The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017385	Klebsiella pneumoniae strain KP36 chromosome, complete genome	5367386	1768998	1778461	5367386	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1768998_1770114_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1770110_1772051_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1772127_1772349_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1772674_1772992_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1773022_1775302_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1775421_1775640_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1775993_1776695_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020323882.1|1776739_1778461_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
>prophage 2
NZ_CP017385	Klebsiella pneumoniae strain KP36 chromosome, complete genome	5367386	2042316	2112703	5367386	portal,terminase,plate,integrase,tail,tRNA,head,capsid,transposase	Enterobacteria_phage(50.0%)	83	2069509:2069530	2107459:2107480
WP_004150803.1|2042316_2043423_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2043479_2043938_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_069985677.1|2043954_2044605_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2044845_2046096_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_020324087.1|2046368_2047082_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2047078_2047471_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2047463_2047787_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_020805510.1|2047906_2048083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|2048236_2048464_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_020324096.1|2048576_2049770_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022631258.1|2049837_2050173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2050392_2050578_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|2050668_2051163_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|2051189_2051696_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|2051712_2052600_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|2052655_2054062_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2054058_2055069_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_020324075.1|2055181_2055379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2055945_2056578_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_020324078.1|2056617_2056797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2057194_2057881_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_009486509.1|2057993_2058158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|2058191_2059700_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2059820_2060711_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020324097.1|2060717_2062502_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|2062575_2063784_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2064086_2065130_+	type II asparaginase	NA	NA	NA	NA	NA
WP_008807690.1|2065791_2066706_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
WP_020324076.1|2066795_2067434_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004190891.1|2067564_2067828_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2067887_2068013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|2068130_2068205_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2068204_2068306_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|2068363_2069377_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
2069509:2069530	attL	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_004216842.1|2069641_2070625_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004213095.1|2070740_2071040_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_020806130.1|2071160_2071439_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004216643.1|2071459_2071678_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020324119.1|2071693_2072071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|2072086_2072350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324115.1|2072427_2072652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408797.1|2072648_2073215_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324116.1|2073447_2074383_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_020324090.1|2074420_2076568_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324106.1|2076825_2078772_+	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_130574490.1|2079033_2080196_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	38.0	3.5e-47
WP_020806129.1|2081468_2081621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324107.1|2081934_2082687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044816202.1|2083163_2084225_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324092.1|2084218_2085946_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_020324109.1|2086102_2086942_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324085.1|2086952_2087987_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324091.1|2088036_2088903_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324071.1|2089007_2089523_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_004131559.1|2089522_2089723_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324103.1|2089713_2089998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324098.1|2089994_2090540_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_157833084.1|2090726_2091062_+	peptidase	NA	B6SD31	Bacteriophage	33.3	4.3e-06
WP_020324102.1|2091062_2091530_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_020324118.1|2091526_2092162_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_009486481.1|2092158_2092746_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324083.1|2092742_2093093_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_020324110.1|2093094_2094018_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020806131.1|2094007_2097034_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324108.1|2097030_2097243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324070.1|2097242_2098340_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324073.1|2098493_2099852_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_032408799.1|2100096_2100588_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324072.1|2100603_2103579_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_053086776.1|2103565_2103703_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_004131585.1|2103723_2104041_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_004216461.1|2104086_2104602_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_020324084.1|2104601_2105774_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_020324077.1|2105928_2107068_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_004213128.1|2107111_2107363_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004179368.1|2107627_2107867_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
2107459:2107480	attR	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_014343000.1|2107856_2108195_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150778.1|2108199_2108709_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004179371.1|2108854_2109547_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|2109578_2110754_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|2110861_2111656_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2111639_2112086_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004179374.1|2112202_2112703_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP017385	Klebsiella pneumoniae strain KP36 chromosome, complete genome	5367386	2516597	2527484	5367386		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2516597_2517218_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004179748.1|2517210_2518476_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002903955.1|2518487_2519390_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2519650_2520412_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004179754.1|2520432_2521293_-	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|2521590_2521851_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179755.1|2521937_2523026_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176258.1|2523056_2524322_-	MFS transporter	NA	NA	NA	NA	NA
WP_004179756.1|2524376_2527484_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_CP017385	Klebsiella pneumoniae strain KP36 chromosome, complete genome	5367386	3542324	3555645	5367386	transposase	Escherichia_phage(22.22%)	11	NA	NA
WP_039819511.1|3542324_3543329_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_004144151.1|3543728_3543851_+	small membrane protein	NA	NA	NA	NA	NA
