The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	7735	80018	4936308	transposase,protease	Ralstonia_phage(36.36%)	56	NA	NA
WP_011407164.1|7735_8572_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8758_9565_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9841_11035_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11188_11860_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11944_12706_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12752_13175_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13178_13592_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13887_14655_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14665_14935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|15009_16470_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17116_18127_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18398_19601_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19742_21881_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22091_22385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155296170.1|22416_22914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23160_24141_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24188_25355_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25501_26068_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27542_28751_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29378_30401_-	sugar kinase	NA	NA	NA	NA	NA
WP_069964474.1|31223_32192_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_125168733.1|33020_33413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057298.1|33638_34520_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
WP_012443646.1|35121_36498_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39510_39753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39694_40018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40483_41464_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|42082_43372_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43811_44147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44421_44853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45201_46611_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_041181902.1|46888_47104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47928_48189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48205_48538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48537_48996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|49403_50372_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011407913.1|50515_51730_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|52250_53048_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|54763_55729_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|55725_56004_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_155296171.1|56147_57536_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|57583_58630_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|58770_59268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|59431_60064_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|60080_62243_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|62357_62543_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|62565_65169_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|65165_67055_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|67111_68869_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|68871_71106_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|71102_72686_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|73159_74788_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|74784_76149_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|76341_77283_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|77523_79248_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|79254_80018_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	122953	169875	4936308	transposase	Ralstonia_phage(14.29%)	34	NA	NA
WP_069959667.1|122953_123904_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	4.4e-96
WP_069959668.1|124017_124203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|124294_124567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|124607_124889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959669.1|125027_126086_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.5	4.9e-72
WP_011407232.1|126226_127174_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|127428_127740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|129206_129677_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|129846_130539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|130630_131029_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|131830_132787_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044756192.1|132761_133232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756194.1|133423_134677_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_069960122.1|135022_135712_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	3.7e-36
WP_011257145.1|135724_136882_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|136894_138205_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027703668.1|140080_140332_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075239626.1|140784_141186_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011407243.1|141209_141440_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011407244.1|141506_142169_-	hemolysin III	NA	NA	NA	NA	NA
WP_155296189.1|142433_144842_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_042464339.1|144838_146665_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407248.1|147153_149298_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|149488_150646_-	ROK family protein	NA	NA	NA	NA	NA
WP_042464342.1|150818_153407_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|153417_154203_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_011407251.1|154516_155656_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|156806_157112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464345.1|157399_158653_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.9e-38
WP_011257161.1|158709_159090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964477.1|159248_163763_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257163.1|163956_165438_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_109182058.1|166675_167641_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|169076_169875_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	217395	359782	4936308	tRNA,holin,transposase	Bacillus_phage(21.43%)	93	NA	NA
WP_012443704.1|217395_219300_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|219560_219740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|219873_220341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|220498_221458_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|221442_222060_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|222102_222522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443706.1|222774_223680_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|223928_224813_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|224876_225659_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|225703_226465_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|226628_226958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|227276_228368_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|228436_230035_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|230199_231444_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|231895_232525_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|232731_234708_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|236094_236760_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_011257214.1|237046_238057_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|238053_238785_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|239138_240668_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|240777_243810_-	membrane protein	NA	NA	NA	NA	NA
WP_011257218.1|244108_247147_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|247311_248364_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|248532_248778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|248776_249742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|249741_252402_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_011257222.1|254220_254439_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257225.1|256998_257484_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_109182060.1|257515_257842_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257226.1|258063_258708_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|258848_259739_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|259866_260349_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|263384_263918_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_069959920.1|264065_265163_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407313.1|266735_267794_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|268101_269175_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|269937_270990_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|271637_272768_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|274091_274481_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|274688_274895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|275126_276095_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|276348_278511_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|279058_280363_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|280422_281025_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|281021_282926_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|292245_293061_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|293407_294370_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|294474_295237_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|297036_298095_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|298105_298396_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|298385_299048_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|299044_299596_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|299607_300357_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|300356_301151_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|301535_301823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|301841_302399_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|302416_303382_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069959685.1|304226_305183_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.9e-41
WP_109182012.1|305254_306017_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|306056_306855_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|306986_308201_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|308260_309091_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|309253_310489_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|311887_312316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|312335_312776_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011407345.1|312678_312984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|313291_315046_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|315986_316749_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|316802_317387_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|317544_318927_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|318929_321329_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|321432_324075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|324822_328272_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|328464_329049_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|329525_330302_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|330482_331784_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_094187863.1|331780_332146_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|332582_334064_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|334256_335222_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|336048_338211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959687.1|338337_340506_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|341143_341773_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|341775_342207_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_094187815.1|342299_342842_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|342937_343690_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|343914_344304_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|344417_346091_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|346087_346732_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|350438_350723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801865.1|351074_351873_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187710.1|351932_352696_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|356649_357615_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|358675_359782_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	770018	806336	4936308	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|770018_771338_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408760.1|771653_772838_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|773367_774681_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|774670_775489_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|775711_776653_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|776652_777399_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|777624_778680_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|778735_779623_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|779619_780177_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|780173_781082_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|781198_782602_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|782647_783994_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|784127_784859_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|784858_785488_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|785545_787633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|787629_789279_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|789394_790003_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|790553_791198_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|791194_792121_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|792123_792966_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|793051_794164_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|794333_795593_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|795654_796116_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|796258_797953_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|798064_798469_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|798600_799374_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|799384_799852_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011257697.1|799857_800331_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|800889_802209_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801894.1|802366_803686_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|803898_804867_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|805016_806336_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	873201	917089	4936308	transposase,protease	Ralstonia_phage(25.0%)	39	NA	NA
WP_069963827.1|873201_874167_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|874557_875133_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|875245_875755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|875853_876048_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|876137_877115_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|877344_877785_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|878062_879007_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|879089_879833_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|880037_880277_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|880418_881654_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|881824_883180_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|883240_884314_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|884310_885270_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|885266_885620_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_133261978.1|886322_887105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128415345.1|887198_887384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|887466_887793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|888028_889627_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|889772_890669_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|890744_891899_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069963828.1|892086_894678_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|895000_895138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960159.1|895410_896610_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011409545.1|897059_898028_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407672.1|898269_900486_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|900564_901563_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|901672_901855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703870.1|902834_905822_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|905996_906944_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|907442_907979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801871.1|908049_909438_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182785.1|909712_910675_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
