NA	NA	NA
WP_069972275.1|398133_399225_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_002236926.1|399359_399908_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002213703.1|400062_400434_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_069972611.1|400728_402420_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_069972612.1|402944_406778_+	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002246154.1|406854_407856_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002213698.1|407905_408088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002252311.1|409161_409677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002239049.1|412454_412658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050167123.1|412669_412951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014574055.1|412988_413252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019273911.1|413271_413844_-|integrase	site-specific integrase	integrase	B7SYF8	Stenotrophomonas_phage	36.2	1.1e-09
WP_002246162.1|414155_415031_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	39.5	4.7e-44
WP_002213688.1|415075_415372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029686099.1|415377_415557_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	54.5	6.8e-11
WP_002221068.1|415669_416047_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	34.0	3.1e-05
WP_002213685.1|416075_416321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002234831.1|416610_417522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213683.1|417518_418001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002225286.1|418090_418594_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	60.7	6.0e-52
WP_069972277.1|419036_419447_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_079278867.1|419400_420201_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	6.1e-51
WP_002219349.1|420946_421552_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_025461129.1|421648_421840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972278.1|422029_423142_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
422234:422279	attR	CCGTACTATTTGTACTGTCTGCGGCTTCGTCGCCTTGTCCTGATTT	NA	NA	NA	NA
WP_002233820.1|424473_425529_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213671.1|425634_426117_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002246167.1|426163_427300_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002213669.1|427296_427842_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_069972613.1|427838_429314_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_002213667.1|429424_429790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972280.1|429810_431721_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	3.4e-55
WP_002219343.1|431739_432384_-	DedA family protein	NA	NA	NA	NA	NA
WP_069972281.1|432547_433366_-	adhesin Opc	NA	NA	NA	NA	NA
WP_002249664.1|433954_435067_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012694	Neisseria meningitidis strain 331401, complete genome	2191116	462470	497291	2191116	terminase,transposase,head,tail,integrase	Mannheimia_phage(32.14%)	44	457329:457348	471728:471747
457329:457348	attL	ATATAGTGGATTAACAAAAA	NA	NA	NA	NA
WP_100244445.1|462470_464435_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LPN5	Mannheimia_phage	41.9	3.2e-117
WP_050176455.1|464649_465564_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	41.5	5.0e-57
WP_002246175.1|465653_465920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246179.1|466659_467178_+	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	48.8	3.2e-32
WP_002213624.1|467337_467553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213623.1|467556_468165_-	hypothetical protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	49.2	4.9e-24
WP_002213622.1|468296_468497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213621.1|468697_468883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213620.1|469155_469323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002229439.1|469559_469802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213617.1|469845_470037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972288.1|470033_470450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217339.1|470622_471057_+	DUF1018 domain-containing protein	NA	L7P7R1	Pseudomonas_phage	40.8	8.8e-20
WP_002217337.1|471034_471466_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	40.3	1.2e-21
WP_002246180.1|471774_472320_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	48.6	2.0e-37
471728:471747	attR	TTTTTGTTAATCCACTATAT	NA	NA	NA	NA
WP_002219372.1|472316_472523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215782.1|472525_472690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245332.1|473034_473229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213614.1|473565_473832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213613.1|473828_474026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972289.1|474027_474534_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	51.5	6.9e-40
WP_079454341.1|474626_476177_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	70.6	1.5e-218
WP_069972290.1|476176_477745_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	61.2	1.7e-185
WP_002246182.1|477731_479027_+|head	phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	49.9	2.2e-114
WP_002213608.1|479136_479553_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	48.2	2.4e-30