WP_077255456.1|3544542_3544647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039819510.1|3546265_3547432_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_039819508.1|3547611_3548166_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_004175259.1|3548180_3549071_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819507.1|3549102_3549972_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_039819536.1|3549985_3551050_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819506.1|3551204_3552575_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_004180506.1|3552596_3554012_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_000043543.1|3554238_3555645_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 5
NZ_CP017385	Klebsiella pneumoniae strain KP36 chromosome, complete genome	5367386	3600543	3607448	5367386	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|3600543_3602022_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3602018_3602741_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_039819857.1|3603059_3604421_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004151134.1|3604663_3605560_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819854.1|3605800_3606574_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_069985709.1|3606584_3607448_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	9.7e-10
>prophage 6
NZ_CP017385	Klebsiella pneumoniae strain KP36 chromosome, complete genome	5367386	4024848	4102326	5367386	terminase,portal,plate,tail,integrase,tRNA,capsid,lysis,head	Salmonella_phage(75.51%)	85	4069730:4069776	4104607:4104653
WP_002914079.1|4024848_4025586_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4025717_4027049_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_004180937.1|4027094_4027478_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4027790_4028480_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4028537_4029623_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4029826_4030252_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4030321_4031020_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_020324863.1|4031054_4033706_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_004180947.1|4033826_4035182_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4035223_4035547_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_020324862.1|4035550_4036846_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
WP_004150973.1|4043002_4045576_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_004180948.1|4045705_4046437_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4046433_4047414_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4047545_4048283_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4048553_4048889_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4048995_4049043_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004150975.1|4049143_4050304_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_004174805.1|4050300_4051173_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4051235_4052357_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4052366_4053437_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4053779_4054289_+	YfiR family protein	NA	NA	NA	NA	NA
WP_004180950.1|4054281_4055505_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004145671.1|4055518_4056001_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004180951.1|4056009_4057380_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4057436_4057895_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4058014_4058362_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4058401_4059169_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004180952.1|4059200_4059749_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4059767_4060016_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4060275_4061640_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4061803_4062595_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4062614_4063901_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4064020_4064611_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4064735_4065614_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004180954.1|4065700_4067362_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4067509_4067851_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145682.1|4067917_4068208_-	RnfH family protein	NA	NA	NA	NA	NA
WP_031281023.1|4068197_4068674_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4068784_4069267_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4069730:4069776	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_022631377.1|4069870_4070248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631378.1|4070275_4070494_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.1e-26
WP_020323978.1|4070560_4071658_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	1.6e-174
WP_020323988.1|4071654_4072140_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	9.1e-58
WP_020324005.1|4072136_4074764_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	3.9e-118
WP_002896220.1|4074756_4074876_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_020324018.1|4074890_4075190_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
WP_002896201.1|4075242_4075758_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_020323990.1|4075767_4076940_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	9.5e-210
WP_020324016.1|4077087_4078251_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	54.3	2.6e-50
WP_020324004.1|4078278_4078497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323992.1|4078497_4080606_-	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	39.6	7.4e-112
WP_031281025.1|4080611_4081208_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.3	4.3e-57
WP_020324006.1|4081197_4082106_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.9	4.9e-105
WP_020323996.1|4082092_4082455_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
WP_020323981.1|4082451_4083024_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.6e-77
WP_020323986.1|4083092_4083539_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	2.5e-54
WP_002896172.1|4083531_4083963_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_073578772.1|4083925_4084084_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.2	7.6e-14
WP_020323995.1|4084058_4084487_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
WP_020323982.1|4084483_4084867_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
WP_020323999.1|4084871_4085381_-	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
WP_004144702.1|4085361_4085577_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_004144701.1|4085580_4085784_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
WP_020323987.1|4085783_4086248_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.0e-74
WP_004185715.1|4086344_4086995_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.1	3.6e-102
WP_020324020.1|4086998_4088063_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_020323980.1|4088079_4088913_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.5e-103
WP_019704191.1|4089053_4090817_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_020323991.1|4090816_4091851_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.7e-176
WP_020324000.1|4091885_4093319_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_020324001.1|4093534_4094377_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.0e-59
WP_020323985.1|4094376_4094595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323998.1|4094881_4095115_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	2.4e-32
WP_020324007.1|4095125_4095314_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_020324017.1|4095467_4097882_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	88.4	0.0e+00
WP_020324002.1|4097878_4098736_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.2	3.4e-116
WP_020324003.1|4098732_4098960_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
WP_020323984.1|4098959_4099193_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.3e-30
WP_020806228.1|4099260_4099602_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	8.4e-50
WP_019704179.1|4099565_4099766_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
WP_020806226.1|4099773_4100283_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_000102106.1|4100315_4100558_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_031281027.1|4100680_4101310_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.1	3.9e-61
WP_022631381.1|4101312_4102326_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	8.5e-191
4104607:4104653	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 1
NZ_CP017386	Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence	155781	12014	19887	155781	transposase	Escherichia_phage(85.71%)	7	NA	NA