WP_012446027.1|910808_911369_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|911411_911894_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|912056_912533_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|912943_913843_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|914082_914469_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|915098_916226_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|916225_917089_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	922389	1078482	4936308	integrase,transposase,protease	Ralstonia_phage(20.83%)	111	1015089:1015107	1075593:1075611
WP_011257788.1|922389_923172_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407683.1|923282_924659_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_011257791.1|924902_925538_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|926164_926698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|926881_927850_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257793.1|927983_928181_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|928190_929303_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|929283_930618_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|930851_931772_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|931848_933165_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|933437_934817_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|934837_935494_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|935622_936276_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|936546_937008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|938067_938952_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|939072_940521_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|940588_941236_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|942052_943126_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|943456_945019_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|945015_946140_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|946215_946473_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|946456_948178_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|948221_949223_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|950499_952377_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|952802_955154_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|955264_956158_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187800.1|956203_959173_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_094187799.1|959787_960903_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|961049_961586_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|961782_962265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|964544_965510_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|965506_965680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|965964_966456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|968135_969392_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|969551_970115_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|970481_971840_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|971839_972436_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|972582_973467_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|975448_976063_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|976145_977132_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|977247_977742_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|977986_979816_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|979834_980305_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|981227_982355_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|982455_983838_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_069964495.1|984085_986209_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|986737_987256_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|987962_989064_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|989579_990815_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|991428_992319_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|992408_992549_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_044756431.1|996108_997344_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|998326_999646_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|1000391_1001315_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|1002377_1003343_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1003644_1005222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1005289_1006053_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1008721_1009690_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964496.1|1009950_1010412_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1010960_1011203_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1011196_1011960_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1011992_1012724_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1014543_1015296_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1015089:1015107	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1015297_1016263_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1016526_1017534_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1017677_1018439_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1021756_1023049_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1023141_1023768_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1023892_1025179_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1025322_1027794_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1028007_1028280_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1029111_1031082_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_041182774.1|1031780_1032959_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1032955_1033723_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1033735_1034392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1034419_1034872_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1034880_1035615_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_012445930.1|1036050_1036755_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011407730.1|1037581_1038211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1039103_1039304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960070.1|1042490_1044641_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1044637_1046335_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_011257899.1|1046654_1047212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1047294_1048260_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1048358_1049045_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1049155_1049560_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1049770_1050820_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1050840_1051590_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1051589_1052339_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1052338_1053370_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1053387_1053747_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1053771_1054269_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1054265_1054511_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1054507_1054954_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1055515_1057612_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1057618_1057939_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1058036_1058630_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1058731_1059082_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1059201_1059735_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1059731_1061684_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1061676_1062633_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1062638_1063592_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1063630_1065499_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1067014_1067530_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1068046_1068805_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1069277_1070024_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1070640_1072242_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1073230_1074466_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1075294_1076263_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1075593:1075611	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1076730_1077081_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1077162_1078482_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	1117212	1233204	4936308	transposase	Leptospira_phage(14.29%)	96	NA	NA
WP_109182097.1|1117212_1118314_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1119744_1120368_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1120391_1120631_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1120680_1121562_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1121711_1122161_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1122311_1122959_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1123050_1123521_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1123517_1124108_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1124716_1125016_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1125012_1125234_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1125469_1126012_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1126022_1127363_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_094187736.1|1128070_1128834_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1129066_1130392_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1130590_1130938_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1130934_1133343_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1133521_1134679_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1134694_1135294_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1135290_1135686_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1135682_1136408_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1136517_1137378_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1137494_1138106_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1138286_1139084_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1139232_1139532_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1139660_1141832_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1141911_1142292_+	RidA family protein	NA	NA	NA	NA	NA
WP_069960167.1|1142312_1144466_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_069959742.1|1144591_1145530_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1145601_1145844_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1146057_1147347_+	citrate synthase	NA	NA	NA	NA	NA
WP_115801874.1|1147515_1148835_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407794.1|1149199_1149850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187795.1|1150159_1152682_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1152804_1153863_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1153862_1154621_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1154617_1155283_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1155279_1155813_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1155832_1157782_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187731.1|1157852_1158651_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1158793_1160029_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082323365.1|1160099_1161134_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	1.1e-65
WP_069963832.1|1161756_1162776_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_069959745.1|1162796_1163759_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1163761_1164223_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1164219_1165227_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_069959746.1|1165223_1167026_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1167022_1168780_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1169075_1169393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057328.1|1169590_1170871_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1171090_1173091_+	transketolase	NA	NA	NA	NA	NA
WP_011258009.1|1173909_1174626_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011407808.1|1174628_1175621_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_027703583.1|1175940_1178655_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1178774_1179950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464577.1|1180084_1182043_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1182218_1182866_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1182862_1184362_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1184358_1185033_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_011407815.1|1185032_1185872_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1186538_1187237_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_069964637.1|1187254_1188616_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1188715_1189081_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959749.1|1189070_1190387_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1190383_1190968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1191310_1191925_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1191924_1192617_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069959750.1|1192627_1193404_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1193474_1194305_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069959751.1|1194318_1195092_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_153296750.1|1198165_1198306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|1198723_1199486_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|1199778_1200780_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109181946.1|1201167_1201930_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1202019_1202985_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1203094_1204414_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1204876_1205554_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1205633_1206023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1206236_1207124_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1207557_1208542_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1208717_1210805_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1210956_1211616_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1211696_1212494_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1212516_1212696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1212714_1213119_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1213152_1213512_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1213755_1214628_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1214700_1215927_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1216172_1216790_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011407845.1|1218350_1219934_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1219930_1220356_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1220380_1220884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1222326_1222776_+	azurin	NA	NA	NA	NA	NA
WP_027703881.1|1226172_1227462_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011258055.1|1231423_1232293_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1232314_1232986_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011258057.1|1232982_1233204_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	1453585	1591811	4936308	tRNA,transposase	uncultured_Caudovirales_phage(12.5%)	106	NA	NA
