The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017296	Pseudomonas fluorescens strain Pt14 chromosome, complete genome	5841722	355844	441075	5841722	plate,holin,tail,tRNA	uncultured_Caudovirales_phage(20.0%)	85	NA	NA
WP_069868300.1|355844_356315_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_014717138.1|356448_357558_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	5.8e-23
WP_014717139.1|357554_358475_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	27.4	7.1e-19
WP_014717140.1|358908_361017_+	molybdopterin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_054898038.1|361094_361433_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_012722487.1|361510_361981_-	bacterioferritin	NA	NA	NA	NA	NA
WP_003188977.1|362182_362401_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_003172097.1|362644_363247_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003188980.1|363311_363983_-	ribonuclease T	NA	NA	NA	NA	NA
WP_014717142.1|363979_365026_-	dihydroorotase	NA	NA	NA	NA	NA
WP_019817696.1|365182_366091_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003188984.1|366219_367437_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_003188986.1|368045_368678_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014717144.1|368761_368944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003188989.1|369051_369690_-	endonuclease III	NA	NA	NA	NA	NA
WP_069868302.1|369750_370719_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_060767092.1|370806_372858_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_034135812.1|373030_374125_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_014717148.1|374646_374970_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_038449077.1|375112_377704_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.0	3.0e-30
WP_080643468.1|377918_378119_-	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_069868304.1|378572_381260_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_060767089.1|381324_382380_+	hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.8	1.9e-20
WP_046071212.1|382407_383061_+	RraA family protein	NA	NA	NA	NA	NA
WP_014717156.1|383721_384210_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	44.5	3.8e-27
WP_014717157.1|384444_385179_+	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	87.7	6.3e-119
WP_005785384.1|385769_386108_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	85.4	1.4e-44
WP_014717158.1|386131_386647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014717160.1|387270_387603_+|plate	phage baseplate protein	plate	A0A2H4JI46	uncultured_Caudovirales_phage	67.3	5.1e-36
WP_014717161.1|387599_388595_+|plate	baseplate J protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	64.4	3.2e-113
WP_014717162.1|388591_389230_+|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	51.9	4.8e-38
WP_014717163.1|389226_389757_+|tail	tail fiber protein	tail	B0ZSG1	Halomonas_phage	56.2	3.2e-48
WP_020301162.1|389810_390563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014717165.1|390572_390809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014717166.1|391073_392240_+|tail	tail protein	tail	B0ZSG8	Halomonas_phage	57.0	7.2e-125
WP_014717167.1|392239_392746_+|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	34.5	2.2e-22
WP_014717168.1|392926_393499_+|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	39.3	1.6e-29
WP_038449089.1|393627_395850_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_014717171.1|395849_396233_+|tail	phage tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	58.3	1.3e-35
WP_014717172.1|396225_396438_+|tail	tail protein	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	65.7	4.0e-18
WP_032872893.1|396447_397449_+|tail	phage-like tail protein	tail	A0A2H4JH05	uncultured_Caudovirales_phage	52.7	1.6e-96
WP_014717174.1|397471_398029_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	72.1	1.6e-74
WP_014717175.1|398181_398682_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	82.5	4.1e-69
WP_014717176.1|398765_399824_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	2.4e-111
WP_014717177.1|399832_400300_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_014717178.1|400361_401474_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_069868306.1|401768_402203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014717180.1|402381_403101_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_003189050.1|403352_404003_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019817716.1|404078_404441_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_016977932.1|404444_405431_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003189055.1|405496_406276_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_038449092.1|406408_407104_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_005785469.1|407108_407570_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.0	2.6e-38