WP_002232421.1|479783_480845_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	43.0	9.6e-60
WP_002245820.1|480932_481898_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	1.8e-36
WP_002229450.1|482593_483244_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	38.4	5.2e-32
WP_002225238.1|483240_483438_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_079871425.1|483440_484850_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	52.1	5.3e-122
WP_002222505.1|484914_485292_+	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	50.8	5.3e-29
WP_069972292.1|485295_485661_+	hypothetical protein	NA	F6MIK9	Haemophilus_phage	36.8	2.0e-09
WP_002222503.1|485912_486515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079871426.1|486684_488841_+	PRTRC system protein F	NA	A0A0M3LPB6	Mannheimia_phage	29.9	5.5e-38
WP_002217232.1|488840_490172_+	phage morphogeneis protein	NA	A0A0M3LQ21	Mannheimia_phage	35.4	9.5e-65
WP_069972294.1|490161_491307_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	57.9	3.9e-115
WP_002213592.1|491303_491537_+	hypothetical protein	NA	A0A0M3LPA3	Mannheimia_phage	55.4	1.1e-11
WP_002213590.1|492001_492562_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	3.1e-25
WP_069972295.1|492572_494546_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	57.6	3.1e-136
WP_002213586.1|495563_495866_-	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	38.8	1.1e-05
WP_002213585.1|495837_496125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972296.1|496204_496810_+	hypothetical protein	NA	Q7Y5S1	Haemophilus_phage	37.5	2.7e-14
WP_002213583.1|496788_497085_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	61.4	1.4e-24
WP_002213582.1|497081_497291_+	hypothetical protein	NA	A0A0R6PHB4	Moraxella_phage	48.2	4.1e-07
>prophage 3
NZ_CP012694	Neisseria meningitidis strain 331401, complete genome	2191116	652856	662033	2191116		Burkholderia_phage(28.57%)	9	NA	NA
WP_002232563.1|652856_653699_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	1.6e-46
WP_002237048.1|653713_654154_+	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_002219188.1|654201_655488_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	62.1	7.4e-147
WP_002213385.1|655501_655780_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_002217077.1|655820_656111_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.5	7.5e-15
WP_002237049.1|656308_657442_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	74.8	1.8e-165
WP_002246001.1|657502_658690_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.9	6.6e-33
WP_002222381.1|658682_659696_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	52.8	8.0e-88
WP_041423596.1|659753_662033_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	67.8	9.2e-310
>prophage 4
NZ_CP012694	Neisseria meningitidis strain 331401, complete genome	2191116	980588	1057370	2191116	terminase,tRNA,transposase,protease,head,tail,plate	Haemophilus_phage(20.0%)	91	NA	NA
WP_002246317.1|980588_981548_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002212805.1|981663_981783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972388.1|981793_982660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972620.1|982710_983763_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_002216777.1|984609_985173_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002212800.1|985983_986319_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002212798.1|986447_987353_+	efflux transporter MtrCDE transcriptional activator MtrA	NA	NA	NA	NA	NA
WP_002235070.1|987414_987903_-	lipoprotein	NA	NA	NA	NA	NA
WP_069972389.1|988049_988952_+	DMT family transporter	NA	NA	NA	NA	NA
WP_079871373.1|988992_990123_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002246319.1|990327_992952_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.0	2.1e-79
WP_002212793.1|993013_993745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002246320.1|994453_995713_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	40.8	9.0e-81
WP_002246321.1|995836_996865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229738.1|997666_998350_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_069972621.1|998645_1000949_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	37.4	3.8e-85
WP_002235078.1|1000968_1002486_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_002212784.1|1002537_1003005_+	response regulator	NA	NA	NA	NA	NA
WP_002246323.1|1003108_1003861_+	ribosomal RNA small subunit methyltransferase J	NA	NA	NA	NA	NA
WP_002212781.1|1004894_1005101_-	DUF2788 domain-containing protein	NA	NA	NA	NA	NA
WP_069972392.1|1005195_1006365_-	O-succinylhomoserine sulfhydrylase	NA	A0A2K9L4S9	Tupanvirus	23.6	7.5e-05
WP_050389538.1|1006662_1007424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002234140.1|1007523_1007775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972393.1|1007826_1008633_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069972394.1|1008939_1010463_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_069972395.1|1010560_1011973_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_002249775.1|1012276_1013242_+|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	3.0e-36
WP_009348827.1|1014497_1014695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002218958.1|1014755_1015562_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_069972396.1|1015611_1016481_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_002246327.1|1016593_1017031_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.1	5.0e-39
