The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014859	Actinoalloteichus hymeniacidonis strain HPA177(T) (=DSM 45092(T)) chromosome, complete genome	6306386	316376	363497	6306386	integrase,tRNA,protease	Mycobacterium_phage(11.11%)	45	316253:316296	327413:327456
316253:316296	attL	ACTCGTAATGCGTAGGTCAAGGGTTCGATTCCCTTAGGCGGCTC	NA	NA	NA	NA
WP_084642400.1|316376_317675_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A286MRB3	Mycobacterium_phage	31.0	1.7e-42
WP_069846007.1|317674_317863_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069846009.1|317879_319529_-	replication initiator protein	NA	NA	NA	NA	NA
WP_069846010.1|319525_321049_-	cell division protein FtsK	NA	G1D482	Mycobacterium_virus	26.6	5.3e-11
WP_157420886.1|321523_321889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157420887.1|321885_322089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069846015.1|322112_322532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069853168.1|322684_323428_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069846017.1|323443_323914_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_157420888.1|323904_324462_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_157420889.1|324690_325527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157420890.1|325839_327147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084642402.1|327569_327845_-	hypothetical protein	NA	NA	NA	NA	NA
327413:327456	attR	ACTCGTAATGCGTAGGTCAAGGGTTCGATTCCCTTAGGCGGCTC	NA	NA	NA	NA
WP_084642404.1|328190_328436_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_069846021.1|328900_329383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084642405.1|329466_330078_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069846025.1|330469_332263_+	NPCBM/NEW2 domain-containing protein	NA	NA	NA	NA	NA
WP_157420891.1|332371_333124_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069846026.1|333136_334033_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069846028.1|334363_335143_+|protease	serine protease	protease	NA	NA	NA	NA
WP_084642409.1|335268_335820_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069846032.1|335819_337640_+	MFS transporter	NA	NA	NA	NA	NA
WP_069846034.1|337724_338243_-	inorganic diphosphatase	NA	NA	NA	NA	NA
WP_172803715.1|338728_338893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172803716.1|339049_340651_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_069853172.1|340705_341755_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_084642412.1|342379_343396_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_069846038.1|343467_344016_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.0	2.0e-08
WP_069846039.1|344310_346731_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	49.2	1.6e-110
WP_069846041.1|346755_347385_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	51.2	3.6e-46
WP_069846043.1|347387_348230_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	33.5	1.0e-19
WP_069846045.1|348226_348610_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_069846046.1|348609_349119_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_069846048.1|349115_349583_+	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_157420893.1|349669_351055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069846051.1|351432_352038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084643523.1|352242_353757_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069846054.1|353905_354823_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_069846056.1|354819_355803_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_069846057.1|355816_356347_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_069846059.1|356388_357174_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_069853174.1|357334_358789_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.3	1.7e-75
WP_069846060.1|358945_359296_+	Lsr2 family protein	NA	A0A160DEV0	Gordonia_phage	44.2	3.7e-16
WP_084643524.1|359625_360495_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_069846062.1|360938_363497_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.2	6.0e-132