WP_032903270.1|407638_408349_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_020301153.1|408556_409027_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003231334.1|409127_410468_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_014717185.1|410649_410985_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_020301152.1|410981_411305_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	39.4	2.4e-14
WP_014717187.1|411719_413621_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	2.9e-75
WP_038449160.1|413756_414863_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_014717189.1|414966_415503_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014717190.1|415708_415894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032904593.1|415948_417574_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_014717192.1|417878_418586_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_014717193.1|418796_420419_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_014717194.1|420418_420931_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_014717195.1|420927_422190_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_020301147.1|422186_422888_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032903262.1|422884_425161_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.4	7.4e-09
WP_003189079.1|425157_426168_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	40.3	9.9e-06
WP_014717198.1|426220_427222_+	PleD family two-component system response regulator	NA	A0A127AWB9	Bacillus_phage	35.2	1.6e-16
WP_096001736.1|427397_428492_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	2.0e-07
WP_003189082.1|428572_430075_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.4	5.5e-85
WP_014717200.1|430218_430935_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014717201.1|431031_432309_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_038449166.1|432401_433307_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	30.0	1.7e-09
WP_003172217.1|433303_433630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014717203.1|433781_434138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003189093.1|434629_435415_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003189094.1|435471_435897_-	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_014717206.1|436180_436525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038449168.1|436724_439370_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_003189104.1|439650_440298_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	32.5	8.6e-11
WP_014717208.1|440388_441075_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP017296	Pseudomonas fluorescens strain Pt14 chromosome, complete genome	5841722	502304	507288	5841722		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_014717247.1|502304_503054_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.4	5.5e-62
WP_003189211.1|503053_503731_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.1	3.1e-43
WP_069868310.1|503940_504777_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	1.1e-05
WP_003189214.1|504883_505891_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
WP_002554837.1|506123_506333_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
WP_003189215.1|506721_507288_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.3	3.7e-74
>prophage 3
NZ_CP017296	Pseudomonas fluorescens strain Pt14 chromosome, complete genome	5841722	2413752	2481441	5841722	head,holin,transposase,integrase,tail	Pseudomonas_phage(59.38%)	96	2422831:2422890	2480475:2480587
WP_019821501.1|2413752_2414700_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014718866.1|2415050_2416868_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_014718867.1|2416869_2418981_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_019816804.1|2419116_2419386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014718869.1|2419519_2420260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014718870.1|2420454_2420652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014718871.1|2420744_2421146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014718872.1|2421275_2421692_-	inhibitor of vertebrate lysozyme family protein	NA	NA	NA	NA	NA
WP_019816803.1|2422038_2422815_+	hypothetical protein	NA	A0A2K9VHE7	Pseudomonas_phage	33.3	3.9e-26
2422831:2422890	attL	CAAACCCCAGAAACGCAAAAGCCCCGCTTTCGCGAGGCTTTCGTGTAAATCTTGGCGGGA	NA	NA	NA	NA
WP_019816802.1|2423145_2423355_+	hypothetical protein	NA	A0A2D1GNR5	Pseudomonas_phage	55.4	1.0e-10
WP_058410384.1|2423442_2423799_+	hypothetical protein	NA	A0A2H4IZV2	uncultured_Caudovirales_phage	56.3	4.2e-28
WP_058410383.1|2423864_2424884_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.3	1.0e-18
WP_019816799.1|2424902_2425109_+	hypothetical protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	80.3	2.8e-24
WP_019816798.1|2425120_2425378_-	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	70.9	6.6e-23
WP_019816797.1|2425374_2425746_-	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	44.9	1.9e-15
WP_019816796.1|2425745_2426171_-	cell wall hydrolase	NA	A0A1B0VMI2	Pseudomonas_phage	90.8	8.0e-74
WP_019816795.1|2426227_2426482_-	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	51.4	7.2e-14
