The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	5111	54216	3187887	transposase,tRNA	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017377815.1|5111_6650_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|6970_7306_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|8118_8412_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|8782_9757_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971645.1|9800_10127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377817.1|10266_10764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|10999_11644_+	porin family protein	NA	NA	NA	NA	NA
WP_053856754.1|11748_12000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|12144_13140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|13217_13646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|13995_14193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|14435_15068_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|15488_16439_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_017377820.1|16435_17968_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|17964_18495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|19582_19810_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|20066_21041_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|21464_22868_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|22901_23690_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|23820_24516_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|25020_25527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|25620_26178_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|26475_27825_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|27911_28169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|28236_28947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|29091_29271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|29794_31054_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|31186_31660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|31668_33051_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|33043_33658_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|33737_34454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|34628_36953_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|37119_38094_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|39257_40766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|40937_42029_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|42061_42700_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|42738_43011_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|43109_43352_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|43369_43672_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|43755_44298_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|44458_45085_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|45090_45930_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|45919_46570_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|46573_47407_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|47496_48624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|48890_49043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|49150_49345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|49537_50188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|50442_51534_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|51530_52895_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|53019_54216_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
>prophage 2
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	64102	113171	3187887	transposase,tRNA	Bacillus_phage(35.71%)	53	NA	NA
WP_017377700.1|64102_64396_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|64512_64662_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|65990_66965_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|67063_67219_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|67137_67398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|67574_68102_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|68356_68581_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|68725_69547_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|69504_69798_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|71274_71562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|72054_72825_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_081329471.1|72894_74307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|74673_76044_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|76040_76205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|76264_76552_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|77583_78174_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|78300_79686_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|79783_79981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|80073_80907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|81444_81798_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|81810_82047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|82046_82253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|82414_83134_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|83222_85007_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|85313_85469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|85395_85650_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|85795_86617_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|86799_87024_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|87129_88533_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|89097_89286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|89415_89682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|90067_91708_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|91820_93170_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|93166_94036_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|94960_96274_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|96270_97041_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|97037_97265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|97969_99130_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|99098_99695_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|100663_100891_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|101858_102263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048063.1|102266_103262_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|103247_104450_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|104376_104991_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|105687_105849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|106128_106674_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|106707_107373_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|107432_108389_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|108667_109345_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|109387_109969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|110113_110785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|111387_111975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|112943_113171_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 3
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	124853	156530	3187887	transposase,tRNA	Staphylococcus_phage(50.0%)	29	NA	NA
WP_017377787.1|124853_125081_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377716.1|125215_126679_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|126681_127734_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377714.1|127723_128179_+	arginine repressor	NA	NA	NA	NA	NA
WP_017377713.1|128203_128761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377712.1|128873_129185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927332.1|129314_130097_+	lipoprotein	NA	NA	NA	NA	NA
WP_144420768.1|130109_131045_-	EamA family transporter	NA	NA	NA	NA	NA
WP_017377709.1|131176_131380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242901.1|131720_132410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|132436_132754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|132771_132984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|133937_134165_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|135322_136084_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|138274_139249_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|139373_140810_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|140889_142350_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|142470_142758_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|142955_143999_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|144014_144914_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|144910_145429_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|145498_146116_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|146125_147613_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|147622_151303_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|151376_152186_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|152185_152866_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|153490_154465_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|154507_155503_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|155555_156530_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 4
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	191981	333486	3187887	integrase,transposase,tRNA,protease	Staphylococcus_phage(15.38%)	113	317105:317164	333262:333758
WP_017376198.1|191981_193442_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|193477_195007_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|195040_196444_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|198355_200170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|200254_201658_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|201803_203207_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|203691_204666_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|205134_206025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|206685_207522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|207810_210483_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|210731_211922_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|212254_212449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|212385_214038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|214638_215865_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|216260_216806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|216765_217143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|217139_218543_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|218761_219187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|219238_220726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|221035_221575_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|221864_222092_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|223337_223913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|224026_225430_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|225426_225717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|226084_226498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|227186_228974_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|229140_229761_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|230107_230248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|230267_232244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|232616_234074_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|234142_235723_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|236363_240260_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|240266_240590_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|240663_241137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|241168_242164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243012.1|242415_244053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|244412_245360_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|245678_246023_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|246116_246788_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|246828_247656_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|247742_248270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|249155_249575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|249684_250266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|250620_251901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|252021_252885_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|252973_253768_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|254005_254992_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|254997_256524_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|256619_257864_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|257917_259297_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|259414_260200_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|260542_261187_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|261221_263027_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|263050_263626_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|264675_265650_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|268186_268864_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|270362_270584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|271464_271626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|271562_272063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|272158_272587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|272846_273296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|273348_273783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|273759_274725_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|274943_275204_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|275298_276033_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|276061_276214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|276418_277363_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|277348_277777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|277921_278173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|278560_279469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|279932_280898_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|280942_281518_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|281548_282823_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|283471_284188_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|284266_285004_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|285124_286480_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|286659_287331_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|287446_288322_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|288922_290227_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|290339_290945_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|291026_292328_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|292395_294828_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|294931_295204_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|295286_297185_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|297216_298101_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|298109_298505_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|298928_301076_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|301047_302397_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|302393_304514_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|304510_306214_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|306348_307491_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|307547_308576_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|308702_310217_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|310323_310524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|310668_311004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|311148_311385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|311655_312534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|313170_314115_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|314388_315792_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|315796_316582_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|316972_317815_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
317105:317164	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|317811_318108_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|319589_320201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|320269_321076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|321379_322354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|322525_324418_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|324990_327306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|327720_329124_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|329564_330044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|330111_331368_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|331514_332039_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|332443_332584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|332781_333486_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
333262:333758	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
>prophage 5
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	337948	477956	3187887	transposase,tRNA,protease	Staphylococcus_phage(20.0%)	116	NA	NA
WP_048875878.1|337948_339352_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|339821_340799_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|340895_342356_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|342382_343036_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|343160_343727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|344023_345757_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|345828_347535_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|347526_348585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|348838_349687_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|350281_350728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|351417_352830_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|353221_354664_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|354795_354864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|355062_356394_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|356498_357473_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|357522_358227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|358667_359480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|359538_362049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|362394_363570_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|364917_365142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|365170_366334_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|368576_369722_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|370314_371250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|372747_373059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|373055_374138_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|374453_374660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|374757_375288_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|375575_376754_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|376902_380667_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|380725_382228_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|382779_383415_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|383926_385174_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|385396_386833_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|387008_388226_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|388687_389467_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|390185_391160_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|392205_392517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|392513_393596_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|393906_394113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|395833_397195_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|397305_397677_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|397899_398550_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|398592_399675_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|400401_401376_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|402246_402474_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|404654_406208_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|406996_407233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|407352_408396_