WP_115801880.1|1453585_1454551_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_099051293.1|1454929_1455607_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1456144_1456369_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_069964506.1|1456368_1458441_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_024712563.1|1458672_1459530_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323430.1|1460553_1462953_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_011258248.1|1462949_1463897_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1464890_1465439_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1465833_1466391_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1466440_1468549_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069959782.1|1468570_1470472_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
WP_027704078.1|1470526_1471387_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964507.1|1471732_1473109_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_155296174.1|1473148_1473553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258251.1|1474016_1474250_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1474470_1475037_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1475239_1475827_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_109182101.1|1476134_1476614_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1476610_1479019_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1479363_1479825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1480071_1480962_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1481139_1481658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1481729_1482443_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1482546_1483296_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1483656_1483908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964508.1|1484240_1486298_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.5	1.4e-78
WP_069960076.1|1488245_1489367_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011258263.1|1489381_1490209_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1490192_1491476_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1491502_1492018_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1492028_1494185_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1494252_1496250_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1496268_1496598_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1496637_1496856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1497087_1500552_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1500954_1501497_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1501908_1502817_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1503162_1503961_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1504104_1504824_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1504979_1506014_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1506034_1506847_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1507582_1507966_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1508097_1509267_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1509261_1510320_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1510380_1511193_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1511708_1512092_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1512250_1513414_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1513444_1514257_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1514487_1515075_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_069964509.1|1515373_1516330_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	6.2e-42
WP_075242217.1|1516403_1517135_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|1517156_1518260_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1518328_1519732_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1519745_1520252_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1520657_1521116_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1521893_1522097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1523658_1524144_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1524371_1524587_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1524837_1525317_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1525448_1525877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258297.1|1525949_1526780_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1526841_1527609_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1527608_1527824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1527969_1528761_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_033013599.1|1528918_1530082_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027704133.1|1532315_1532954_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1533129_1535070_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1535286_1535841_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1536062_1537493_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258308.1|1537559_1539014_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011258309.1|1539430_1540156_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_094187725.1|1540254_1540665_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_113175329.1|1540716_1541688_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.1	4.6e-32
WP_012444404.1|1541914_1544296_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258314.1|1546924_1547335_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1547634_1547817_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1547949_1548990_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1549062_1550508_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_044756984.1|1550634_1551933_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011408046.1|1552189_1552735_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1552731_1554195_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1555655_1555910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1556312_1556846_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1556871_1557273_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1557241_1557622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1557618_1557861_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_069964510.1|1559225_1561130_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_012444418.1|1561393_1563790_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_059317478.1|1563939_1564662_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_069959788.1|1564849_1565797_-	DMT family transporter	NA	NA	NA	NA	NA
WP_059317476.1|1567612_1568113_+	RraA family protein	NA	NA	NA	NA	NA
WP_059317475.1|1568054_1569731_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1569877_1571143_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1571201_1572395_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1572391_1573081_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_069960078.1|1573186_1574656_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1574675_1575512_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1575537_1576641_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_069964511.1|1576637_1579694_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069960188.1|1579759_1580350_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069959790.1|1580481_1582314_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1582389_1583153_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1583195_1584515_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1585812_1590303_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_128415435.1|1590302_1590791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|1590842_1591811_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 10
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	1715339	1781205	4936308	tRNA,transposase	Bacillus_phage(20.0%)	42	NA	NA
WP_011257310.1|1715339_1716575_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1716625_1717389_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1717455_1718832_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1719210_1719885_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|1720515_1720920_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1720998_1721496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1721634_1723431_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1723986_1724532_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1724633_1728755_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1728975_1731618_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1733059_1734574_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187782.1|1734744_1735507_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1735818_1736331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1736393_1737512_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1737508_1737787_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1737783_1738536_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1738532_1739432_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1739515_1739596_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1739885_1742072_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1742375_1743818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1744150_1746253_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1746494_1748939_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1748952_1749477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1749676_1751704_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1751717_1752437_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|1752433_1753348_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|1753640_1754516_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|1754512_1755463_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1755712_1756114_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|1756131_1756494_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|1756493_1757024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|1757063_1759100_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_069963843.1|1759213_1766140_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|1766147_1767350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|1767383_1767860_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258513.1|1768110_1768734_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|1768745_1769828_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|1774449_1775514_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|1775510_1776242_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011408189.1|1776266_1778225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|1778366_1779470_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|1779969_1781205_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	1889347	1948743	4936308	transposase,protease	Tupanvirus(18.18%)	53	NA	NA
WP_011408249.1|1889347_1890934_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_011258599.1|1891099_1892905_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	6.1e-22
WP_011258600.1|1893011_1893812_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1893842_1894220_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1894209_1894890_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1894886_1895786_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1896009_1896732_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1896880_1897603_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1897761_1899096_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1899270_1899768_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1899863_1901099_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1901327_1902704_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1902823_1903507_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1903523_1904558_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1904738_1906316_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1906433_1907438_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1907437_1907992_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1908077_1908830_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1908916_1909123_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1910633_1911278_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1911267_1913769_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1913765_1915370_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1915366_1915600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1915596_1916619_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1916955_1917321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1917317_1917908_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1918005_1919715_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1919823_1920150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1920379_1920724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1920846_1922022_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1922177_1925006_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1925066_1926167_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1926634_1927162_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1927563_1927737_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1927897_1928152_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1928326_1928593_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1928783_1929350_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1930837_1932157_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1932548_1932734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1932923_1934300_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1934439_1934913_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1936584_1937634_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1937748_1938084_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1938372_1938663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1939553_1940672_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|1940892_1942104_+	MFS transporter	NA	NA	NA	NA	NA
WP_103057306.1|1942274_1942436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258643.1|1944026_1944482_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1944755_1945358_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1945393_1946002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1946061_1946256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1946325_1947696_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1947980_1948743_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	1964785	2023889	4936308	tRNA,coat,transposase,protease	Acidithiobacillus_phage(25.0%)	45	NA	NA
WP_011258663.1|1964785_1966870_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|1967094_1967544_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|1968307_1969366_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|1969636_1971034_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|1971030_1972008_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|1972189_1974127_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1974547_1975324_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1975328_1976003_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|1977633_1979010_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|1979049_1979445_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|1979487_1980963_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|1981761_1982178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1982191_1982362_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|1986056_1986620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258677.1|1987092_1988409_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|1988576_1989179_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|1989252_1989699_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|1989776_1990043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258680.1|1990864_1992208_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044756910.1|1992144_1993557_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|1993553_1994291_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_069959819.1|1994290_1996471_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|1997310_1998270_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|1998445_2002036_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2002493_2003234_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2003230_2004487_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2004525_2005317_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2005340_2005802_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2005798_2006812_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258692.1|2007211_2009665_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2009661_2011008_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2011034_2012225_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2012227_2013055_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2013051_2013813_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2013830_2014388_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2014568_2015291_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2015347_2015725_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2015852_2016731_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2016900_2017704_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2018079_2018805_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2018807_2019140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2019186_2020221_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2020217_2022569_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2022585_2023356_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2023364_2023889_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 13
