The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	7736	80018	4954304	transposase,protease	Ralstonia_phage(36.36%)	56	NA	NA
WP_011407164.1|7736_8573_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8759_9566_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9842_11036_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257015.1|11944_12706_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12752_13175_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13178_13592_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13887_14655_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14665_14935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|15009_16470_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17116_18127_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18398_19601_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19742_21881_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22091_22385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22416_22914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23160_24141_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24188_25355_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25501_26068_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27542_28751_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29378_30401_-	sugar kinase	NA	NA	NA	NA	NA
WP_011258529.1|31223_32192_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_075243400.1|32544_33816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075244126.1|33812_34520_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.1	5.9e-05
WP_012443646.1|35121_36498_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39510_39753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39694_40018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40483_41464_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_069959662.1|42082_43372_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.0e-39
WP_011407185.1|43811_44147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44421_44853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296471.1|45014_45167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45201_46611_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_041181902.1|46888_47104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47928_48189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48205_48538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48537_48996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|49403_50372_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011407913.1|50515_51730_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|52250_53048_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|54763_55729_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|55725_56004_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182054.1|56147_57536_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|57583_58630_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|58770_59268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|59431_60064_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|60080_62243_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|62357_62543_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|62565_65169_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|65165_67055_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|67111_68869_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|68871_71106_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|71102_72686_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|73159_74788_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|74784_76149_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|76341_77283_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|77523_79248_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|79254_80018_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	122988	167608	4954304	transposase	Ralstonia_phage(14.29%)	34	NA	NA
WP_069959667.1|122988_123939_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	4.4e-96
WP_143699970.1|124052_124262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|124329_124602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|124642_124924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959669.1|125062_126121_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.5	4.9e-72
WP_011407232.1|126261_127209_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|127463_127775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|129241_129712_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|129881_130574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|130665_131064_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|131865_132822_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044756192.1|132796_133267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756194.1|133458_134712_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_069960122.1|135057_135747_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	3.7e-36
WP_011257145.1|135759_136917_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|136929_138240_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155297134.1|138919_139885_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012443655.1|140115_140367_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075239626.1|140819_141221_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012443656.1|141244_141475_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012443657.1|141541_142204_-	hemolysin III	NA	NA	NA	NA	NA
WP_094187820.1|142468_144877_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_027703669.1|144873_146700_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_069960124.1|147188_149333_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|149523_150681_-	ROK family protein	NA	NA	NA	NA	NA
WP_012443664.1|150853_153442_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|153452_154238_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_011407251.1|154551_155691_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|156841_157147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256616.1|157364_158528_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	1.6e-39
WP_011257161.1|158674_159055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|159256_163729_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_069960125.1|163923_165405_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_115877339.1|166642_167608_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	223518	365865	4954304	tRNA,transposase,holin	Bacillus_phage(21.43%)	92	NA	NA
WP_012443704.1|223518_225423_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|225683_225863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|225996_226464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|226621_227581_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|227565_228183_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|228225_228645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959680.1|228897_229803_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.9	2.0e-37
WP_011257202.1|230051_230936_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|230999_231782_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|231826_232588_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_069959681.1|232751_233081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|233399_234491_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|234559_236158_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|236322_237567_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|238018_238648_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|238854_240831_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|242217_242883_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_011257214.1|243169_244180_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|244176_244908_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|245261_246791_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|246900_249933_-	membrane protein	NA	NA	NA	NA	NA
WP_011257218.1|250231_253270_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|253434_254487_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|254655_254901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|254899_255865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|255864_258525_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_011257222.1|260343_260562_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257225.1|263120_263606_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_109182060.1|263637_263964_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257226.1|264185_264830_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|264970_265861_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|265988_266471_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|269506_270040_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|272855_273914_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|274221_275295_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|276057_277110_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|277757_278888_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|280211_280601_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|280808_281015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|281246_282215_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|282468_284631_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|285178_286483_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|286542_287145_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|287141_289046_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|298365_299181_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_011409560.1|299527_300490_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|300594_301357_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|303156_304215_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|304225_304516_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|304505_305168_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|305164_305716_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_069959684.1|305727_306477_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|306476_307271_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|307655_307943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|307961_308519_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|308536_309502_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069959685.1|310346_311303_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.9e-41