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|408642_409044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|409217_410117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|410511_411723_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|411733_411958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|412279_412444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|412536_413940_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|414106_414415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|414699_414870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|415498_416548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|416616_417639_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|417684_418599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|419567_419795_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|419751_420621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|422058_422775_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|423219_425091_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|425182_426928_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|427007_427457_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|427509_427725_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|427971_428988_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|429036_429666_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|430006_431218_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|431250_431601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|431566_432247_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|432523_432943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619425.1|433088_433775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774346.1|433919_434213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|434256_435231_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|435250_435886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|436129_437131_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|437229_438438_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|438427_440158_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|440341_441478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|442222_442858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|442972_444307_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|444435_445077_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|445382_445805_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|446082_447045_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|447083_448259_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|448347_450048_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|450047_451586_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|451625_453278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|453351_454107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|454293_455169_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|455433_455628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|455772_456246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|456515_456689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|456893_458207_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|458203_458848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|459366_460554_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242844.1|460734_461376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|461449_462799_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|462902_465083_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|465152_466028_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|466074_466371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|466494_466902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|466881_467460_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|467882_468545_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|468575_468944_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|468954_470271_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|470517_471129_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|471204_471384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|471554_471848_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|472088_472391_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|472445_474719_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|474778_475024_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|475148_475904_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|476012_476987_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|477194_477956_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	483807	537419	3187887	transposase,tRNA	unidentified_phage(16.67%)	56	NA	NA
WP_017376080.1|483807_484596_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|484592_485804_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|485796_486153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|486247_486676_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|486827_487937_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|487933_488662_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|488719_489607_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|489691_490066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|490165_491443_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|491454_492186_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|492157_493414_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|493523_494927_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|495079_495250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|496655_497486_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|497713_497863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|498057_498879_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|498875_499769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|499814_500336_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|500413_500899_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|501032_501689_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|501685_501994_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|502342_503314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|503618_504410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|504399_505263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|505289_505709_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|505761_506718_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|507200_509873_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|509953_510580_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|510736_512335_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|512424_513846_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|513876_514398_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|514394_515000_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|515076_516087_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|516199_516904_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|516938_517370_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|517372_518467_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|518526_519879_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|519914_520556_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|520628_521528_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|521530_522178_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|522228_523032_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|523213_523429_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|523432_523666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|523727_525320_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|525522_526452_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|526453_527221_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|527586_528357_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_036771330.1|528415_529390_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|529497_529860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|530029_531739_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|531979_533383_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|533434_533692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048058.1|533997_534180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|534728_536036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|536495_536873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|537017_537419_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	547811	599575	3187887	transposase,protease	Burkholderia_virus(28.57%)	41	NA	NA
WP_048875961.1|547811_549215_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|549334_549964_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|550202_550922_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|551035_554575_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|554641_555472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773465.1|555458_557498_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|557513_558569_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|558579_559110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|561267_562188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|562332_562473_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|563361_563745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|563754_564114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|565048_565195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|565433_566690_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|566945_567125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|567444_568098_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|568302_568629_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|569400_570804_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|570974_572345_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|572391_573291_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|573271_576076_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|576155_576752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|577165_577921_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|578010_578238_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|579354_579996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|580265_581591_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|581587_583645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|583622_584195_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|584277_584610_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|584674_585709_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|585696_586818_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|586911_587895_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|588051_589719_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|590005_590857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|591265_593734_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|593747_594722_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|594708_595977_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|596010_597759_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|597938_598142_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|598360_599038_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|599317_599575_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 8
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	639763	673745	3187887	transposase,tRNA	uncultured_Mediterranean_phage(40.0%)	29	NA	NA
WP_051929562.1|639763_640468_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|640718_641693_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|642580_645307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|645830_646805_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|647002_648484_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|648943_649606_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|649847_651080_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|651236_654008_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|654076_654520_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|654672_656145_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|656256_657318_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|657314_658349_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|658351_659392_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|659576_660692_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|660730_661084_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|661104_662973_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|662994_663939_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|664172_664451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|664813_665452_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|665426_666851_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|667051_667729_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|667849_669124_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|669191_669947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|669998_670916_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|671050_671221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|671340_672120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|672172_672460_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|672519_672870_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081078111.1|672992_673745_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	683491	742191	3187887	transposase	Escherichia_phage(20.0%)	50	NA	NA
WP_017375910.1|683491_684220_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|684622_685351_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|685414_686242_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|686423_686792_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|686788_687607_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|687707_688523_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|688806_690867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|690863_691289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|691474_692968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|693100_693916_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|694011_694428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|694810_695350_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|696266_696428_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|697139_698201_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|699691_700045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|700253_701966_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|702412_704266_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|704368_704701_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|704731_705328_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|705324_706449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|706560_707208_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|707259_709173_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|709377_710415_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|710473_713800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|714506_715475_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|715604_716093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|716534_716768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|717077_717266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|717754_718240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|718510_718780_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|718814_720140_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|720195_720843_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|721036_722995_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|723138_726069_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|726874_728278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|729718_730504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|730594_732244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|732388_733234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|733347_734751_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927801.1|734747_735194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|735199_735406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|735435_736095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|736113_736989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|737124_738114_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|738090_738852_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_144420659.1|738884_739664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|739940_740576_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|740572_740737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|740935_741910_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_081329472.1|741945_742191_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	804328	844734	3187887	transposase,tRNA	Tupanvirus(22.22%)	38	NA	NA
WP_017378228.1|804328_805249_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|809412_809556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|810165_810984_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|811091_811553_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|811569_812493_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|812516_813566_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|813703_814297_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|814319_814790_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|814899_816150_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|816838_817303_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|817741_819214_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|819330_819783_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|819907_820063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|820207_820411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|820601_821000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|821185_821791_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|821799_822096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|822100_822637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875985.1|822781_823387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|823430_824405_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|824401_824899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|825306_825723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|825790_827194_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|827190_827811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|828082_829057_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|829221_829845_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|829841_831782_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|831937_832591_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|832759_833935_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|834288_835614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|835706_836495_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|836596_837469_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|837655_838918_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|838991_839522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|839543_841049_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|841061_841727_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|841820_843581_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|843858_844734_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	850400	955827	3187887	transposase,tRNA,protease	Burkholderia_phage(13.04%)	95	NA	NA
WP_017376460.1|850400_852995_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|853301_853565_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|853937_854813_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046597.1|854927_855104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376465.1|855648_857211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772167.1|857752_858700_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376467.1|858919_860395_-	APC family permease	NA	NA	NA	NA	NA