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	2075050	2207850	4936308	tRNA,transposase	Ralstonia_phage(21.43%)	99	NA	NA
WP_115801887.1|2075050_2076370_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2076704_2077631_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2077760_2078366_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2078704_2080474_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_103073520.1|2080470_2081064_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_011258751.1|2081331_2081925_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2082123_2083560_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2083801_2085004_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2085046_2087875_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2088055_2088988_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2088984_2090484_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2090821_2091085_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2091364_2091865_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2092106_2093474_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_094187715.1|2096496_2097259_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296175.1|2097219_2097363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963920.1|2098711_2100115_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_027703710.1|2100237_2100660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445134.1|2101292_2102123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963848.1|2102132_2103119_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|2103115_2103991_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_014502778.1|2103987_2104350_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2104352_2104601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2104736_2105294_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2105385_2106351_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2106376_2107726_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2107718_2107955_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2107955_2108708_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2109041_2109887_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2110027_2111203_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011408378.1|2111216_2112527_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_103057264.1|2112451_2113510_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2113506_2114712_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2115098_2117852_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2117994_2119134_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2119130_2120126_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057266.1|2120247_2121396_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2121395_2121536_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2121907_2123353_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2123919_2126448_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2126658_2127457_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2128527_2129295_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2129296_2129644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2129802_2130771_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181928.1|2132123_2133089_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2133533_2134718_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2134772_2136248_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2136569_2136752_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2136900_2138100_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258802.1|2138960_2139929_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407756.1|2140128_2141448_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|2141597_2142566_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181930.1|2142845_2143644_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2144754_2145723_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181932.1|2148224_2149190_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2150221_2151190_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_012443979.1|2151316_2152552_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109181933.1|2153686_2154789_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2154975_2155443_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_099051282.1|2155803_2156568_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2156574_2157924_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187763.1|2158073_2158872_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801888.1|2159311_2160631_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2160843_2161812_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_069959827.1|2161863_2162460_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2162559_2163573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2164263_2164530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182103.1|2164773_2164869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960204.1|2164942_2168458_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2168681_2168981_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2168984_2169179_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_153296744.1|2169245_2169392_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_082331600.1|2169447_2173050_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_069959830.1|2174601_2176077_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	9.2e-101
WP_069959831.1|2176217_2180345_-	avirulence protein	NA	NA	NA	NA	NA
WP_115801889.1|2180633_2181953_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2183784_2184870_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2185197_2185896_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2185898_2186465_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2186476_2187154_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2187242_2188673_-	amino acid permease	NA	NA	NA	NA	NA
WP_011408420.1|2188749_2190231_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2190367_2190955_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2191110_2192352_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2192560_2193979_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2194013_2194313_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|2195439_2196474_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011258847.1|2197586_2198606_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094187828.1|2198599_2199010_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2199027_2199630_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2199622_2201560_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2201728_2202199_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2202195_2202366_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2202362_2203115_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011258853.1|2203209_2203905_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2203901_2204546_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2204772_2205921_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2206060_2206864_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2206884_2207850_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	2308907	2443897	4936308	tRNA,transposase,protease	Xanthomonas_phage(60.98%)	117	NA	NA
WP_012444952.1|2308907_2310320_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2310825_2311624_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2311937_2312264_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2312273_2313188_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2313184_2314480_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2314476_2315568_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2315564_2316692_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2316688_2317291_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2317287_2318022_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2318015_2318792_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2318781_2319402_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_069964532.1|2319987_2323842_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2324066_2324366_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2324369_2324564_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_155296177.1|2324831_2328215_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2328666_2329446_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2329487_2329586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2330339_2330525_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2330524_2330728_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2330863_2331937_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2332041_2332341_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2332704_2332944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2333050_2334535_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2334536_2334857_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2334853_2336038_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|2336092_2336263_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2337371_2337632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959845.1|2338496_2338808_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	100.0	1.8e-54
WP_113085484.1|2338832_2339045_-	hypothetical protein	NA	A0A1W6DXJ1	Xanthomonas_phage	100.0	2.4e-26
WP_069959846.1|2339100_2339394_-	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	100.0	3.4e-47
WP_069959847.1|2339554_2340202_-	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	100.0	2.7e-121
WP_069959848.1|2340203_2341397_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	100.0	5.5e-221
WP_011408503.1|2341396_2341726_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_069959849.1|2341725_2343132_-	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	99.6	7.9e-235
WP_011347634.1|2343268_2343499_-	hypothetical protein	NA	A0A1W6DXZ2	Xanthomonas_phage	100.0	2.2e-30
WP_042464854.1|2343510_2343714_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_069959850.1|2343717_2344014_-	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	100.0	2.8e-49
WP_080496434.1|2344010_2345051_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	99.1	7.7e-203
WP_134953795.1|2345037_2345223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408508.1|2345203_2345416_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_069970101.1|2345728_2346358_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2346482_2346665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2346786_2347098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2347167_2347930_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|2348434_2348758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2349371_2349884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2350015_2350778_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082331601.1|2351999_2355797_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2356065_2356260_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2356263_2356563_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964534.1|2356786_2360542_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2360631_2361394_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296744.1|2361413_2361560_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_042464821.1|2361625_2361820_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2361823_2362123_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069959856.1|2362347_2366364_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|2366537_2366759_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2366755_2367427_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011407237.1|2368681_2369638_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|2370052_2371021_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181915.1|2371170_2372490_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182129.1|2372642_2373608_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2373585_2377686_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2377994_2379179_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2379229_2380129_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2380295_2380802_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2381276_2381909_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2381908_2383765_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011408525.1|2383761_2385261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2385203_2385668_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2385664_2386444_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2386735_2387776_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2387772_2389542_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2389538_2390003_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2390006_2390669_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2390697_2393106_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2393359_2394325_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_014503499.1|2395718_2396453_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2396445_2397687_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2397710_2398163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2398113_2398362_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2398472_2399255_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2399271_2399481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2399484_2401275_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2401309_2401696_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2401692_2402088_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2402147_2402414_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2402357_2403230_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2403358_2404456_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2404887_2406318_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2406314_2407322_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2407318_2408038_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2408140_2410057_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2410112_2410772_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2412398_2412602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2413617_2413998_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2414212_2417608_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2419173_2419936_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408544.1|2421831_2422065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2422231_2423206_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_069960088.1|2423969_2424851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408549.1|2426551_2427685_+	phospholipase A	NA	NA	NA	NA	NA