WP_109182012.1|311374_312137_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|312176_312975_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|313106_314321_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|314380_315211_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|315373_316609_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|318006_318435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|318454_318895_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011407345.1|318797_319103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|319410_321165_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|322093_322856_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|322909_323494_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|323651_325034_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|325036_327436_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|327539_330182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|330929_334379_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|334571_335156_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|335632_336409_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|336589_337891_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_094187863.1|337887_338253_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|338689_340171_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|340363_341329_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|342154_344317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959687.1|344443_346612_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|347249_347879_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|347881_348313_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_094187815.1|348405_348948_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|349043_349796_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|350020_350410_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|350523_352197_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|352193_352838_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|356522_356807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801865.1|357158_357957_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187710.1|358016_358780_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|362732_363698_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|364758_365865_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	776125	812443	4954304	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_155297136.1|776125_777445_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|777760_778945_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|779474_780788_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|780777_781596_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|781818_782760_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|782759_783506_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|783731_784787_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|784842_785730_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|785726_786284_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|786280_787189_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|787305_788709_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|788755_790102_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|790235_790967_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|790966_791596_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|791653_793741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|793737_795387_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|795502_796111_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|796660_797305_-	ABC transporter	NA	NA	NA	NA	NA
WP_069959724.1|797301_798228_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|798230_799073_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|799158_800271_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|800440_801700_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|801761_802223_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|802365_804060_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|804171_804576_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|804707_805481_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|805491_805959_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011257697.1|805964_806438_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|806996_808316_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|808473_809793_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|810005_810974_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182081.1|811123_812443_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	843550	916567	4954304	transposase	Ralstonia_phage(28.57%)	58	NA	NA
WP_011409190.1|843550_844507_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
WP_011407640.1|845330_847070_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_041181968.1|847066_847246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257722.1|847245_848463_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011407642.1|848730_849162_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257724.1|849171_849681_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011257725.1|849677_850094_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257726.1|850090_850726_+	type II secretion system protein J	NA	NA	NA	NA	NA
WP_011407644.1|850722_851574_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011407645.1|851570_852692_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407646.1|852675_853329_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407647.1|853318_854128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|854124_856437_+	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011257732.1|856433_857273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257733.1|857689_858418_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011407648.1|858523_859099_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_069960151.1|859474_861637_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069960152.1|861672_862830_-	phosphotransferase	NA	NA	NA	NA	NA
WP_011407652.1|863441_864281_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257741.1|871042_871333_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407655.1|871347_872382_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257743.1|872384_873017_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011257744.1|873036_873903_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257745.1|873899_875744_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257746.1|875740_876415_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_069960153.1|876542_878834_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_069960154.1|878945_879911_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|880301_880877_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|880989_881499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|881597_881792_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|881881_882859_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_069960155.1|883088_883529_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|883806_884751_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|884833_885577_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|885781_886021_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|886162_887398_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|887568_888924_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|888984_890058_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|890054_891014_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|891010_891364_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|891886_892360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|892451_893214_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407665.1|893379_893706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075243453.1|893941_895717_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|895685_896582_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_069960157.1|896657_897812_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069960158.1|897978_900570_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011257766.1|900892_901030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960159.1|901302_902502_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011409545.1|902951_903920_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407672.1|904161_906378_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044757093.1|906456_907455_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|907564_907747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757092.1|908726_911714_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044757091.1|911888_912836_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|913333_913870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265185.1|913940_915260_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182785.1|915604_916567_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