WP_014717932.1|2426478_2426769_-	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	45.0	3.3e-15
WP_019816794.1|2426765_2427563_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	48.6	2.4e-31
WP_081339073.1|2427618_2428548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019816793.1|2428520_2428826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868561.1|2428827_2432829_-	DUF1983 domain-containing protein	NA	A0A1B0VMH5	Pseudomonas_phage	72.4	0.0e+00
WP_069868564.1|2432888_2433482_-|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	95.9	1.8e-100
WP_069868566.1|2433537_2433990_-	hypothetical protein	NA	A0A1B0VMH3	Pseudomonas_phage	93.9	3.9e-63
WP_069868568.1|2433986_2434322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868570.1|2434425_2434764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019816788.1|2434957_2435287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034135906.1|2435803_2436058_-	hypothetical protein	NA	A0A0S2SYE8	Pseudomonas_phage	57.0	3.2e-14
WP_034135907.1|2436129_2436516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069868574.1|2436502_2437303_-	C40 family peptidase	NA	A0A1B0VP68	Pseudomonas_phage	88.3	4.3e-137
WP_069868576.1|2437305_2438058_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	91.6	2.8e-138
WP_058409918.1|2438067_2438406_-|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	83.9	1.1e-54
WP_069868578.1|2438405_2441447_-|tail	phage tail tape measure protein	tail	A0A1B0VMG8	Pseudomonas_phage	43.3	4.2e-201
WP_093114111.1|2441474_2441717_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	57.3	4.4e-21
WP_069868580.1|2441794_2442175_-	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	49.6	2.5e-26
WP_014717917.1|2442177_2442849_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	41.9	3.6e-44
WP_069868582.1|2442918_2443338_-	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	86.9	9.0e-62
WP_069868584.1|2443334_2443931_-	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	52.8	2.4e-52
WP_069868586.1|2443927_2444296_-	hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	94.2	2.4e-58
WP_069868588.1|2444342_2444537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868590.1|2444574_2445078_-	hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	96.4	1.1e-87
WP_069868592.1|2445137_2445725_-	hypothetical protein	NA	A0A1B0VMF7	Pseudomonas_phage	78.1	1.7e-74
WP_069868594.1|2445771_2446734_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	90.3	6.5e-164
WP_019816770.1|2446746_2447475_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	97.1	2.6e-125
WP_074059153.1|2447567_2448023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019816769.1|2447987_2449082_-|head	phage head morphogenesis protein, SPP1 gp7	head	A0A1B0VMF3	Pseudomonas_phage	94.5	1.9e-188
WP_019816768.1|2449056_2450475_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	93.8	3.3e-265
WP_019816767.1|2450471_2451773_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	59.7	6.7e-148
WP_019816766.1|2451759_2452221_-	DUF2280 domain-containing protein	NA	A0A0S2SY97	Pseudomonas_phage	77.2	7.4e-49
WP_069868598.1|2452252_2452876_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	87.0	3.7e-104
WP_019816764.1|2453323_2453764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032872094.1|2453780_2453972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019816762.1|2454345_2454642_-	hypothetical protein	NA	A0A291LAS5	Pseudomonas_phage	35.6	3.9e-11
WP_069868600.1|2454699_2455029_-|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	62.6	3.4e-32
WP_139271882.1|2455244_2455751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019816760.1|2455759_2455945_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	86.8	1.1e-11
WP_069868603.1|2456666_2457302_-	hypothetical protein	NA	A0A0U1VZM0	Pseudomonas_phage	63.4	7.8e-65
WP_069868605.1|2457298_2457814_-	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	45.0	1.8e-35
WP_044483149.1|2457810_2458608_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	68.1	3.4e-94
WP_069868607.1|2458594_2459509_-	helix-turn-helix domain-containing protein	NA	A0A1B0VME0	Pseudomonas_phage	67.2	5.6e-48
WP_081339074.1|2459505_2460093_-	hypothetical protein	NA	A0A1B0VME0	Pseudomonas_phage	66.9	2.3e-39
WP_069868609.1|2460094_2460943_-	Rha family transcriptional regulator	NA	A0A2H4J111	uncultured_Caudovirales_phage	68.0	2.4e-53
WP_069868611.1|2461078_2461504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868613.1|2461584_2461797_-	Rha family transcriptional regulator	NA	H2BD64	Pseudomonas_phage	69.2	2.0e-17
WP_019816751.1|2461879_2462548_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	47.0	1.2e-44
WP_069868615.1|2462826_2463135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069868617.1|2463276_2463690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068967253.1|2463757_2464213_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	45.3	5.8e-22