WP_011408550.1|2428113_2428566_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_125168754.1|2428253_2428748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259006.1|2428884_2430402_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_012444869.1|2430735_2432616_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011408551.1|2432804_2433584_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2433734_2434220_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_027703343.1|2436676_2436916_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259011.1|2437167_2437881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2439405_2439906_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757420.1|2440067_2440646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259015.1|2440737_2441238_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259016.1|2441304_2442138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2442188_2442503_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|2442686_2442875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408557.1|2443288_2443897_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	2532936	2581032	4936308	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2532936_2534331_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2534332_2534590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2534586_2534892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2534888_2535215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2535941_2536604_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2536692_2537223_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2539446_2540718_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2540889_2542257_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2542560_2544006_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2544002_2544689_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2544661_2545681_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2545722_2546283_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2546303_2547260_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2547427_2548204_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2548687_2550823_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2550819_2551011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2552785_2553292_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2553332_2553860_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2553856_2554348_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2554371_2554947_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2555023_2555977_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2556065_2556938_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_103057219.1|2556934_2557702_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2557892_2558591_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2558754_2559537_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2559545_2559926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2559922_2560633_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2561943_2562492_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258802.1|2562663_2563632_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408623.1|2564236_2565472_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2566035_2566356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2566695_2567946_+	porin	NA	NA	NA	NA	NA
WP_103057309.1|2568080_2569154_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_011408626.1|2569341_2570433_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2570545_2571520_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2571519_2572389_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2572411_2573242_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2573370_2574081_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2574213_2574621_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2574898_2575540_+	ribonuclease T	NA	NA	NA	NA	NA
WP_155296178.1|2575610_2576930_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2577166_2578228_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2578278_2579463_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2579712_2581032_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	2587751	2658899	4936308	tRNA,transposase,protease	uncultured_Mediterranean_phage(35.71%)	51	NA	NA
WP_011259125.1|2587751_2588897_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2588966_2590037_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2590202_2590634_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2590757_2592254_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_069964538.1|2592213_2592528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|2592598_2593306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2596681_2597803_-	phytase	NA	NA	NA	NA	NA
WP_103057211.1|2600075_2600501_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2600693_2601326_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2601722_2602485_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2602765_2603797_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2603803_2605597_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2605593_2605878_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408650.1|2606109_2606595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2606653_2607160_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2607156_2607777_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2608017_2609922_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2610009_2611067_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2611164_2612484_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2612717_2613875_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2614151_2615117_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2615094_2616570_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011257031.1|2619109_2620078_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075243670.1|2620345_2620585_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2622459_2623680_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2623994_2625392_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|2625402_2626623_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2626619_2627258_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2627328_2628189_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2628185_2628974_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2628984_2630190_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2630208_2630634_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2630853_2631486_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2631510_2633883_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2634040_2635246_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_069959870.1|2635566_2636898_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.1e-41
WP_011408659.1|2636894_2637245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2637276_2637684_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2637680_2638007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2638038_2639415_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2639651_2643818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103073501.1|2643930_2644560_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_069964540.1|2646762_2649120_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_069959872.1|2649403_2650372_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2650429_2651551_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2652978_2653731_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2653811_2654030_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2654310_2656593_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2656736_2657057_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2657307_2657766_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2657762_2658899_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	2739168	2810648	4936308	tRNA,transposase	Ralstonia_phage(41.67%)	48	NA	NA
WP_155296179.1|2739168_2740557_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801909.1|2740644_2741964_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2742113_2743082_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_075242300.1|2743176_2743707_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|2744995_2745758_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2750732_2751701_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|2753764_2754733_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_128415342.1|2756357_2756837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182297.1|2756906_2757869_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011259260.1|2766050_2766443_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2766451_2766913_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2767333_2767732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444749.1|2768208_2768385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2769435_2770401_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408707.1|2770407_2771706_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|2771874_2773560_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2773556_2775293_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_011407237.1|2775809_2776766_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|2776925_2777894_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259269.1|2778650_2778761_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012444741.1|2778981_2780247_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|2780227_2782141_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2782508_2783753_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2783917_2785072_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2785085_2785346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187751.1|2785345_2785714_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2785710_2787006_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|2787129_2788080_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011259279.1|2788692_2790036_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2790075_2791176_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2791181_2791634_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259282.1|2791875_2793117_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2793188_2794214_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2794526_2795021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259285.1|2795191_2796622_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2797119_2797557_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2797553_2798804_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2798871_2799933_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2800075_2801116_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_024710406.1|2801206_2801488_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2801484_2802834_+	dihydroorotase	NA	NA	NA	NA	NA
WP_094187752.1|2802773_2803673_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_094187715.1|2804571_2805334_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2805360_2805624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2805995_2806484_-	general stress protein	NA	NA	NA	NA	NA
WP_011408734.1|2806707_2808027_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2808163_2809132_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|2809331_2810648_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	2842479	2903570	4936308	tRNA,transposase,protease	Bacillus_virus(22.22%)	51	NA	NA
WP_011259328.1|2842479_2843358_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2843455_2844355_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2844442_2845183_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2845342_2845918_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2846091_2847063_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_069964544.1|2847096_2848038_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2848037_2849915_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2850052_2851786_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_012444701.1|2851838_2852339_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2852335_2853823_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2853847_2854915_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2855029_2855793_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182164.1|2855876_2857214_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_069959887.1|2857509_2858772_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2858988_2859736_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2860052_2861888_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2862159_2863251_+	ribonuclease D	NA	NA	NA	NA	NA
WP_080493491.1|2863326_2863716_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_011408757.1|2863579_2863930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2864343_2864745_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011259346.1|2865251_2865386_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015463309.1|2865608_2865788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2866389_2866680_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2866667_2866946_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2867430_2867619_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408522.1|2868391_2869576_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|2870156_2871122_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408763.1|2875614_2876031_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2876241_2876568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2876600_2877041_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2877119_2877755_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_103057267.1|2878148_2878892_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2878899_2880159_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2880158_2880803_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2881332_2882319_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2884254_2885709_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2886132_2887119_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2887530_2888193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2888247_2888733_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2888732_2889251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2889345_2890224_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2890220_2891501_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2891516_2892518_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2892669_2894034_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2894288_2894699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2894854_2895685_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2895998_2897246_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259371.1|2897391_2898903_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2898889_2900476_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2900472_2901675_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_155296180.1|2902181_2903570_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	2930197	2990705	4936308	transposase	Ralstonia_phage(50.0%)	34	NA	NA
WP_012444654.1|2930197_2931181_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	2.0e-96
WP_069964547.1|2931629_2936654_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2936931_2937591_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2937605_2938910_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2938922_2942093_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2943068_2944034_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2944740_2945736_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059317461.1|2945896_2948413_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2948409_2949366_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_069963855.1|2949524_2951267_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011408800.1|2951585_2952722_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|2953388_2954357_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296181.1|2954471_2954627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963899.1|2954838_2955795_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	8.1e-42