>prophage 7
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	920990	1063342	4954304	transposase,integrase,protease	Ralstonia_phage(17.39%)	96	1024524:1024540	1069598:1069614
WP_011407680.1|920990_922118_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|922117_922981_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011257785.1|923274_923460_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011407681.1|923797_925090_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_011407682.1|925415_928088_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
WP_011257788.1|928281_929064_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407683.1|929174_930551_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_014502309.1|930794_931430_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|932056_932590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|932773_933742_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257793.1|933875_934073_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|934082_935195_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_069960160.1|935175_936510_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|936743_937664_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|937740_939057_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|939329_940709_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|940729_941386_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|941514_942168_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|942438_942900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|943959_944844_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|944964_946413_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|946480_947128_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|947944_949018_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|949348_950911_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|950907_952032_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|952107_952365_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|952348_954070_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|954113_955115_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|956391_958269_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|958694_961046_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|961156_962050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187800.1|962095_965065_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_094187799.1|965679_966795_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|966941_967478_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|967674_968157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|970432_971398_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|971394_971568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|971852_972344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|974023_975280_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|975439_976003_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|976369_977728_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|977727_978324_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|978470_979355_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|981336_981951_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|982033_983020_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|983135_983630_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|983874_985704_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|985722_986193_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|987115_988243_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|988343_989726_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|989973_992097_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|992625_993144_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|993848_994950_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|995465_996701_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|997314_998205_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|998294_998435_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|1001994_1003230_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|1004212_1005532_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155297144.1|1006277_1007201_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	4.5e-37
WP_109182121.1|1008263_1009229_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1009530_1011108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1011175_1011939_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1014607_1015576_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1015836_1016298_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1016846_1017089_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1017082_1017846_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1017878_1018610_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1020429_1021182_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181948.1|1021183_1022149_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1022412_1023420_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1023563_1024325_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
1024524:1024540	attL	TCGGGGGTTCGAATCCC	NA	NA	NA	NA
WP_012445939.1|1027642_1028935_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1029027_1029654_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1029778_1031065_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1031208_1033680_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1033893_1034166_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1034997_1036968_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1037673_1038852_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1038848_1039616_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1039628_1040285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1040312_1040765_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1040773_1041508_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1041943_1042648_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1043473_1044103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1044994_1045195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960161.1|1045590_1048311_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	1.1e-70
WP_069960162.1|1048376_1050524_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.3	4.0e-28
WP_069960163.1|1050520_1052203_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_069960164.1|1052199_1052463_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960165.1|1054726_1056409_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_069960164.1|1056405_1056669_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044757078.1|1058932_1060630_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_069960164.1|1060626_1060890_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960166.1|1060951_1061509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862289.1|1061591_1062557_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1062655_1063342_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
1069598:1069614	attR	GGGATTCGAACCCCCGA	NA	NA	NA	NA
>prophage 8
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	1087527	1153380	4954304	transposase	Bacillus_phage(28.57%)	56	NA	NA
WP_011257570.1|1087527_1088763_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1089591_1090560_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075241901.1|1091027_1091378_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_155296575.1|1091459_1092779_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407757.1|1092822_1093158_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011257932.1|1093489_1094416_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_011257933.1|1094476_1095253_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011407759.1|1095553_1096225_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407760.1|1096547_1097186_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011257936.1|1097185_1098457_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011257937.1|1098610_1099702_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011257938.1|1099701_1100964_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_011407761.1|1101116_1101797_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011407762.1|1101963_1103880_-	amylosucrase	NA	NA	NA	NA	NA
WP_011407763.1|1103914_1106359_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407764.1|1106628_1107960_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407765.1|1108200_1109232_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407766.1|1109472_1110213_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_011257945.1|1110324_1111653_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_011407767.1|1111880_1113074_-	porin	NA	NA	NA	NA	NA
WP_011407768.1|1113329_1114031_+	response regulator	NA	NA	NA	NA	NA
WP_011407769.1|1114023_1115409_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	8.3e-11
WP_011407770.1|1115408_1116458_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011257949.1|1116497_1117136_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011257951.1|1117336_1118191_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407771.1|1118187_1118826_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011257953.1|1119134_1120037_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257955.1|1120028_1120808_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_143677753.1|1120804_1122127_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.5e-62
WP_011407773.1|1122469_1125115_-	response regulator	NA	B5LWN0	Feldmannia_species_virus	28.1	4.4e-13
WP_011407774.1|1125436_1126609_-	porin	NA	NA	NA	NA	NA