WP_069972397.1|1018179_1018584_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_002246329.1|1018623_1019811_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_002218952.1|1019873_1020407_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_069972398.1|1020666_1021506_-	hypothetical protein	NA	A0A0R6PH56	Moraxella_phage	50.0	1.1e-77
WP_002212759.1|1021853_1022342_-	hypothetical protein	NA	A0A0R6PGL8	Moraxella_phage	47.7	6.7e-24
WP_002212758.1|1022342_1022966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972399.1|1022962_1025245_-	hypothetical protein	NA	U5PSK6	Bacillus_phage	35.3	9.4e-20
WP_002212756.1|1025247_1025814_-	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	36.3	8.0e-21
WP_002212755.1|1025810_1026386_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	42.0	3.4e-35
WP_069972400.1|1026388_1026874_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	40.8	2.0e-20
WP_002212752.1|1026870_1027224_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	53.0	3.7e-24
WP_002237234.1|1027284_1027914_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	47.2	2.3e-32
WP_069972401.1|1027914_1029054_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	43.8	1.8e-80
WP_069972402.1|1029037_1030405_-	hypothetical protein	NA	F6MIL2	Haemophilus_phage	28.9	1.4e-42
WP_002212743.1|1032450_1032699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212742.1|1032656_1033046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002246518.1|1033228_1034194_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	1.0e-36
WP_154021291.1|1034221_1034566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002237241.1|1034618_1035083_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	39.1	2.0e-22
WP_002212738.1|1035069_1035456_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	54.3	2.8e-25
WP_069972405.1|1035631_1036006_-|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	45.2	3.3e-23
WP_069972406.1|1036019_1037447_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	41.6	7.5e-84
WP_002212735.1|1037446_1037635_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_069972407.1|1037631_1038300_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_002212733.1|1038283_1038709_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	41.7	2.9e-15
WP_002212732.1|1038705_1039179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212731.1|1039216_1040119_-|head	head protein	head	A0SMP3	Pseudomonas_virus	64.8	5.0e-110
WP_010981241.1|1040140_1041205_-	transcriptional regulator	NA	A0A0M5N0Q6	Ralstonia_phage	34.3	8.0e-30
WP_002212728.1|1041413_1041911_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	37.3	2.4e-13
WP_002249701.1|1042014_1043361_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	B7SDN5	Haemophilus_phage	31.6	7.4e-41
WP_002212726.1|1043353_1044913_-	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	47.8	3.1e-131
WP_079278890.1|1044991_1046551_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	71.3	3.4e-215
WP_002212724.1|1046622_1046817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050175005.1|1046813_1047320_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	55.6	2.1e-44
WP_002212722.1|1047322_1047538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212721.1|1047537_1047819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002237247.1|1047815_1048157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215845.1|1048153_1048372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215844.1|1048384_1048555_+	YegP family protein	NA	NA	NA	NA	NA
WP_002233783.1|1048599_1048782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002246334.1|1048801_1049221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215783.1|1049192_1049429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215782.1|1049431_1049596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002219372.1|1049598_1049805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002246335.1|1049801_1050347_-	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	49.2	4.1e-38
WP_033909514.1|1050478_1051156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972408.1|1051167_1051614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212717.1|1051610_1052045_-	DUF1018 domain-containing protein	NA	L7P7R1	Pseudomonas_phage	43.3	5.2e-20
WP_002212716.1|1052120_1052396_-	DNA-binding protein HU-beta 2	NA	A3E2K9	Sodalis_phage	52.8	8.9e-18
WP_002212715.1|1052444_1052645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212714.1|1052645_1053296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212713.1|1053301_1053913_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	54.4	6.3e-56
WP_010981244.1|1053905_1054100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212711.1|1054071_1054527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981245.1|1054510_1054888_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	41.9	6.7e-16
WP_002237252.1|1055006_1055321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981246.1|1055317_1055533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212706.1|1055848_1056148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972409.1|1056137_1056380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972410.1|1056455_1057370_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	44.5	7.5e-53