WP_017376469.1|860914_861937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|862293_863661_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|863936_864191_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|864239_865493_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|865512_866727_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|866726_867620_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|867817_869116_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|869205_870483_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|870496_872896_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|872892_873651_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|873827_874217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|876339_876627_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|876992_877784_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017375672.1|878442_878934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|878922_879651_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|879669_880527_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|880532_881786_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|881819_883688_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_052106215.1|883674_884913_-	MFS transporter	NA	NA	NA	NA	NA
WP_080963599.1|884897_886745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377461.1|886729_887935_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|887946_890136_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|890704_891334_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|891356_891776_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_027242816.1|891768_892173_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|892172_893015_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|893070_894051_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|894031_896029_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|896046_897222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|897503_898907_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|899055_899418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|899589_899808_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|900353_902381_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|902462_903713_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|904012_904348_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|904659_904908_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|904943_905453_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|905452_906232_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|906249_906597_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|906706_906982_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|907143_907500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|907898_908234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|908438_909215_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|909171_910044_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|910328_910616_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|910699_911419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|911549_912158_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|912963_913938_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|914017_914395_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027242786.1|914493_915585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|917257_917755_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|917899_918298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|918383_919289_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|919507_919828_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_036773204.1|919909_920683_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|921259_922093_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|922122_922977_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|923353_924364_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|924508_924766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|924879_926136_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|926391_926571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|927064_927307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|927332_928691_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|928972_929332_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|929763_931398_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|931404_932241_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|932262_933540_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|933626_933944_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377576.1|933966_935058_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|935248_936838_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|936898_937672_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|937842_938892_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_036816899.1|939620_939812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|940641_941418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420668.1|941618_941930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|942022_942988_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275315.1|944199_944454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|944860_945103_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875996.1|945115_945991_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036816928.1|946317_946758_-	universal stress protein	NA	NA	NA	NA	NA
WP_081000007.1|948341_948746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999986.1|948907_949105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|949308_950283_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017377185.1|950631_951570_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|951633_953628_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_026063604.1|953630_954227_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_017377182.1|954223_954562_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_036774017.1|954951_955827_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1014162	1029733	3187887	transposase	unidentified_phage(25.0%)	15	NA	NA
WP_048876002.1|1014162_1015146_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1015945_1017099_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1017220_1017913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1017921_1019109_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1019258_1019885_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1019930_1021160_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1021354_1021801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1021992_1023351_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1024016_1024190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|1024319_1025237_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1025578_1026238_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1026318_1026822_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1026794_1027082_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1027374_1028496_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1028758_1029733_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 13
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1044720	1233858	3187887	protease,transposase,tRNA,integrase	Staphylococcus_phage(17.07%)	170	1064903:1064962	1092368:1093362
WP_036771330.1|1044720_1045695_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1045770_1046088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275321.1|1046091_1046460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|1047193_1048162_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1048371_1049784_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1049971_1050685_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1050705_1051119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1051219_1052293_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1052429_1053329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1053584_1053836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1053884_1054520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|1054644_1055502_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_048876031.1|1055689_1057093_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1057268_1057772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1057848_1059150_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1059318_1060419_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1060769_1061012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1061005_1061323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1062545_1062773_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|1063383_1063854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1064076_1064376_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1064372_1064618_-	hypothetical protein	NA	NA	NA	NA	NA
1064903:1064962	attL	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGAT	NA	NA	NA	NA
WP_144420679.1|1064910_1065867_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375591.1|1066151_1066355_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1066485_1067514_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1067877_1068123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1068485_1069460_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1070931_1072638_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|1072683_1073535_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1073737_1076194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1076713_1077115_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1077701_1078676_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1078716_1080045_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1080308_1080878_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1080893_1081205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1081214_1082183_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1082315_1082669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1082672_1083737_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1083737_1085477_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1085483_1085906_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1085889_1086519_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1086754_1086853_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1086885_1088757_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1088904_1089879_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_017378522.1|1089922_1090102_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1090275_1091619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1092375_1093332_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1093658_1094042_+	hypothetical protein	NA	NA	NA	NA	NA
1092368:1093362	attR	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTACCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGCGTGATGGTGCTTACGCTTAGTTGTCACTTTATAAGCTTTACGTTGCAGCACCTTTAAACCGAGTTTTTGCATTAGGCTTCTCGCCCGATAACGGCCTACTTGAAAGCCTTCTTCTTGAAGTTTATATGCCATCATTCGTGATCCTAAGCTGCCGCGACTTTCTTTAAAAAGCTCCTTACAGCGCCGATAAAGCTGAAGCTCTTCAATTGAAATCACTTTAGCAGGCCGCTTGTCCCAAGCATAAAAGGCAGAACGGCTTACCTTCATCACTTTACAGGTCAGATTAATAGGATATAACACTTTGTTCTTCCGAATAAAATTAAATTTTACTTCATTTCTTTCGCGAAGAAGGCACTCGCCTTTTTTAAAATTTCTTTCTCCATCTGCAGTTGCTTTACTTTCTTTCGCAGGGATTGAAGCTCAGCCTTTTCATCAGGAGTCAGA	NA	NA	NA	NA
WP_144420680.1|1094057_1094978_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|1095293_1096169_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1096170_1096335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1096625_1097501_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1097502_1097667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|1097846_1098032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1098075_1099050_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_027242577.1|1099046_1100348_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|1100365_1100902_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376785.1|1101364_1102270_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|1103676_1103838_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|1104372_1104582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|1105697_1107011_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|1107246_1108392_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243097.1|1108457_1108643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1108678_1109311_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|1109487_1110144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1110132_1112418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|1112691_1113051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|1113332_1113968_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|1115155_1115980_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|1116035_1117247_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|1118030_1118738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1118800_1118980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243093.1|1119041_1119359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|1119471_1120215_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|1120228_1121272_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|1121410_1123180_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1123404_1124538_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1125387_1128207_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1128581_1129307_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|1131901_1132462_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|1132666_1132999_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1133058_1133346_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1133998_1135024_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1135151_1136126_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1136320_1137274_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1137443_1137692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1137874_1138399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1138853_1139681_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1139749_1139935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1140135_1140594_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1140734_1140962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1141126_1142512_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1142807_1143122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1143230_1144856_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1145268_1146258_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1146579_1146765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1147154_1149110_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1149181_1149304_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1149346_1150321_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|1150543_1151005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|1151389_1152187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772310.1|1152652_1154458_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_027243044.1|1154545_1155892_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075275422.1|1158529_1158961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772316.1|1159112_1159856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377201.1|1161503_1161974_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_017377202.1|1162535_1163138_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_027243048.1|1163907_1165395_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377206.1|1165456_1166914_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_065653751.1|1166950_1167415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1167442_1168021_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_017377209.1|1168291_1170109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1170085_1171135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1171334_1171712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1172901_1173189_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1173248_1173545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1173689_1174346_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1174585_1174966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1175617_1177021_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1177017_1177299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1177693_1178158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1178338_1178932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1179117_1180092_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1180495_1181320_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1181394_1182543_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1182558_1184187_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|1184530_1185724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1191838_1192339_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1192752_1192893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1193015_1194476_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1194553_1195036_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1195194_1196460_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1196544_1197804_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1197875_1198148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1198485_1198821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1199181_1199430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1199700_1200111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1200255_1200792_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1200802_1200988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1201423_1202395_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1202376_1203348_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1203461_1204235_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|1204505_1204835_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|1205090_1205609_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1205661_1205889_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|1206870_1207746_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1207937_1208315_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1208874_1209924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1210237_1211623_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1211629_1213168_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1213210_1213936_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1214106_1215339_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1215538_1216360_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1216409_1217219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1217374_1221241_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1221406_1222282_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1222346_1222625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1222769_1223345_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1223393_1223552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1224300_1225017_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1226145_1226562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1227476_1228406_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1228377_1228536_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1228684_1228999_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1229908_1230892_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1231042_1231390_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1231389_1231989_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1232363_1232702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|1232520_1232910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|1232913_1233858_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1252825	1386195	3187887	transposase	Staphylococcus_phage(28.57%)	113	NA	NA