WP_001067855.1|12014_12719_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001620097.1|13149_14238_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|14324_14585_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_069985710.1|14882_15743_+	SHV family class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.3	1.3e-155
WP_001067855.1|16213_16918_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|17583_18288_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000842134.1|18777_19887_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
>prophage 2
NZ_CP017386	Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence	155781	69327	126516	155781	integrase,transposase	Escherichia_phage(25.0%)	60	73743:73757	135677:135691
WP_048270288.1|69327_70401_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023287106.1|70584_70959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|71014_71341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|71337_72066_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568057.1|72062_72494_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_023287107.1|72538_74596_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.2	3.4e-21
73743:73757	attL	TTTTCCAGCAGGGCG	NA	NA	NA	NA
WP_009310026.1|74665_74914_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_015065513.1|74962_75505_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	77.5	1.6e-50
WP_004152756.1|76335_76899_-	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_013054814.1|76946_78302_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001568051.1|78353_78584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|78675_78903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032436760.1|79640_79961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440466.1|79995_80250_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|80437_80629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|80671_81178_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568045.1|81221_81650_-	antirestriction protein	NA	NA	NA	NA	NA
WP_025714480.1|82330_83098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|83151_83571_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|83580_83802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|83801_84503_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568040.1|84939_85170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015345000.1|85232_85904_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568038.1|85906_86878_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004178082.1|87126_88614_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|89020_89452_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|89451_90723_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_004197644.1|91134_92010_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
WP_004197649.1|92641_93268_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_006788217.1|93387_93567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|94022_94817_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|95014_96031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|96041_96356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017899885.1|96382_96778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|96946_97252_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|97253_97472_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_004193995.1|98026_98716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069985716.1|98746_99436_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_021312476.1|99876_100107_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069985717.1|100103_100520_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_069985718.1|100565_103883_-	pcar	NA	NA	NA	NA	NA
WP_000019473.1|103940_104921_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_009310051.1|105916_106180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654312.1|106176_106743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213594.1|106773_107268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213596.1|107328_107532_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_069985721.1|108241_109159_-	bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|109820_110087_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_077269838.1|110074_110557_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|110756_112160_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|112188_112821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314316.1|113050_114397_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004118832.1|118231_119965_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|119972_120920_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|120964_122569_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|122581_123502_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|123501_124350_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|124346_124940_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|124936_126064_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|126348_126516_-|integrase	integrase	integrase	NA	NA	NA	NA
135677:135691	attR	CGCCCTGCTGGAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP017387	Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence	225962	507	49784	225962	transposase	Salmonella_phage(33.33%)	54	NA	NA
WP_130574490.1|507_1670_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.2	4.0e-43
WP_019704555.1|2200_3760_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_014342188.1|4411_5497_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_072201193.1|5496_5730_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_019704556.1|5726_7643_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
WP_072201198.1|7668_8379_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	57.6	3.6e-71
WP_040203999.1|8388_8958_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.4e-94
WP_040203489.1|9033_11337_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_014342181.1|11467_12610_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_001067855.1|12754_13459_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_130574490.1|13552_14714_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.2	4.0e-43
WP_077269839.1|14650_15217_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.9	2.8e-18
WP_094319388.1|15282_16366_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	5.2e-45
WP_069985726.1|16439_17345_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_052259184.1|17737_18475_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|18471_18696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|18906_20400_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|20430_20682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|20964_21780_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|22086_22398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|22571_23357_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|23360_24542_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|24590_24863_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|24915_25551_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000939033.1|25642_25786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|26104_26482_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000044824.1|26474_26756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|26730_27405_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|27472_27904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210541.1|27909_28221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647189.1|28229_28730_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000936896.1|28733_30161_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268551.1|30160_30817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362482.1|31022_31241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464631.1|31334_31952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|32163_32463_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
WP_000468105.1|32554_33043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366822.1|33057_35250_-	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.7e-42
WP_001191892.1|35249_35483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001249396.1|35464_36082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337757.1|36249_39228_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_000178856.1|39224_41090_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000332866.1|41100_41685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743450.1|41641_42271_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000122506.1|42280_42727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869261.1|42736_43114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231463.1|43113_43776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509509.1|44099_44477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805625.1|44621_44903_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001049716.1|44899_45526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000794249.1|45509_46427_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_024131605.1|46426_47740_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000793435.1|47736_48315_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_004152342.1|48515_49784_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