WP_011407775.1|1126899_1128273_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011257960.1|1128470_1130780_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_109182097.1|1131508_1132610_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1134040_1134664_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1134687_1134927_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1134976_1135858_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1136007_1136457_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1136607_1137255_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1137346_1137817_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1137813_1138404_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1139012_1139312_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1139308_1139530_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1139765_1140308_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1140318_1141659_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_094187736.1|1142366_1143130_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1143362_1144688_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1144886_1145234_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1145230_1147639_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1147817_1148975_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1148990_1149590_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1149586_1149982_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1149978_1150704_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1150813_1151674_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1151790_1152402_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1152582_1153380_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	1161811	1225960	4954304	transposase	Leptospira_phage(14.29%)	51	NA	NA
WP_115801874.1|1161811_1163131_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407794.1|1163494_1164145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187795.1|1164454_1166977_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1167099_1168158_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1168157_1168916_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1168912_1169578_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1169574_1170108_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1170127_1172077_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1172147_1172946_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1173088_1174324_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082323365.1|1174394_1175429_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	1.1e-65
WP_069959744.1|1176107_1177070_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_069959745.1|1177090_1178053_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1178055_1178517_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1178513_1179521_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_069959746.1|1179517_1181320_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1181316_1183074_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1183369_1183687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057328.1|1183884_1185165_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1185384_1187385_+	transketolase	NA	NA	NA	NA	NA
WP_069959747.1|1188203_1188911_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.6e-05
WP_011407808.1|1188913_1189906_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1190225_1192940_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1193059_1194235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464577.1|1194369_1196328_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1196503_1197151_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1197147_1198647_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1198643_1199318_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_069959748.1|1199317_1200157_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1200823_1201522_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1201539_1202901_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1203000_1203366_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959749.1|1203355_1204672_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1204668_1205253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1205595_1206210_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1206209_1206902_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069959750.1|1206912_1207689_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1207759_1208590_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069959751.1|1208603_1209377_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_153296750.1|1212450_1212591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1213247_1214249_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109181945.1|1214636_1215399_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1215488_1216454_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1216563_1217883_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1218345_1219023_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_069960073.1|1219120_1219492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1219705_1220593_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1221026_1222011_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_069960168.1|1222183_1224271_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_069960169.1|1224422_1225082_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1225162_1225960_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	1471866	1609781	4954304	tRNA,transposase	Ralstonia_phage(16.67%)	106	NA	NA
WP_109181897.1|1471866_1472832_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258243.1|1473211_1473889_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1474426_1474651_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_069959779.1|1474650_1476723_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_069959780.1|1476954_1477812_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323430.1|1478835_1481235_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_011258248.1|1481231_1482179_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080497155.1|1482171_1482777_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1483171_1483720_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1484114_1484672_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1484721_1486830_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069959782.1|1486851_1488753_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
WP_027704078.1|1488807_1489668_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080493959.1|1489628_1490315_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959783.1|1490778_1491012_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1492000_1492588_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_109182101.1|1492895_1493375_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1493371_1495780_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1496124_1496586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1496832_1497723_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1497900_1498419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1498490_1499204_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1499307_1500057_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1500417_1500669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1501001_1503059_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1505006_1506128_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011258263.1|1506142_1506970_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1506953_1508237_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1508263_1508779_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1508789_1510946_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1511013_1513011_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1513029_1513359_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1513398_1513617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1513848_1517313_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1517715_1518258_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1518669_1519578_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1519923_1520722_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1520865_1521585_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_133265085.1|1521740_1522775_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1522795_1523608_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1524343_1524727_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1524840_1526010_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1526004_1527063_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1527123_1527936_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1528451_1528835_+	membrane protein	NA	NA	NA	NA	NA
WP_155297137.1|1528822_1528960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960178.1|1529002_1530166_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	4.4e-98