WP_036772026.1|1252825_1253701_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1253738_1254653_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1254717_1255347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1255391_1255826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1255806_1256547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1256560_1257958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1257960_1260909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1260908_1262630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1262644_1263049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1263049_1265929_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1265931_1266654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971655.1|1267015_1268908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1268939_1271480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|1271511_1272675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|1272680_1273304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1273318_1274818_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1274834_1275341_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1276596_1276668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1276850_1277033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1278234_1278507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1278522_1279956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1280100_1281366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1281651_1283403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|1283415_1284579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|1284582_1284879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1284918_1285146_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|1287014_1287989_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1288047_1288311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1288320_1289634_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1289838_1290012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1290079_1290223_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1290241_1290439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1290456_1290963_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1291885_1292761_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242571.1|1292826_1293075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378158.1|1293240_1296321_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017378159.1|1296338_1297391_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378160.1|1297914_1298565_+	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1298898_1299543_+	porin family protein	NA	NA	NA	NA	NA
WP_017378162.1|1299881_1300421_+	porin family protein	NA	NA	NA	NA	NA
WP_144420698.1|1300935_1301097_+	phosphatase	NA	NA	NA	NA	NA
WP_075275334.1|1301245_1301539_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377970.1|1302313_1302505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|1302553_1302793_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_144420699.1|1303128_1303458_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_026063694.1|1303547_1304132_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_017377966.1|1304267_1304954_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|1305077_1306262_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|1306477_1307920_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242961.1|1308059_1309010_+	DMT family transporter	NA	NA	NA	NA	NA
WP_048876021.1|1309108_1309882_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_017377960.1|1309885_1310635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1310707_1312177_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027242964.1|1312491_1313064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773041.1|1313172_1314672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242965.1|1314993_1317426_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017377953.1|1317994_1319191_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_017377952.1|1319238_1321605_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_144420700.1|1322229_1322379_+	phosphatase	NA	NA	NA	NA	NA
WP_048876022.1|1322516_1323368_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1323780_1324934_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1325024_1326128_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1326467_1326968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1327664_1328018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1328318_1330046_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1330149_1330875_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1330867_1332106_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1332243_1333281_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|1333335_1334238_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|1334347_1335601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1335658_1339150_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1339266_1339944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1340071_1340620_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_048875857.1|1340844_1341819_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375873.1|1342490_1342652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1343843_1344410_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1344412_1345537_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1345621_1346440_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1346570_1348550_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|1348609_1349263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1349947_1351318_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1353033_1353681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1353718_1354111_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1354363_1355110_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1355708_1356614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1356729_1357704_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1357849_1358578_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1358697_1359279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1359301_1362142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1364184_1365135_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1365217_1366000_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|1366098_1366392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1366914_1367559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1367592_1368237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1368285_1369140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1369277_1369790_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1369857_1370052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1370265_1370619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1371827_1372802_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1373549_1374251_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|1374325_1374985_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1375122_1376379_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1376653_1377316_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1377305_1378538_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1378669_1379287_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1379364_1379871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1379881_1380109_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|1381391_1381658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1381887_1383006_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1383150_1383486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1383496_1383910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1385118_1385283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1385319_1386195_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1395623	1521002	3187887	transposase,tRNA	Staphylococcus_phage(23.53%)	109	NA	NA
WP_048876030.1|1395623_1396727_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1396796_1397672_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1397668_1398013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|1398022_1398484_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1398497_1399889_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1399930_1402918_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1402987_1403821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|1403875_1405063_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1405050_1405755_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1405800_1406586_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1406613_1407351_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1407455_1409651_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1409725_1410409_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1410419_1410851_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1410896_1411295_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1411671_1412379_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1412443_1412740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619421.1|1412778_1413258_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1413311_1413833_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1413914_1415009_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1415975_1417379_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1417548_1418112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1418247_1419723_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1419729_1419936_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1419993_1421064_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1421261_1423232_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1423592_1425152_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1425748_1426105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1426945_1427605_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1427700_1429062_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1429203_1429431_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|1430482_1431823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1432473_1432635_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|1432734_1433562_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|1433915_1434791_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1434834_1435809_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1435828_1436017_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242753.1|1436661_1437204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242754.1|1437484_1437838_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242755.1|1437830_1438976_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242756.1|1439386_1440634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242757.1|1440771_1441155_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242758.1|1441151_1441883_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242759.1|1441885_1442629_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_144420798.1|1442642_1443542_-	GTPase Era	NA	NA	NA	NA	NA
WP_027242761.1|1443547_1444222_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|1444384_1444606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910649.1|1444633_1445575_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|1445571_1447374_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_027242764.1|1447683_1448253_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242765.1|1448407_1449982_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155052681.1|1449989_1450343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242767.1|1450428_1450674_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080963649.1|1450715_1451753_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242769.1|1451899_1452226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082328.1|1452235_1452373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1452382_1452793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420703.1|1452935_1453259_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_062365727.1|1453519_1454212_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|1454208_1454352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1455695_1455923_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375766.1|1457229_1459260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1459326_1460352_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|1460344_1461391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|1461531_1462527_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|1462824_1463463_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|1464176_1465364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|1465529_1466483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|1466505_1468524_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|1468612_1468936_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|1469184_1469361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|1469588_1470308_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|1470923_1471307_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|1471951_1472425_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|1472530_1473901_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|1474016_1474748_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|1474772_1475870_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|1475905_1477324_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|1477533_1477986_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1477997_1478225_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|1478274_1478601_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|1478804_1479494_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|1479642_1480131_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242781.1|1480171_1481275_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|1481317_1482400_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|1482392_1482953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|1482943_1484248_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_146619547.1|1484301_1484901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|1484902_1485880_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929890.1|1485898_1486447_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|1486471_1487488_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929892.1|1487920_1491043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|1491439_1492063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|1492845_1494396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|1494690_1495446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1496154_1497129_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|1500037_1500709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1501787_1503191_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|1504778_1508180_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|1508176_1510870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|1511173_1512673_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|1513339_1514161_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|1514232_1514718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1514866_1516270_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|1516266_1517337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|1517582_1519757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1519779_1520460_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|1520488_1520689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1520774_1521002_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 16
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1532038	1598941	3187887	transposase	Acinetobacter_phage(25.0%)	59	NA	NA
WP_075275340.1|1532038_1532647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1533177_1534053_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|1534293_1534968_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1534996_1535485_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|1536530_1536965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1537170_1538253_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|1538249_1538561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927811.1|1538808_1540320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|1541280_1541574_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|1541531_1542110_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|1542195_1543071_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1543063_1543420_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|1543428_1543824_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|1545148_1545709_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|1546831_1548721_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|1548755_1549961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|1549963_1551262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|1551242_1552466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|1552515_1553316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|1553312_1553711_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|1553707_1554016_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1554409_1555138_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|1555178_1555823_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|1555835_1556303_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1556357_1557332_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|1557361_1557979_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1557957_1558419_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|1558462_1559398_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|1559425_1560421_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|1560634_1561597_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|1562736_1563465_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|1563515_1565150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1565420_1566608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|1567209_1567647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1570180_1570453_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|1570528_1570837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|1573312_1573630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1573786_1574761_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|1574757_1575147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|1575227_1575974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1575942_1576671_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|1577415_1577703_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|1577762_1577927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|1577923_1579327_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1579359_1580121_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|1580406_1581123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1581900_1582806_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|1583292_1584585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1584820_1587571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|1589209_1589677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1589677_1590379_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|1590640_1590823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|1591076_1591451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|1591560_1593552_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|1593541_1594588_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|1595028_1595880_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|1595880_1596798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|1597193_1597367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1597969_1598941_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1607036	1658825	3187887	transposase,tRNA,protease	Burkholderia_virus(22.22%)	47	NA	NA