WP_041182891.1|2958072_2958804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959893.1|2958835_2961178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2961202_2961931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2962438_2963201_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465604.1|2965142_2965886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964549.1|2965916_2968751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|2968747_2969677_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|2969685_2972448_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_041182637.1|2977332_2977722_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_082325566.1|2979248_2981738_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|2981777_2982167_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408813.1|2982321_2983281_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2983213_2983528_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|2983755_2985075_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257570.1|2985197_2986433_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|2987499_2987916_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_103057251.1|2987912_2988221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182107.1|2988162_2988540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|2988601_2989237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258188.1|2989736_2990705_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 20
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	3007932	3077160	4936308	tRNA,transposase	uncultured_Caudovirales_phage(53.33%)	43	NA	NA
WP_011408830.1|3007932_3008187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103073514.1|3009868_3010555_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_069964553.1|3010870_3011632_+	transporter	NA	NA	NA	NA	NA
WP_069964554.1|3011645_3013988_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_109181932.1|3014484_3015450_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069964555.1|3015689_3017936_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_069964640.1|3018666_3020778_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	2.5e-14
WP_044757389.1|3021461_3023537_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_069964556.1|3024130_3026392_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011259432.1|3026785_3029047_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011259433.1|3030004_3030802_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3030937_3031420_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3032268_3033066_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408843.1|3033327_3033633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408844.1|3033711_3036111_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.9e-09
WP_011408845.1|3036363_3037230_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011259439.1|3037226_3037823_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011259440.1|3037819_3038896_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011408846.1|3039004_3041248_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259442.1|3041903_3042719_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011259443.1|3043072_3045664_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259444.1|3045729_3046140_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003486316.1|3046136_3046385_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259446.1|3046532_3049301_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011259449.1|3049950_3051633_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_011408848.1|3051809_3052679_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259451.1|3052690_3054868_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408849.1|3055232_3056369_-	two-component system response regulator	NA	NA	NA	NA	NA
WP_011408850.1|3056510_3058028_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	3.8e-86
WP_014503214.1|3058231_3059357_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_041182178.1|3059610_3060558_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959908.1|3063364_3064066_+|transposase	transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_011408855.1|3064226_3064604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960095.1|3064785_3065004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959909.1|3065783_3067523_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_011259461.1|3067519_3068440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408858.1|3068456_3068933_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259463.1|3068929_3072172_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012444585.1|3072180_3072624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259464.1|3072623_3073748_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_011408860.1|3073987_3074704_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_094187715.1|3075113_3075877_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257570.1|3075924_3077160_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	3113554	3125329	4936308	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3113554_3113854_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3113896_3114127_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3114370_3115120_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3115124_3115820_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_109181974.1|3115755_3115983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3116005_3116305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3116692_3117097_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3117822_3118035_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3118174_3120823_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3120924_3121413_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3121715_3122750_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3122922_3123564_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3123652_3125329_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 22
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	3165659	3244648	4936308	transposase,plate	Xanthomonas_phage(44.44%)	58	NA	NA
WP_011407237.1|3165659_3166616_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011259549.1|3166714_3167827_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041182180.1|3167823_3168954_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011408908.1|3169075_3169774_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027703449.1|3169770_3171006_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011259553.1|3171018_3171861_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011259554.1|3172141_3172993_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_027703450.1|3173038_3174172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259555.1|3174168_3175119_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069964557.1|3175115_3176369_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_069959913.1|3176365_3177478_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	8.3e-30
WP_069959914.1|3177477_3178410_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069959915.1|3178396_3179350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408914.1|3179353_3180025_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011408915.1|3180021_3180453_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_041182464.1|3180847_3181378_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_012444527.1|3181461_3182802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408918.1|3182827_3183220_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013216.1|3183662_3184451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408920.1|3184514_3185096_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011408921.1|3184987_3185749_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011259567.1|3185745_3187071_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
WP_011259568.1|3187081_3187840_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011408923.1|3187836_3188043_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011259569.1|3188039_3188510_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408924.1|3188573_3190562_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011259571.1|3190558_3191101_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_027703454.1|3191100_3191598_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011408926.1|3191597_3192302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964558.1|3192510_3196230_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3196498_3196693_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|3196696_3196996_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069964559.1|3197219_3201671_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444931.1|3201939_3202134_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408408.1|3202137_3202437_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069964560.1|3202660_3207106_+	avirulence protein	NA	NA	NA	NA	NA
WP_069964561.1|3207585_3208179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959918.1|3208168_3209644_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	5.4e-101
WP_069964562.1|3209726_3212315_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3212371_3213484_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3213608_3214187_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3215673_3217761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3218146_3219244_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3219660_3222741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3225776_3226484_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3226480_3227473_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3227469_3229929_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3230042_3231023_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3231031_3232060_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3232226_3233024_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3233086_3233884_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|3233944_3234271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964563.1|3234267_3237171_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3237167_3237890_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3237886_3238534_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069959923.1|3238530_3241989_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3241992_3243309_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3243310_3244648_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 23
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	3253611	3318820	4936308	transposase,plate	Ralstonia_phage(100.0%)	49	NA	NA
WP_011408954.1|3253611_3254622_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3254585_3256463_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3256466_3256970_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3256957_3257791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3257826_3258330_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3258429_3259944_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3259936_3260443_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3261801_3262770_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_155296182.1|3262905_3264225_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3264395_3265631_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|3265761_3267081_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3267293_3268262_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069964564.1|3268313_3270230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3270247_3270994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3271022_3273857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3274514_3276344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3276357_3276957_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3277044_3277401_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3277397_3277820_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445384.1|3277835_3278069_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_069964565.1|3278095_3278356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704270.1|3278704_3280489_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3280521_3281508_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_069964566.1|3281918_3285638_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3286163_3286927_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3287030_3287678_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3287899_3288661_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011257031.1|3288818_3289787_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408974.1|3289920_3290286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3290344_3290776_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3290787_3292050_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3292033_3293326_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3293695_3294466_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3295222_3296458_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3297757_3298015_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3298454_3299438_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3299753_3300722_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407489.1|3300858_3302178_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408981.1|3302327_3303290_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3303539_3303698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3303729_3303909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3304273_3305239_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3306446_3307424_+	siroheme synthase	NA	NA	NA	NA	NA
WP_069964567.1|3311348_3311606_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011258802.1|3313335_3314304_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3315908_3316871_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3317120_3317279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3317310_3317490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3317854_3318820_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	3472338	3601676	4936308	tRNA,integrase,transposase,protease	Ralstonia_phage(20.0%)	103	3574986:3575045	3594614:3595425
WP_094187736.1|3472338_3473102_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|3473934_3474180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|3474125_3476492_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3476488_3477163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3477372_3478311_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3478433_3479783_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3479779_3480667_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3480984_3481791_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3482236_3483454_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3483559_3484528_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3484947_3485616_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3485612_3486386_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_094187839.1|3486959_3489026_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3489592_3490618_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3490702_3491776_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3491768_3492872_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_069964573.1|3492882_3493809_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_069959940.1|3493889_3494540_+	SCO family protein	NA	NA	NA	NA	NA
WP_069964574.1|3494536_3495385_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_069959942.1|3495935_3497519_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103073413.1|3497705_3498161_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	5.4e-12