>prophage 2
NZ_CP017387	Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence	225962	68956	92492	225962	integrase,transposase	Shigella_phage(33.33%)	26	88983:88998	95154:95169
WP_001067855.1|68956_69661_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000050481.1|70819_72361_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|73667_74120_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|74161_74806_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|75296_76136_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|76263_76764_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|76732_77725_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000179844.1|77727_79407_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|79481_80150_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|80185_80422_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|80418_80781_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_015063453.1|80798_82493_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000522996.1|82531_82957_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|82984_83260_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|83275_83641_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|83712_84168_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000787563.1|85514_85787_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_000750746.1|85791_86034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|86081_86381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|86547_87000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130574490.1|87149_88311_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.2	4.0e-43
WP_069985727.1|88284_88860_-	hypothetical protein	NA	NA	NA	NA	NA
88983:88998	attL	TAATTATGATAATTAC	NA	NA	NA	NA
WP_000575657.1|89121_89403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130574490.1|89527_90689_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.2	4.0e-43
WP_000949433.1|90942_91479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|91481_92492_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
95154:95169	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 3
NZ_CP017387	Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence	225962	140265	175055	225962	terminase,tail,portal,transposase	Salmonella_phage(88.89%)	42	NA	NA
WP_001067855.1|140265_140970_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_069985732.1|142238_142793_+	aminoglycoside N-acetyltransferase AAC(6')-Ib11	NA	NA	NA	NA	NA
WP_012695455.1|143020_143761_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
WP_077249983.1|143747_145256_-|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
WP_001067855.1|145415_146120_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032734118.1|146456_146864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021313142.1|146991_147366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064152273.1|147368_147650_+	hypothetical protein	NA	J9Q753	Salmonella_phage	82.8	4.5e-41
WP_064152274.1|147855_148338_+	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.0e-64
WP_004109904.1|148929_149133_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_004109892.1|149183_149834_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_021313137.1|150150_150681_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.6	2.5e-56
WP_021313136.1|150730_151087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126066598.1|151111_151711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126066599.1|151857_152397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313134.1|152458_152737_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	70.3	6.2e-27
WP_021313133.1|152739_154299_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
WP_050484892.1|154358_155063_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.8e-108
WP_014342142.1|155062_155731_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_019704584.1|155727_156366_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_019704585.1|156358_156613_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_064152275.1|156618_157509_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	96.6	4.6e-164
WP_004109869.1|157518_157785_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109866.1|157960_158602_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109863.1|158604_159861_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_064163024.1|159893_161468_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.4	1.9e-274
WP_023279435.1|161490_162390_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_004109857.1|162416_163295_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342134.1|163372_163801_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_064152247.1|163848_164283_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	1.1e-62
WP_021313128.1|164282_165116_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	4.8e-131
WP_004109848.1|165213_165558_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_021313126.1|165548_166022_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_064152246.1|166023_166416_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	66.7	5.0e-46
WP_064152245.1|166483_167230_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_004109835.1|167291_167609_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_014342129.1|167734_167959_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_064163025.1|167966_172502_+	tape measure protein	NA	J9Q712	Salmonella_phage	69.8	0.0e+00
WP_032423010.1|172545_172881_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_004109820.1|172967_173666_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|173658_174456_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_021313122.1|174443_175055_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	4.5e-78
>prophage 4
NZ_CP017387	Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence	225962	195551	206965	225962	tail	Salmonella_phage(92.31%)	14	NA	NA
WP_064163034.1|195551_195830_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	65.2	6.9e-26
WP_064163032.1|196223_196691_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	2.6e-49
WP_064152241.1|196770_197559_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.4	6.4e-69
WP_074182673.1|197679_198801_-	DNA primase	NA	J9Q720	Salmonella_phage	91.3	8.3e-203
WP_032440528.1|198947_200288_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_040203349.1|200352_201078_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	9.6e-128
WP_077257223.1|201322_202108_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	24.8	1.8e-07
WP_014342115.1|202153_202510_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_021313115.1|202515_203181_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_014342117.1|203421_203943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040203611.1|204145_204397_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	4.5e-24
WP_040203608.1|204399_205092_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	88.3	3.9e-118
WP_004109805.1|205105_205429_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_048333199.1|205519_206965_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
>prophage 5
NZ_CP017387	Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence	225962	215136	225763	225962	transposase	Salmonella_phage(83.33%)	12	NA	NA
WP_001067855.1|215136_215841_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040213759.1|216339_216783_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	95.0	1.1e-68
WP_040213762.1|217097_217313_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	79.4	2.9e-24
WP_040213768.1|217662_218094_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
WP_040213770.1|218213_219221_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.0	6.0e-144
WP_048268833.1|219281_220226_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.3	1.1e-171
WP_019704549.1|220225_220492_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_064185416.1|220494_222837_+	recombinase RecA	NA	J9Q736	Salmonella_phage	83.8	3.3e-28
WP_014342076.1|223007_223184_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
WP_019704552.1|223546_223882_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_014342074.1|223881_224094_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_072201189.1|224545_225763_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