WP_036771330.1|1607036_1608011_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|1608277_1608547_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|1608691_1609648_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|1609808_1610735_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|1611030_1611792_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|1611993_1612605_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|1612625_1613825_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|1613919_1614060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1614072_1614477_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|1614707_1615277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|1615343_1616384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1616410_1616638_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|1617688_1618546_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|1618542_1619304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|1619388_1622118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|1622251_1623127_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242874.1|1623391_1624366_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|1624794_1625508_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|1625676_1626168_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|1626307_1626799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|1627001_1627892_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|1628276_1628861_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|1628941_1629880_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|1629931_1631026_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|1631150_1632473_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|1632520_1637407_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|1637501_1637804_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|1637914_1639837_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|1639858_1641154_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|1641150_1642761_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|1642867_1643761_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|1643870_1644494_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|1645200_1645899_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|1646042_1646612_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|1646927_1647554_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|1647750_1648497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|1648592_1649432_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|1649482_1649830_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|1650020_1650908_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|1651022_1651625_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|1651621_1652341_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|1652409_1654122_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|1654269_1656207_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|1656319_1657369_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|1657368_1657644_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|1657724_1658273_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|1658597_1658825_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 18
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1683719	1728155	3187887	transposase	Staphylococcus_phage(50.0%)	41	NA	NA
WP_036771330.1|1683719_1684694_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|1685009_1685171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1685167_1686571_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|1686684_1687452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365735.1|1687810_1689214_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|1690034_1690235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|1690475_1691921_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|1693116_1693992_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|1695443_1695725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|1695943_1696123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|1696282_1697302_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|1697288_1697711_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|1697712_1698186_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|1698311_1698968_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|1698964_1699639_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|1699644_1700793_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|1700789_1701251_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|1701326_1702577_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|1702703_1704383_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|1704494_1705376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|1706618_1707212_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|1707573_1708089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|1709028_1709313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|1709862_1710138_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1710510_1711485_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|1711641_1712280_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|1712361_1712760_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|1712912_1713230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|1713308_1713563_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|1713715_1715377_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|1715437_1716121_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|1716120_1717206_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377751.1|1717247_1719884_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_155051395.1|1720863_1721007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|1721688_1723008_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|1723011_1723728_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|1723724_1724366_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|1724358_1724493_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|1724741_1725197_-	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_027242980.1|1725288_1725633_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|1726751_1728155_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1783073	1829781	3187887	transposase,tRNA	Synechococcus_phage(20.0%)	41	NA	NA
WP_048875859.1|1783073_1783868_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|1784157_1785081_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|1785348_1785642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|1786844_1787768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|1787903_1788746_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|1788833_1789484_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|1789497_1790538_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|1790660_1791746_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|1791772_1792882_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|1793186_1793504_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|1793500_1793860_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|1793962_1796695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|1798184_1798862_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|1799108_1799327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048033.1|1799471_1800680_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|1801107_1802565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|1803400_1803676_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|1806379_1806559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|1806555_1806927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1806937_1808020_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|1808016_1808238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|1809223_1809442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1809932_1810199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|1810457_1810778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|1812163_1813414_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|1813402_1814284_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|1814276_1815362_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|1815358_1816618_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|1816786_1817446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|1817616_1818279_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|1818625_1819573_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|1819669_1820296_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|1820301_1820883_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|1820954_1822046_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|1822135_1822849_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|1822942_1823767_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|1824000_1824678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|1826355_1826613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1827013_1827988_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|1828162_1828807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|1828986_1829781_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1835476	1871755	3187887	transposase,protease	Acinetobacter_phage(25.0%)	34	NA	NA
WP_087910651.1|1835476_1835653_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|1835948_1836383_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|1836576_1838046_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|1838039_1839416_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|1839428_1839821_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|1839817_1840921_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|1841099_1842392_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|1842402_1843350_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|1843361_1844174_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|1844176_1844956_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|1844970_1846029_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|1846025_1847036_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|1847042_1847240_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|1847300_1850207_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|1850248_1851100_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|1851182_1851728_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|1851825_1852686_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|1852777_1853194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|1853275_1853782_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|1853827_1856779_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|1856800_1857133_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|1857250_1857760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|1858293_1858449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|1859523_1860690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|1860834_1861587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1861942_1862917_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|1863049_1863760_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|1863756_1864791_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|1864894_1865236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|1865746_1866907_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|1866875_1867472_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|1868440_1868611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1868607_1869582_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|1870601_1871755_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 21
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1916886	1982785	3187887	transposase,tRNA,plate	Staphylococcus_phage(18.18%)	57	NA	NA
WP_027242858.1|1916886_1918194_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|1918198_1918909_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|1918921_1922092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|1922158_1923295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|1924157_1925015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|1925156_1925957_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|1926055_1926631_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|1926713_1927385_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|1927430_1928330_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|1928364_1928748_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|1928897_1929728_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|1929652_1930363_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|1930359_1931385_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|1931515_1934020_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|1934026_1935295_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|1935296_1936280_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|1936292_1937114_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|1937158_1937551_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|1937625_1938432_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|1938619_1939048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1939106_1940081_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|1940104_1940542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1940576_1941980_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|1942560_1942722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|1943942_1944314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|1944421_1945972_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|1946004_1946844_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|1946840_1947356_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|1947359_1948352_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|1948730_1950101_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|1950309_1951449_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_062365741.1|1951662_1952265_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.0e-10
WP_036816881.1|1952948_1953167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052676.1|1953205_1953493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|1959148_1959829_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|1959893_1961180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|1961781_1962051_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|1962234_1963206_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|1963273_1964248_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|1964345_1965422_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|1965502_1966495_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|1966499_1968302_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|1968319_1969621_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|1969636_1970920_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|1971052_1971445_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|1971551_1972637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|1972852_1973869_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|1973871_1974879_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|1974882_1976037_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|1976051_1976414_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|1976410_1978126_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|1978225_1978900_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|1978928_1979333_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|1979357_1980317_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|1980449_1981232_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|1981333_1982293_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|1982437_1982785_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	1986786	2050558	3187887	transposase	Planktothrix_phage(10.0%)	51	NA	NA
WP_144420814.1|1986786_1987704_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875984.1|1987848_1988385_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|1988644_1989547_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|1990536_1991526_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|1991694_1992033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|1992029_1992605_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|1992653_1992869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|1993055_1993895_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|1997591_1998500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|1998630_1999287_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|1999395_2000322_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2000640_2001201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2001670_2002990_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2003057_2003924_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2003916_2004792_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2004850_2005069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2006469_2006799_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377043.1|2007717_2009946_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2010208_2011222_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2011330_2011552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2011556_2013194_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2013332_2013866_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2013986_2015105_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|2015097_2016420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2016406_2017543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2017773_2018199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2021528_2021882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2021916_2022792_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2022948_2023353_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2023500_2024676_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2024935_2025439_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|2025478_2026963_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|2027186_2028140_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2028120_2029212_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2029514_2029757_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155048025.1|2030657_2030843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2030824_2031400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2032274_2032547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2032699_2032954_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2033068_2034472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2034556_2035063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2035627_2037448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2037514_2038045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2039591_2040308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2040350_2040788_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2040825_2042205_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2042599_2044594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2045058_2045871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2046054_2047518_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2047877_2049257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2050009_2050558_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 23
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2082349	2125709	3187887	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|2082349_2083324_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2083320_2083758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2083932_2085336_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2085346_2085622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2085899_2086370_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2086672_2088043_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2088372_2088840_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2088852_2089863_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2090064_2091468_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2091894_2092683_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2092669_2093698_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2093675_2094080_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2094307_2096275_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2096470_2096962_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2096996_2097839_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2097884_2098337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2098626_2099259_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2099259_2100510_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2100543_2101641_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|2101970_2103356_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2103395_2103653_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|2106068_2107472_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2107468_2108509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2108901_2109297_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2109293_2110082_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2110267_2110993_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2111237_2112425_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2112717_2113260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2113256_2113943_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2113946_2114558_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2114604_2115624_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2115726_2116521_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2116534_2117335_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2117413_2118463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|2118638_2119919_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2119964_2120642_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2120727_2121009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2121100_2121955_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|2121894_2122293_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2122820_2123762_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2124480_2124702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|2124698_2125709_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2178402	2214342	3187887	transposase	Staphylococcus_phage(16.67%)	31	NA	NA