WP_011409074.1|3498229_3498697_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_103057205.1|3498941_3500159_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3500119_3500407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960098.1|3500517_3501024_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|3501145_3502546_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|3502808_3503384_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3503380_3503815_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3503842_3504010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3504674_3504860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3504894_3505464_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3505556_3506408_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3507795_3509811_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3510081_3510780_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3510820_3511228_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3511665_3512628_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3513911_3515162_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3515169_3516414_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3516641_3517121_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3517231_3517768_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3517877_3518627_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3518834_3519326_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3520439_3521759_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3521902_3523609_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3523642_3524947_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3524978_3525239_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3525240_3526116_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3527950_3528415_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3528466_3528655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963878.1|3528627_3528948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3528944_3530312_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3530457_3531039_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3531295_3532741_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011409097.1|3533587_3537508_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011259814.1|3537641_3539141_-	ribonuclease G	NA	NA	NA	NA	NA
WP_011409098.1|3539140_3539713_-	Maf-like protein	NA	NA	NA	NA	NA
WP_011409099.1|3539851_3540586_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409100.1|3541057_3544171_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3545589_3546060_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_011259820.1|3546614_3546824_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3547149_3548265_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3548276_3548693_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011409104.1|3548749_3549649_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3549645_3550674_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3550696_3551332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259825.1|3551844_3554487_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3554559_3555171_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3555375_3556233_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3556488_3556938_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|3557215_3558184_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181928.1|3558397_3559363_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3559487_3560250_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3560860_3561154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3561627_3561861_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3561894_3562908_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3562875_3563067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3563157_3564477_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3564564_3565779_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3565924_3566452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182722.1|3566448_3567414_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3567654_3568417_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3568719_3570852_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407175.1|3571402_3572372_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011258803.1|3572532_3573501_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_082323400.1|3574576_3574990_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3574986:3575045	attL	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGA	NA	NA	NA	NA
WP_094187715.1|3574986_3575750_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3576621_3577419_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3577452_3577845_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3577935_3578328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3580666_3581086_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3582802_3584587_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3584777_3584978_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3585513_3586308_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3586609_3587368_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3587443_3589306_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3589363_3589705_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3589964_3590240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3593286_3594000_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|3594060_3594483_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3594614_3595378_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3598451_3599363_-	RNA methyltransferase	NA	NA	NA	NA	NA
3594614:3595425	attR	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGACATCCAGCTTCTCGAAGCGCGTGAAAATCCGTCGGTAGCCCTTCAAGCGACGGAACAGCCTCTCCACTTCGTTGCGCCGCTTGTACATTTCCTTGTCGTACTCCCAAGGATCGACCCGATTGGACTTGGGTGGAACCACCGGCACGAAGCCAAGATCGAGCGCCAACTGGCGGGTTTCATTGCCTTCGTAAGCGCGATCCATCAGCAGATGAACCGGCCGCTCCACTGGCCCCAGGTGTTCAAGCAACGCGCGGCCTGCGGGTGCGTCATGTGCGTTGCCAGGCGTCAATCCGAACGTGATGGCTGTTCGAGCATCTGCGGCAACCATATGAATTTTGGTGTTCCATCCGCCGCGCGATTTCCCGATGGATTGTGGGCCGTTTTTTTTAATGCGCCAGTGCCATCCGGATGCACCTTGATGCTGGTGGAGTCCAGCGAGACCGCTTCGATTTTGATGCGCACGATCTGGCAGGTCTGCAATTGGGCGAACATCCGGTCCAGCACACCGGACTTGGCCCAACGGTTAATGCGCGTGTACACCGTATGCCAGTTGCCAAAGCGCTCGGGCAGACCGCGCCATTTGCAGCCATGCTCTGCGACGTAAAGAAGGGCGTTGACTACCTGCAGGTTGGTCATGCTGACATTGCCGCGTTGCAAAGGTAGGCAATGCTCGATGAGTGCAAATTGTGCTGGCGTGATCTCCATGCCCAATAGTTTAATCGCTCGAGACATTAATGTTAACAGGCCCTAGC	NA	NA	NA	NA
WP_033013519.1|3599878_3600016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801902.1|3600710_3601676_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	3649133	3726199	4936308	transposase,plate	Ralstonia_phage(21.43%)	52	NA	NA
WP_011407175.1|3649133_3650102_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3651122_3652157_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3652540_3653266_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3653397_3653859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3657305_3659426_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3659692_3660538_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3661529_3662498_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3662822_3664793_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3665221_3666619_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3666731_3667550_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011409162.1|3667860_3671058_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
WP_011259908.1|3671293_3672712_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_082348427.1|3672721_3673324_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3673373_3673979_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3674128_3674350_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3674359_3674785_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187763.1|3675276_3676074_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3677151_3677931_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3678145_3678775_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3678835_3679591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963882.1|3679919_3680696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3681104_3682679_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3682927_3683194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964578.1|3683472_3686652_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	4.6e-73
WP_069963885.1|3686651_3687326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959956.1|3687325_3688072_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_069964579.1|3688068_3688878_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258802.1|3688943_3689912_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409179.1|3690732_3691167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|3691177_3692707_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3693009_3694002_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|3694054_3694363_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069959957.1|3694943_3698417_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	22.4	1.5e-08
WP_069964580.1|3698556_3699555_+	Abi family protein	NA	NA	NA	NA	NA
WP_069964581.1|3699601_3701146_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	2.0e-13
WP_069964642.1|3701126_3702605_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011259929.1|3702638_3702947_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3702953_3703217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|3703939_3704695_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069964582.1|3704988_3706005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331605.1|3706016_3707960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964583.1|3707871_3708897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331606.1|3708900_3710844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959964.1|3710755_3711772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331622.1|3711780_3713796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959960.1|3714280_3715312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964585.1|3715320_3718179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465165.1|3718197_3719043_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069963891.1|3719044_3721816_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	5.1e-44
WP_011259938.1|3721908_3722262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3722292_3725022_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3725107_3726199_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 26
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	4125630	4220204	4936308	transposase	Ralstonia_phage(22.22%)	61	NA	NA
WP_115801919.1|4125630_4127238_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4127399_4127663_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4127667_4128327_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4128513_4129878_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4130093_4130789_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4131735_4132359_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409414.1|4132560_4133301_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4133394_4134045_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4134136_4134952_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4135001_4135739_+	endonuclease	NA	NA	NA	NA	NA
WP_011407219.1|4137667_4138651_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4138773_4141347_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4141539_4142302_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4142375_4143344_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|4143674_4144643_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4145237_4145504_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4146435_4147234_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4148880_4150113_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4150152_4151115_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4151290_4152247_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4152458_4153427_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4153762_4154525_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4159362_4159593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4160217_4162260_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4162261_4164160_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4164161_4165415_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_044756435.1|4165411_4166017_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_044756434.1|4166436_4167591_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4167593_4168622_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_012444129.1|4168628_4169696_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4169736_4171014_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4171058_4171826_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959999.1|4172040_4173207_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_069964600.1|4175762_4178660_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_069960264.1|4178810_4181501_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260311.1|4183580_4184765_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4184832_4185570_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4185738_4186254_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4186345_4187848_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4187851_4188292_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4188288_4190100_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|4190385_4190748_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4190907_4191960_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4192299_4193241_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4193261_4194599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4194770_4195151_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4195275_4196037_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4198294_4199698_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4199820_4200876_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_069964507.1|4201771_4203148_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_011260328.1|4203713_4205897_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_041182498.1|4206395_4207391_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_041182275.1|4207486_4209298_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_155296183.1|4209392_4209542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964601.1|4209542_4210556_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_069964602.1|4210570_4211269_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4211256_4211535_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4212600_4213806_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4214306_4215722_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4215718_4216858_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_069963899.1|4219247_4220204_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	8.1e-42
>prophage 27
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	4286089	4428795	4936308	tRNA,transposase	Acinetobacter_phage(30.77%)	115	NA	NA
WP_109181887.1|4286089_4286853_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4287900_4288686_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4288939_4290613_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4291156_4291603_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4291933_4292218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703841.1|4292812_4293724_-	magnesium transporter	NA	NA	NA	NA	NA
WP_027703842.1|4293969_4294965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4295058_4296435_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_011260393.1|4297601_4299302_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_069964605.1|4299710_4301483_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_099051318.1|4301758_4302643_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044757311.1|4302831_4303710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964606.1|4305749_4306841_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011409507.1|4308749_4311074_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069964607.1|4311269_4313216_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_076659567.1|4313590_4313782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756392.1|4314171_4315755_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4316102_4316699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964608.1|4318047_4318896_-	threonine aldolase	NA	NA	NA	NA	NA
WP_011409514.1|4318930_4320406_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4320996_4321926_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4322160_4322652_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4322648_4323320_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4323714_4324044_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_044757306.1|4325651_4326329_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.3	8.8e-75