WP_056847751.1|2464442_2464694_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_069868619.1|2465124_2465364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069868621.1|2465436_2465652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069868623.1|2465792_2466059_+	hypothetical protein	NA	A0A2H4J404	uncultured_Caudovirales_phage	49.4	7.1e-12
WP_069868625.1|2466036_2466267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069868627.1|2466263_2466491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069868629.1|2466594_2467710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069868631.1|2467763_2468756_+	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	55.3	6.4e-66
WP_155766227.1|2468752_2469415_+	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	39.8	1.2e-31
WP_069868635.1|2469417_2469660_+	hypothetical protein	NA	A0A2H4J1H1	uncultured_Caudovirales_phage	63.8	7.3e-16
WP_069868637.1|2469656_2470127_+	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	88.1	8.8e-74
WP_069868639.1|2470196_2470679_+	hypothetical protein	NA	A0A1B0VMB5	Pseudomonas_phage	84.8	3.0e-69
WP_069868641.1|2470704_2471526_-	hypothetical protein	NA	S5W9H2	Leptospira_phage	37.3	4.3e-07
WP_069868643.1|2471634_2472642_+	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	66.3	1.2e-123
WP_069868644.1|2472691_2472892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155766218.1|2473102_2473738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868646.1|2473784_2475275_+	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	47.5	1.5e-106
WP_155766219.1|2475265_2475721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081339075.1|2475802_2476078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155766220.1|2476100_2476385_+	DUF4406 domain-containing protein	NA	S5VWA8	Mycobacterium_phage	52.5	1.1e-15
WP_056786242.1|2476381_2476831_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	63.1	4.7e-16
WP_069868652.1|2477232_2477634_+	HNH endonuclease	NA	A0A1P8DTS4	Salmonella_phage	46.2	6.9e-27
WP_069868654.1|2477683_2478448_+	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	48.7	9.4e-49
WP_069868959.1|2478483_2478726_-	hypothetical protein	NA	A0A2H4J1H6	uncultured_Caudovirales_phage	98.8	3.0e-41
WP_069868656.1|2478851_2479082_+	hypothetical protein	NA	A0A2H4J1L2	uncultured_Caudovirales_phage	80.6	4.7e-20
WP_069868960.1|2479093_2479330_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	73.1	8.2e-28
WP_069868658.1|2479334_2480399_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	75.2	4.4e-145
WP_003192030.1|2480769_2481441_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	94.2	1.3e-107
2480475:2480587	attR	CAAACCCCAGAAACGCAAAAGCCCCGCTTTCGCGAGGCTTTCGTGTAAATCTTGGCGGGAAACCAGGGATTCGAACCCTGGAGACGCTATTAACGTCCGCCGGTTTTCAAGAC	NA	NA	NA	NA
>prophage 4
NZ_CP017296	Pseudomonas fluorescens strain Pt14 chromosome, complete genome	5841722	2502776	2508995	5841722	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
WP_003192069.1|2502776_2503169_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	86.2	3.3e-58
WP_014718891.1|2503170_2503521_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	67.8	2.6e-38
WP_014718892.1|2503520_2503799_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.6	2.4e-26
WP_014718893.1|2503795_2504131_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	78.4	8.0e-45
WP_014718894.1|2504127_2505129_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	86.3	3.5e-168
WP_038450514.1|2505217_2506213_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_014718896.1|2506319_2507714_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_019816715.1|2507714_2508995_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.5	4.1e-97
>prophage 5
NZ_CP017296	Pseudomonas fluorescens strain Pt14 chromosome, complete genome	5841722	4366865	4416950	5841722	protease,holin	Tupanvirus(16.67%)	44	NA	NA
WP_014720226.1|4366865_4367366_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_020302148.1|4367537_4368434_+	acyltransferase	NA	NA	NA	NA	NA
WP_130175537.1|4368467_4368746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020302147.1|4368919_4369492_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_019817428.1|4369628_4370087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014720230.1|4370282_4371482_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.7	1.1e-11
WP_014720231.1|4371665_4372523_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_019817430.1|4372648_4373281_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_019817431.1|4373417_4376435_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_003194855.1|4376431_4376734_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_003176546.1|4376749_4378000_-	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
WP_017738444.1|4378022_4379276_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.7e-100