WP_053856766.1|2178402_2179806_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|2179925_2180564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2180911_2181886_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2182194_2183220_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|2183327_2184530_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2184767_2185181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2185682_2186252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2186254_2186593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2186585_2187119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2187137_2187428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2187514_2189146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2189698_2190202_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2190164_2190872_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2190936_2191797_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2191777_2192551_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2192581_2193820_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2193819_2194782_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2194825_2195578_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2198106_2198343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2198361_2198811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2199031_2200456_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_052106221.1|2200520_2201570_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2201860_2202592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2202622_2203513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2204855_2207666_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2207958_2208984_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|2209367_2210225_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2210394_2211123_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2211323_2212727_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2212872_2213370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2213439_2214342_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2237550	2277766	3187887	transposase,tRNA,protease	Staphylococcus_phage(42.86%)	44	NA	NA
WP_069971662.1|2237550_2238525_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2238808_2240011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2240307_2240565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2240522_2240963_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2241068_2241635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2241779_2242034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2242178_2243048_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063584.1|2243569_2244529_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2244525_2245173_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2245201_2246053_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2246067_2247345_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2247385_2247901_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2247978_2249040_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2249061_2250150_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2250194_2252030_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2252072_2252543_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2252579_2252915_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080963574.1|2252927_2253644_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2253580_2254621_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2254593_2255073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2255159_2257640_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2257702_2258134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2258334_2258625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2258684_2260283_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2260447_2260783_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2260811_2262476_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2262475_2263117_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2263116_2263860_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2263918_2264155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2264305_2265673_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2265683_2266235_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2266315_2267419_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2267420_2269178_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2269400_2270024_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2270078_2270498_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2270638_2271253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2271310_2272096_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2272727_2273744_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2273746_2274259_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2274300_2274774_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2274829_2275615_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2275658_2276399_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2276488_2276737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2277112_2277766_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2365163	2477225	3187887	transposase,tRNA,protease	Staphylococcus_phage(12.5%)	102	NA	NA
WP_017378106.1|2365163_2366108_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2366107_2366461_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2366509_2369185_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2369201_2370719_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2370795_2371248_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2371466_2372906_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2372905_2374444_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2374458_2376429_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2376432_2376738_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2376761_2377385_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2377404_2377893_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2377906_2378932_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2378936_2381330_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2381379_2382669_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2382675_2383176_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2383175_2384429_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2384430_2385108_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2385125_2385611_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2385601_2385970_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|2386648_2387011_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2387024_2387786_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2388087_2389434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2389530_2390073_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2390188_2391022_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2391043_2391637_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2391812_2392832_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2393102_2393504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2393514_2393838_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2393861_2394872_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2394938_2395787_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2395903_2396815_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2397581_2398457_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2398515_2398896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2399042_2399279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2399575_2400046_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2400100_2400955_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2401426_2401645_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2401747_2402998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2403053_2403536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2403772_2404201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2404536_2405511_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2405569_2406622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2406940_2407906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2408208_2409033_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2409234_2410311_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2410395_2411382_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2411400_2412045_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2412056_2413166_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2413232_2413895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2414154_2416038_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2416351_2417851_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2417941_2418724_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2418851_2419772_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2419795_2420254_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2420375_2421251_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2421284_2422550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2422737_2423613_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2423811_2424003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2424207_2425503_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2425822_2426041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2426077_2427457_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2427484_2427943_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2427920_2429138_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2429330_2429567_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2429580_2429736_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2429816_2430779_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|2430938_2432255_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|2432264_2432933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2433343_2435158_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2435873_2436059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2436240_2436699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081078121.1|2437417_2438218_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2438249_2438477_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420737.1|2439757_2440156_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2440159_2440402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2441291_2443043_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|2443053_2443854_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|2443956_2444445_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|2444944_2445868_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2445964_2446309_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|2452003_2452966_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|2453004_2453880_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|2454139_2455399_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2455621_2455948_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|2456142_2457093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|2457150_2459217_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|2459222_2460218_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|2460957_2462538_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2462685_2464095_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|2464154_2465288_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|2465426_2466251_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|2466774_2466987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|2467000_2467138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052673.1|2467275_2467500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2468560_2468932_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|2469242_2469530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|2469681_2470530_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|2470652_2471624_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|2471726_2472767_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|2475305_2475596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|2475863_2476124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2476250_2477225_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2510219	2570856	3187887	transposase,tRNA	Acinetobacter_phage(33.33%)	57	NA	NA
WP_053093682.1|2510219_2510963_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|2512129_2512726_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|2512996_2513575_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|2518097_2519603_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|2519630_2519912_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2520060_2520402_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|2520522_2522427_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|2522559_2524131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929687.1|2524148_2525348_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|2525469_2526468_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|2526471_2527230_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|2527231_2528431_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|2528414_2529086_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|2529107_2529884_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|2529887_2530886_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|2530887_2531466_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|2531462_2532932_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2532975_2533263_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|2533463_2534384_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|2534499_2535054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|2535169_2535595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|2535865_2536216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|2536409_2536949_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|2537033_2537570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|2538229_2538532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|2538980_2539550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|2539618_2539963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|2540141_2541116_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|2541382_2541556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2541661_2543065_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|2543069_2544089_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|2544705_2545035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|2545260_2545659_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|2546526_2547477_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|2547476_2549555_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|2549696_2550212_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|2550220_2550784_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|2550764_2551511_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|2551649_2552102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|2552237_2553074_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|2553070_2553967_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|2553999_2555067_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2555085_2555454_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|2555479_2556931_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|2556937_2558317_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|2558357_2559671_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|2559660_2560635_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|2560728_2561232_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|2561366_2562518_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2562514_2562994_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|2563140_2565462_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|2565406_2566033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|2566037_2566937_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|2567117_2567672_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2567711_2568686_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_069971663.1|2568904_2569147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2569881_2570856_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 28
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2637248	2752765	3187887	transposase,tRNA,protease	Escherichia_phage(19.05%)	105	NA	NA
WP_017378478.1|2637248_2638628_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|2638742_2640635_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|2640682_2641309_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|2641328_2642213_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|2642245_2643136_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|2643250_2643649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|2643653_2644469_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|2644520_2644925_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|2644979_2645450_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|2645461_2645989_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|2646005_2647547_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|2647572_2648433_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|2648463_2649855_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|2649879_2650308_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|2650401_2651766_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|2651822_2653658_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|2653771_2654500_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|2655026_2656568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|2656834_2657491_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|2658188_2658848_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|2658992_2659250_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|2659362_2660115_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|2660173_2660887_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|2661078_2661711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2663445_2664849_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376720.1|2664845_2665106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2665149_2666124_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|2666143_2666461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|2666538_2666751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|2666997_2667417_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|2667514_2667961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|2668305_2669304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|2669336_2669690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|2669734_2670007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|2670403_2671822_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|2672048_2672990_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|2673024_2675004_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|2675000_2675606_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|2675607_2675949_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|2675949_2676786_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|2676951_2677269_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|2677346_2678768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|2678764_2679460_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|2680646_2681492_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|2681501_2681840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|2682408_2683812_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|2683844_2684789_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|2684993_2685167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|2685774_2686824_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2686978_2687197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2687516_2688920_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|2688930_2689488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|2689484_2690360_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|2690584_2690875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|2693498_2694272_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|2694690_2695047_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|2695078_2695531_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243065.1|2695683_2698746_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_017376261.1|2698742_2699807_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376260.1|2700170_2701124_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376259.1|2701156_2702320_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376258.1|2702325_2702925_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376257.1|2703112_2703613_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376256.1|2703630_2704719_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376255.1|2704857_2706102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|2706098_2706941_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376253.1|2706920_2707730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420746.1|2707916_2708132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376251.1|2708132_2709095_+	TonB family protein	NA	NA	NA	NA	NA