WP_011409520.1|4328846_4329332_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4329870_4332699_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4332698_4333073_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069960013.1|4333069_4334614_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_044756383.1|4334610_4335117_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4335113_4335398_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4335394_4335748_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|4336195_4336534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|4336717_4337686_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409528.1|4338117_4339443_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011409529.1|4339807_4340878_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4341048_4341537_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4341893_4342484_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409531.1|4342495_4344004_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
WP_011260428.1|4344446_4345340_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075242274.1|4346702_4347368_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_041182581.1|4348000_4348966_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4349498_4349879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4350039_4350803_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103073472.1|4350897_4351803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260437.1|4351871_4353167_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_069960017.1|4353282_4353807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4354232_4355498_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4355494_4356472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4356575_4357379_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4357554_4358364_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4358371_4359170_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187851.1|4359212_4359860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4359954_4360530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4360741_4362061_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4362210_4363179_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260446.1|4363304_4364057_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4364094_4364535_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4364741_4365083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4365308_4365686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4365896_4366094_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_069960019.1|4366400_4367147_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260452.1|4367239_4368046_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4368266_4369679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4369675_4370773_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4370927_4371726_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4371779_4372578_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964610.1|4372797_4373760_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4374207_4374971_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4375252_4376029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4376025_4377342_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4377858_4379094_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4379687_4379969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4380529_4380964_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4381138_4382317_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4383312_4384275_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4386608_4388780_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4389007_4389364_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_069964611.1|4389442_4390507_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
WP_002808376.1|4390786_4391002_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|4391318_4391765_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_012443989.1|4393242_4394205_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4394294_4396043_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_041182298.1|4397370_4397616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4397615_4397882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4398106_4399153_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011409569.1|4399336_4400917_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4401305_4402202_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4402204_4403368_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4403378_4403954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4403981_4404701_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4404761_4404980_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4405072_4405948_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_011260482.1|4405986_4406583_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4406579_4406753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4406733_4408338_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_069964612.1|4408376_4409330_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4409346_4409823_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4410099_4413300_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_109182027.1|4414515_4415481_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960028.1|4415493_4415964_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4416306_4416522_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4416602_4417220_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4417768_4418161_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4418164_4418593_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_069960112.1|4418778_4419432_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4419686_4420001_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4420160_4420955_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4421092_4421785_+	CRP-like protein Clp	NA	NA	NA	NA	NA
WP_011409579.1|4422105_4422822_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4422814_4423612_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4423748_4424786_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4424903_4425533_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4425684_4426266_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_155296184.1|4427693_4428795_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 28
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	4433681	4503478	4936308	tRNA,integrase,transposase	Acidithiobacillus_phage(18.18%)	52	4433563:4433583	4501681:4501701
4433563:4433583	attL	ATAGTCGCCCCTGAAAAACCG	NA	NA	NA	NA
WP_069964614.1|4433681_4435058_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_115801910.1|4437265_4438064_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143699981.1|4439162_4439546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240159.1|4440164_4440395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|4440652_4441621_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_069960033.1|4441787_4442759_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4442951_4444136_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4444603_4445419_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_069960034.1|4446177_4447494_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4447753_4448998_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4449090_4452339_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_069964615.1|4452472_4455613_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4455902_4457270_-	VOC family protein	NA	NA	NA	NA	NA
WP_012443929.1|4457279_4457489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182775.1|4458014_4458980_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|4459398_4460364_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4460826_4461297_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4461325_4461748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4461823_4462258_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4462367_4462883_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4462898_4463924_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4464246_4464843_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_069964617.1|4465200_4466928_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4466977_4468420_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4468404_4469751_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4469941_4470691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4470792_4471404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4471508_4472732_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4473073_4473550_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4473576_4474038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4474423_4474744_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4474845_4475862_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4475933_4477097_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4477093_4478725_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_042465275.1|4478726_4481228_+	helicase SNF2	NA	NA	NA	NA	NA
WP_069964618.1|4481224_4482127_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4482348_4482732_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4483050_4484721_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4484949_4485960_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4486024_4486183_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011260549.1|4486417_4487794_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4487804_4488338_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4488766_4490026_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4490164_4491472_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4493556_4494591_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4494941_4495487_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4495512_4495779_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4495953_4497792_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4498022_4498898_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011257570.1|4500383_4501619_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057293.1|4502040_4502304_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4501681:4501701	attR	CGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_069964619.1|4502497_4503478_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.4e-97
>prophage 29
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	4623186	4681247	4936308	tRNA,transposase	Leptospira_phage(25.0%)	34	NA	NA
WP_155296188.1|4623186_4624152_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4624252_4624678_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4624720_4625483_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4625545_4626577_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4627937_4629194_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4629190_4630081_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4630077_4630473_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4630492_4631071_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4630956_4631814_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4631746_4633135_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082331613.1|4636611_4637034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011257031.1|4637044_4638013_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011260667.1|4639080_4641165_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4641264_4643292_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4643534_4645145_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4645155_4646319_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4646447_4647068_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260672.1|4647629_4647965_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4649589_4649901_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4651019_4651538_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4651809_4653528_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4653618_4654005_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4654066_4655392_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4655506_4656820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4656918_4657644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4657860_4658523_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4658601_4659696_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4661200_4663960_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4664212_4665802_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4665801_4668039_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4668327_4669236_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4669325_4671140_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4671525_4680351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801913.1|4680449_4681247_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013678	Xanthomonas oryzae pv. oryzae strain PXO563, complete genome	4936308	4691423	4768299	4936308	tRNA,tail,transposase	Escherichia_phage(22.22%)	49	NA	NA
WP_011260702.1|4691423_4692341_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4692944_4694282_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4694507_4695575_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011409722.1|4695750_4697946_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4697942_4699907_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4699918_4701178_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4701177_4702878_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_080493943.1|4702880_4705595_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4705817_4707290_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4708267_4709323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4709550_4710969_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4711009_4711987_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_011409726.1|4713403_4714885_-	MFS transporter	NA	NA	NA	NA	NA
WP_099051314.1|4715226_4718100_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4718198_4719686_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4719717_4720752_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_011257570.1|4720839_4722075_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187716.1|4722488_4723286_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|4724162_4724300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|4724592_4725549_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4726276_4727039_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4727056_4728157_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4728222_4729344_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011260726.1|4729353_4730448_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4730522_4731203_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4731235_4732034_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4732162_4733482_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4733584_4734541_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4736007_4736466_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4736567_4736996_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4737242_4738106_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011409690.1|4739587_4740976_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465346.1|4742758_4743025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4743186_4743435_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4743643_4744402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4744398_4745094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4745192_4745525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4745996_4746431_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4746546_4746792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4747127_4747460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260744.1|4747708_4747807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4747909_4749304_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4750232_4750523_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_012443754.1|4750540_4750822_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_069960050.1|4750916_4753169_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.9	1.8e-10
WP_069964628.1|4753356_4757430_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.4	1.9e-10
WP_069964629.1|4757426_4760840_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_133260594.1|4760875_4761178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4767753_4768299_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