WP_038451785.1|4379512_4380241_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_014720235.1|4380331_4381372_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_014720236.1|4381565_4381766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014720237.1|4382351_4383452_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_069868813.1|4383734_4385030_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_014720239.1|4385884_4386097_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_038451788.1|4386148_4387369_+	chitin-binding protein	NA	Q9PYT6	Xestia_c-nigrum_granulosis_virus	32.9	8.3e-23
WP_014720241.1|4387442_4388213_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_014720242.1|4388223_4389444_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_019817451.1|4389443_4391387_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_003194876.1|4391524_4393585_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_005792152.1|4393600_4394131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014720245.1|4394209_4395187_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_014720247.1|4395405_4395807_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_032902308.1|4395850_4396813_-	tyrosinase family protein	NA	NA	NA	NA	NA
WP_014720249.1|4397003_4397420_+	DUF3010 family protein	NA	NA	NA	NA	NA
WP_038451791.1|4397451_4398630_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032902306.1|4398698_4399643_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032902304.1|4399838_4400783_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_038451795.1|4400871_4401759_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_014720254.1|4401834_4402800_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_014720255.1|4402902_4403397_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014720256.1|4403620_4403884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003194907.1|4403971_4405075_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_014720257.1|4405603_4406980_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_019817457.1|4407396_4408344_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003194913.1|4408413_4409259_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_014720259.1|4409255_4410434_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.8	3.5e-26
WP_014720260.1|4410591_4412583_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.4	1.5e-18
WP_003194919.1|4412915_4413509_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_014720261.1|4413619_4415092_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014720262.1|4415246_4416950_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.3	2.9e-50
>prophage 6
NZ_CP017296	Pseudomonas fluorescens strain Pt14 chromosome, complete genome	5841722	4479578	4490069	5841722		Bacillus_phage(33.33%)	7	NA	NA
WP_019817747.1|4479578_4479818_-	hypothetical protein	NA	B5TK57	Pseudomonas_phage	56.1	3.5e-10
WP_005792245.1|4480252_4480540_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	50.6	7.1e-18
WP_003195048.1|4480676_4481132_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_038451839.1|4481124_4486944_-	response regulator	NA	W8CYM9	Bacillus_phage	35.9	3.7e-12
WP_038451842.1|4487119_4489171_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	9.3e-19
WP_014720319.1|4489167_4489692_-	type IV pilus biogenesis protein PilI	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	2.0e-05
WP_014720320.1|4489703_4490069_-	response regulator	NA	W8CYM9	Bacillus_phage	33.3	1.1e-12
>prophage 7
NZ_CP017296	Pseudomonas fluorescens strain Pt14 chromosome, complete genome	5841722	5126306	5137464	5841722	tail,integrase	Pseudomonas_phage(83.33%)	16	5130663:5130676	5140042:5140055
WP_069868864.1|5126306_5126891_-|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	62.8	6.5e-58
WP_069868866.1|5126887_5127466_-|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	71.7	3.0e-71
WP_069868868.1|5127474_5127855_-	hypothetical protein	NA	A0A1B0VML3	Pseudomonas_phage	53.7	3.7e-30
WP_069868870.1|5127961_5128570_-	hypothetical protein	NA	A0A1B0VMK2	Pseudomonas_phage	94.1	5.6e-105
WP_069868872.1|5128566_5128875_-	hypothetical protein	NA	A0A1B0VML7	Pseudomonas_phage	95.1	9.0e-51
WP_069868874.1|5129211_5131011_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	99.0	0.0e+00
5130663:5130676	attL	CGCCGCTGCCGCCG	NA	NA	NA	NA
WP_069868876.1|5130997_5131879_-	toprim domain-containing protein	NA	A0A1B0VML8	Pseudomonas_phage	86.3	3.6e-145
WP_060549775.1|5131875_5132103_-	hypothetical protein	NA	A0A1B0VRK9	Pseudomonas_phage	90.7	2.4e-32
WP_060549776.1|5132095_5132383_-	hypothetical protein	NA	A0A1B0VMJ4	Pseudomonas_phage	86.0	6.6e-40
WP_069868878.1|5132489_5132999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868880.1|5132995_5133259_-	hypothetical protein	NA	A0A1B0VMJ2	Pseudomonas_phage	72.3	1.6e-24
WP_069868882.1|5133731_5134406_-	KilA-N domain-containing protein	NA	H6WRU3	Salmonella_phage	55.7	5.6e-29
WP_069868884.1|5134402_5134708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868886.1|5134708_5134975_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069868888.1|5135092_5136091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069868890.1|5136219_5137464_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	42.9	2.4e-78
5140042:5140055	attR	CGCCGCTGCCGCCG	NA	NA	NA	NA