WP_017376250.1|2709150_2709702_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376249.1|2709831_2710254_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376248.1|2710246_2711008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376247.1|2711062_2711761_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_026063518.1|2711747_2712596_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376244.1|2713213_2713738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376243.1|2713870_2715085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376242.1|2715399_2716461_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376241.1|2716474_2718202_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_027243064.1|2718235_2718967_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_027243063.1|2718966_2719755_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243062.1|2719859_2720483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376237.1|2721814_2722567_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027242703.1|2728246_2728870_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376193.1|2728909_2729395_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017376192.1|2729441_2730587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653742.1|2730588_2732859_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_036771610.1|2732860_2733721_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_017376188.1|2733717_2734590_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_017376187.1|2734586_2735594_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376186.1|2735613_2736021_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_065653741.1|2736049_2737438_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_027242702.1|2737434_2738607_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_017376183.1|2738638_2739490_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242701.1|2739499_2740663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242700.1|2740659_2741667_+	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242699.1|2741663_2742800_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017376177.1|2742796_2743723_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_017376176.1|2743817_2745218_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_144420747.1|2745505_2746894_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_036771589.1|2746975_2747803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771607.1|2748021_2749026_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209597.1|2749079_2749310_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771588.1|2749317_2750196_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_017376171.1|2750332_2751307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376170.1|2751664_2752765_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
>prophage 29
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2825758	2956870	3187887	tail,transposase,tRNA,protease	Acinetobacter_phage(11.11%)	112	NA	NA
WP_017377604.1|2825758_2827741_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|2827950_2829294_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|2829560_2832230_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|2832253_2834170_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|2834339_2835761_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|2835905_2836880_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|2836889_2837189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|2837306_2837528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|2837691_2839353_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|2839425_2839716_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|2839942_2840398_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|2840462_2840927_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|2841018_2842365_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|2842364_2843270_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|2843331_2844318_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2844310_2844553_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|2844671_2846216_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|2846262_2847549_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|2847591_2848995_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|2848999_2851537_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|2851933_2852182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|2852113_2852575_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|2853069_2853765_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|2853866_2855429_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|2855756_2857550_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|2857636_2857909_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|2857914_2858541_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|2858527_2859958_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|2860279_2861335_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|2861303_2861981_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|2861970_2862819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|2862964_2863258_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|2863369_2864182_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|2864480_2865335_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|2865488_2866538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|2866583_2867240_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|2867257_2868538_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|2868811_2870173_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|2870233_2870785_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|2876215_2877487_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|2877543_2878527_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|2878523_2879309_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|2879616_2880066_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2880159_2881563_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|2882000_2883482_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|2883537_2884647_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|2886219_2886432_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|2886472_2887168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155763433.1|2887431_2888604_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|2890148_2890715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|2890872_2891433_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|2891552_2892956_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|2892952_2893309_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|2893564_2894389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|2895086_2895611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2895896_2896871_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|2896970_2897522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2897634_2898288_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|2898539_2899997_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|2900110_2900590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2900827_2901433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|2901712_2902828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2902766_2903453_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|2903446_2904424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2904458_2905622_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|2905961_2906186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|2906568_2906856_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|2907030_2907786_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2907818_2908250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|2908225_2908702_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|2908708_2910286_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|2910288_2911053_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|2911106_2911643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2911639_2912371_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|2912595_2913357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2913682_2914558_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|2915960_2916116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2916309_2918019_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|2918672_2918981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|2918998_2921191_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|2921998_2922247_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|2922359_2922593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|2922827_2923358_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|2923362_2924076_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|2924703_2925429_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|2925437_2927501_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|2927680_2928160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2928652_2930020_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|2930411_2931209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2931320_2932610_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|2932790_2933777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|2933893_2934073_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|2934084_2934516_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|2934728_2935088_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|2935257_2936883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2937606_2939034_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|2939327_2940509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|2943111_2944410_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|2944765_2945659_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|2945655_2945961_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|2945986_2946766_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|2946795_2947026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|2947177_2947423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|2947609_2948401_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|2949100_2949823_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|2949819_2950701_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|2950724_2952215_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|2952304_2953192_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|2953864_2954356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2954360_2954588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2954680_2955655_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|2955631_2956870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	2964836	3018250	3187887	transposase	Staphylococcus_phage(57.14%)	49	NA	NA
WP_053856767.1|2964836_2966240_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2966345_2966531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2967229_2968633_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|2968723_2969227_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2969266_2970241_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|2970237_2970807_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|2971293_2971986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|2972593_2973586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|2973575_2975348_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|2975348_2975537_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|2975574_2976549_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|2976607_2976802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2976868_2977096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2977225_2978101_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2978328_2978478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|2978469_2978736_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|2978880_2979780_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2979866_2980124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2980736_2981963_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|2982052_2982592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|2982713_2983352_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|2983385_2983874_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|2984120_2984423_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|2984403_2984892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2985462_2986761_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|2986877_2987168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2987206_2989861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|2990574_2990829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|2991138_2991867_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|2992637_2993822_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|2993840_2994785_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|2995090_2995876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|2995989_2996358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|2996586_2998164_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|2998947_3003372_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|3003508_3005032_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|3005236_3005464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|3005608_3005866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|3006433_3007405_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|3007329_3007638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|3007701_3007923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3008042_3009017_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|3009070_3010042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|3010121_3011096_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|3011456_3014126_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|3014296_3015178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|3015188_3015845_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|3015911_3016616_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|3016846_3018250_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013816	Piscirickettsia salmonis strain AY3800B, complete genome	3187887	3075259	3131252	3187887	transposase,tRNA	Acinetobacter_phage(20.0%)	47	NA	NA
WP_048875895.1|3075259_3076423_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|3076476_3077478_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|3077559_3078129_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|3078342_3079314_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|3079325_3080921_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|3080941_3081973_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|3082304_3083408_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|3083519_3084704_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|3084781_3086770_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_144420609.1|3087929_3089303_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|3089320_3090307_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|3090309_3091464_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|3091460_3092156_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|3092298_3093789_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|3093809_3094859_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|3094925_3096320_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|3097252_3099184_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|3099188_3099719_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|3099753_3099948_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|3099990_3100350_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|3100481_3101477_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|3101489_3103871_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|3103876_3104164_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|3104430_3104637_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|3106245_3107019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|3107020_3107962_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|3108095_3109673_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|3109866_3110265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|3111265_3111472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|3112276_3112921_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|3112988_3114245_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|3114500_3114680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|3114902_3115130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|3116405_3117164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|3117381_3117945_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|3118048_3118597_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|3119193_3120346_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|3120691_3120988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|3121247_3122159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|3122393_3122933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|3124095_3124233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|3124479_3125208_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|3125254_3125863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|3127137_3127398_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|3127571_3129110_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|3129288_3130215_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|3130319_3131252_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
>prophage 1
NZ_CP013817	Piscirickettsia salmonis strain AY3800B plasmid p1PS10, complete sequence	60086	0	5335	60086		Pseudomonas_phage(20.0%)	6	NA	NA
WP_069971677.1|892_1075_-	hypothetical protein	NA	A0A0A1IUH0	Pseudomonas_phage	62.7	3.2e-08
WP_069971678.1|1167_1662_-	hypothetical protein	NA	A0A0S1WEX5	Vibrio_phage	43.2	3.1e-13
WP_144420830.1|1767_2073_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_027242583.1|2429_2741_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	2.3e-14
WP_027242582.1|2737_3139_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_027242581.1|3148_5335_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.3	1.1e-73
>prophage 2
NZ_CP013817	Piscirickettsia salmonis strain AY3800B plasmid p1PS10, complete sequence	60086	25809	58933	60086	transposase,integrase	unidentified_phage(14.29%)	35	50736:50766	55058:55088
WP_069971648.1|25809_26784_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	2.9e-26
WP_069971679.1|26842_28648_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_036773372.1|28653_29319_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_036773373.1|29327_30317_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_080963562.1|30421_31108_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_155074374.1|31031_31409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774456.1|31365_33945_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_065653727.1|33957_34404_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_051929537.1|34406_35876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929536.1|35885_36590_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_062365791.1|36582_37092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|37124_38528_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036775000.1|38708_38999_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_052106244.1|39014_39332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420828.1|39529_39784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774994.1|39989_40268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927058.1|40346_40703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053063426.1|40822_41608_+	class I SAM-dependent methyltransferase	NA	R4ZE30	Choristoneura_rosaceana_entomopoxvirus	27.9	2.1e-19
WP_047927059.1|41583_42285_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036775038.1|42270_43011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242605.1|43305_44601_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.8e-12
WP_036774869.1|45044_45893_-	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
WP_047927060.1|45889_46750_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
WP_053856777.1|46739_46961_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_047927062.1|47477_47804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927063.1|47803_48928_+	hypothetical protein	NA	NA	NA	NA	NA
50736:50766	attL	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_048876031.1|51024_52428_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242600.1|52455_53046_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_032126795.1|53318_53579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|53582_53855_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_155046644.1|54180_54399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963647.1|55428_55599_-	hypothetical protein	NA	NA	NA	NA	NA
55058:55088	attR	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_036774631.1|55937_56402_-	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_098082828.1|57668_57926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|57925_58933_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013818	Piscirickettsia salmonis strain AY3800B plasmid p2PS10, complete sequence	33556	4509	20532	33556	head,transposase,integrase,terminase,capsid,tail	unidentified_phage(38.46%)	20	3839:3898	18012:18303
3839:3898	attL	CAAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGT	NA	NA	NA	NA
WP_036771330.1|4509_5484_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|6019_6610_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|6840_7101_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|7093_7447_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|7623_8598_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|9130_9496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|9640_9895_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|9878_10235_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|10332_11307_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|11932_12799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|13011_13395_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|13481_13964_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|13966_14152_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|14171_15146_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|15242_15635_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|15670_16252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|16632_17607_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|17680_17896_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|18699_19215_-	hypothetical protein	NA	NA	NA	NA	NA
18012:18303	attR	ACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGCATTGATCCTACTCAGCTTATTGATACGCCGACCGGTACGATACTGATACATTCTCACCCTGATGGCACGGTTGAGCCGTCACTCGCGGATATGGTGGGTCAACGCGATACTGGATTATTATGGGGGATTGTTGCACTCAATCAACACGCTGTGACGGATGCCATTGTTTTTGGTGAGCAGTTATTCACCCAGCAATTACTCGAGCGGCCGTTTTTGCATGGTATTTTTGAT	NA	NA	NA	NA
WP_027242943.1|20115_20532_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
>prophage 1
NZ_CP013819	Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence	45767	0	25688	45767	integrase,transposase	Escherichia_phage(27.27%)	31	4548:4563	30340:30355
WP_021461774.1|406_688_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_069971687.1|759_1971_-	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	NA	NA	NA	NA
WP_021461772.1|2063_2693_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004235553.1|2990_3923_-|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_011751353.1|4124_4766_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	6.6e-56
4548:4563	attL	TCATCATTACCCTGGG	NA	NA	NA	NA
WP_004235553.1|5439_6372_+|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_155763435.1|6497_6653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|6713_7211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|7286_8075_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|8132_8657_-	streptothricin N-acetyltransferase Sat2	NA	NA	NA	NA	NA
WP_000071896.1|8979_9516_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|9630_9957_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|10144_10384_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_081329474.1|10829_11276_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_012850379.1|11336_12554_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_012850378.1|12553_13306_-	ParA family protein	NA	H7BUL8	unidentified_phage	29.4	9.6e-14
WP_069971684.1|13309_13624_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_041692625.1|13824_14019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850375.1|14392_15388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041692624.1|15497_15920_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	33.0	1.6e-05
WP_012850373.1|16456_17821_-	hypothetical protein	NA	A0A1B1P892	Bacillus_phage	25.8	1.2e-09
WP_012850372.1|18005_18317_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012850370.1|18722_19463_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	33.7	1.6e-05
WP_012850369.1|19462_20110_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012850368.1|20110_21175_-	phosphoribosyltransferase	NA	A0A0R6PHM5	Moraxella_phage	34.9	4.1e-34
WP_012850367.1|21184_21508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850366.1|21614_21752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850365.1|21799_22057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850364.1|22482_22971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850363.1|22980_23721_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_012850362.1|23717_25688_+	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	34.2	1.2e-76
30340:30355	attR	TCATCATTACCCTGGG	NA	NA	NA	NA
>prophage 2
NZ_CP013819	Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence	45767	37244	41957	45767		Bdellovibrio_phage(50.0%)	3	NA	NA
WP_012850393.1|37244_40292_+	hypothetical protein	NA	H9C0J7	Bdellovibrio_phage	30.6	5.4e-23
WP_012850392.1|40281_40425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850391.1|40427_41957_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	6.9e-35
>prophage 1
NZ_CP013820	Piscirickettsia salmonis strain AY3800B plasmid p4PS10, complete sequence	188301	0	60057	188301	head,integrase,capsid,tail,portal,transposase	Streptococcus_phage(16.67%)	56	1010:1069	72736:73471
WP_036772541.1|214_943_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|954_1659_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
1010:1069	attL	GTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTC	NA	NA	NA	NA
WP_144420840.1|2041_2473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876212.1|2503_3382_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243191.1|3335_4043_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_075275473.1|4159_4336_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_048876213.1|5574_6465_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971688.1|6773_7880_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_155763436.1|7864_10057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|10789_11767_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771353.1|11848_12568_+	ParA family protein	NA	NA	NA	NA	NA
WP_036771355.1|12584_14021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|14492_15470_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|15497_15926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|15984_18675_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|18671_19229_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|19218_20004_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|19933_20605_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|20601_20943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|20935_23014_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|23017_23284_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|23340_23664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|23665_24088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|24087_24438_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|24434_24830_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|25007_25433_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|25429_25741_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|26125_26710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|26723_27263_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|27312_28287_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_036771953.1|28749_31029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242588.1|31045_31399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|31737_32712_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036773107.1|32999_33317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|33300_34002_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|34025_34259_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|34402_35377_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027243195.1|35742_36789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|37114_38131_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_047927763.1|38621_38885_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|38881_39280_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|39523_39979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|41879_42137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|42281_42452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|43121_44048_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|44243_44972_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|46120_46741_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|46796_47525_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_069971691.1|48392_48650_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|48652_49381_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|49410_50343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773695.1|51239_53312_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_016212398.1|55374_55836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|55930_56386_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_081000017.1|58743_58995_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_081329475.1|59259_60057_-|transposase	transposase	transposase	NA	NA	NA	NA
72736:73471	attR	GTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCGCAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAATCATCTCTACCCTCATAAGGCAAACTAGAGAGTTTATCTGTATGGATATGAACTCTCTACTCGGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP013820	Piscirickettsia salmonis strain AY3800B plasmid p4PS10, complete sequence	188301	64838	129247	188301	transposase,integrase,portal	Streptococcus_phage(48.15%)	60	72374:72433	112016:112936
WP_027243203.1|64838_65633_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|65726_65930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|66124_66460_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_036771296.1|67159_69055_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036772437.1|69410_71309_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|71604_71871_+|transposase	transposase	transposase	NA	NA	NA	NA
72374:72433	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTA	NA	NA	NA	NA
WP_036771330.1|72410_73385_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|73691_74096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|74096_74843_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_036774644.1|75351_76413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|77392_77611_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|77629_78358_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|78509_79193_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|79197_79767_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|79937_80666_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|81149_81878_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|81930_82326_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|82619_83348_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|83505_86847_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|86910_87150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|87315_88044_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|88318_89254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876188.1|89967_90741_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_036774373.1|90914_91643_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036774376.1|91952_92381_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774316.1|92377_92677_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774378.1|92719_93289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420833.1|93493_93685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|93698_94739_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242592.1|94805_95135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774388.1|95158_96121_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|97498_98227_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|98473_98623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|98634_99363_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|99392_99779_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|99714_100143_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|101694_101922_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|102654_103146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|103227_103956_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|104299_104446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|104751_106617_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|106689_106956_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|107136_107478_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|107658_108192_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|109431_110160_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|110642_111665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772450.1|113478_114606_+	hypothetical protein	NA	NA	NA	NA	NA
112016:112936	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCGATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAACTTCATTAAAATCCGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGTTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCGGCAAACTCTGTTCCGTTGTCAGAAGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCGCAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAA	NA	NA	NA	NA
WP_051929764.1|115277_115769_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	6.9e-21
WP_032126795.1|117127_117388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|117391_117664_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|117739_118468_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|119037_120009_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|120873_121701_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|122554_123025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|123918_124062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|125268_125868_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|126221_126998_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|127358_128087_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|128156_128357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|128275_129247_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013820	Piscirickettsia salmonis strain AY3800B plasmid p4PS10, complete sequence	188301	135486	140257	188301		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_017375964.1|135486_135912_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|136182_137178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|137481_137889_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|137996_139040_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|139341_139575_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|139712_139865_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|139894_140257_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
>prophage 4
NZ_CP013820	Piscirickettsia salmonis strain AY3800B plasmid p4PS10, complete sequence	188301	144393	188074	188301	terminase,transposase,portal	Streptococcus_phage(37.5%)	49	NA	NA
WP_027242929.1|144393_144777_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|144863_145346_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|145348_146680_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|146884_147319_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|147405_147792_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|147829_148564_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|148610_149324_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|150702_150888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|150891_154236_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|154416_155145_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|155238_156213_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|156526_156889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|156928_157438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|157669_158650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971702.1|159115_159988_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.3	3.8e-38
WP_036771347.1|160069_161047_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|161061_161223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|161440_161695_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|161684_161972_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_155048088.1|162466_163297_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.8	4.9e-35
WP_036771347.1|163297_164275_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_069971704.1|164382_164874_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|164955_165933_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|166060_166789_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|166971_168258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|168278_168443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420842.1|168859_169018_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|169079_169808_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772437.1|170229_172128_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|172423_172690_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|173235_173964_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|174004_174175_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|174250_175228_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|175309_175993_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_155046629.1|176020_176173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|176574_178314_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_082304501.1|178316_178679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|179628_180315_-	Fic family protein	NA	NA	NA	NA	NA
WP_080963659.1|180660_181281_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772434.1|181259_181988_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_017377656.1|182075_182462_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017377655.1|182458_182704_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075275474.1|183045_184158_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017375840.1|185126_185345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|185389_185794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|185807_186146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|186138_186363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|186734_187343_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|187345_188074_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