WP_069960179.1|1530196_1531009_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_103057736.1|1531240_1531798_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407587.1|1531878_1532913_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011258802.1|1533180_1534149_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_050580205.1|1534259_1535105_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_069960180.1|1535126_1536230_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1536298_1537702_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1537715_1538222_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1538627_1539086_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1539863_1540067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1541628_1542114_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1542341_1542557_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1542807_1543287_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027704135.1|1543418_1543847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258297.1|1543919_1544750_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011258298.1|1544811_1545579_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1545578_1545794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1545939_1546731_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_033013599.1|1546888_1548052_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|1550284_1550923_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1551098_1553039_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1553255_1553810_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1554031_1555462_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258308.1|1555528_1556983_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011258309.1|1557399_1558125_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1558223_1558634_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1558685_1559642_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1559885_1562267_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258314.1|1564923_1565334_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1565633_1565816_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1565948_1566989_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1567061_1568507_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_027704131.1|1568633_1569932_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_012444410.1|1570188_1570734_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_012444411.1|1570730_1572194_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1573656_1573911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704130.1|1574313_1574847_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1574872_1575274_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1575242_1575623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1575619_1575862_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258329.1|1577226_1579131_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_069960185.1|1579394_1581791_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_069960186.1|1581940_1582663_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_059317476.1|1585582_1586083_+	RraA family protein	NA	NA	NA	NA	NA
WP_069960187.1|1586024_1587701_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1587847_1589113_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|1589171_1590365_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|1590361_1591051_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_033013597.1|1591156_1592626_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1592645_1593482_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1593507_1594611_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|1594607_1597664_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069960188.1|1597729_1598320_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069959790.1|1598451_1600284_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1600359_1601123_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1601165_1602485_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1603782_1608273_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|1608269_1608761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|1608812_1609781_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 11
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	1668315	1807740	4954304	tRNA,portal,head,terminase,capsid,plate,holin,integrase,tail,transposase	Stenotrophomonas_phage(42.86%)	115	1709514:1709534	1767246:1767266
WP_069960189.1|1668315_1671147_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|1671461_1671962_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|1672049_1673000_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1673513_1674449_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1674448_1676449_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011408098.1|1676451_1677078_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1677077_1677413_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_011258405.1|1677762_1679460_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012444470.1|1679684_1681931_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_041182048.1|1681954_1683574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960190.1|1683717_1688301_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
WP_125168749.1|1688290_1688890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181910.1|1690625_1691727_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.2e-41
WP_011408105.1|1693603_1696159_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
WP_012445369.1|1699128_1700523_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011258422.1|1701910_1703467_+	membrane protein	NA	NA	NA	NA	NA
WP_011408111.1|1706050_1707289_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1707729_1708023_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|1708520_1709297_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|1709454_1711221_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
1709514:1709534	attL	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_011258428.1|1711732_1712260_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703718.1|1712359_1713037_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011258430.1|1713126_1713855_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|1713969_1714494_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|1714651_1715236_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|1715435_1717343_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|1717471_1718509_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|1718561_1719020_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012445351.1|1719031_1719811_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|1719967_1720417_+	protein TolR	NA	NA	NA	NA	NA
WP_044756956.1|1720406_1721447_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_041182054.1|1721706_1723026_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|1723083_1723602_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011258440.1|1723608_1724427_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|1724469_1725153_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_019301562.1|1725986_1726097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408120.1|1726386_1727097_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_011408121.1|1727331_1727538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057327.1|1729331_1729910_-	amino acid transporter	NA	NA	NA	NA	NA
WP_011257310.1|1732445_1733681_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1733731_1734495_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1734561_1735938_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1736316_1736991_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011258445.1|1737235_1738420_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.2	2.0e-122
WP_011258446.1|1738419_1738680_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.9e-18
WP_011408130.1|1738637_1738844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408131.1|1738840_1739113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182407.1|1739109_1739355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258447.1|1739351_1739627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010364106.1|1739788_1740199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|1740424_1740703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|1740699_1740918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|1741226_1743899_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|1743932_1744145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|1744141_1744420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408136.1|1744430_1744751_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
WP_053503015.1|1744753_1745011_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|1745082_1745520_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|1746180_1747167_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|1747163_1747565_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_011258455.1|1747577_1750448_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.2	6.4e-207
WP_011258456.1|1750480_1750594_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|1750602_1750905_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|1750950_1751460_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_069959796.1|1751490_1752657_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.7	7.9e-132
WP_069959797.1|1752668_1753028_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	5.6e-36
WP_069959798.1|1753024_1753588_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.8	2.2e-26
WP_069959799.1|1753648_1754227_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069959800.1|1754234_1755740_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.2	1.7e-54
WP_041182705.1|1755749_1756295_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.0	1.2e-50
WP_069959801.1|1756287_1757178_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	52.7	4.9e-81
WP_080493952.1|1757551_1759411_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_069959803.1|1759528_1759978_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.6	3.5e-35
WP_069959804.1|1759965_1760385_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	2.6e-40
WP_069959805.1|1760381_1760870_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.4	3.2e-26
WP_011258470.1|1760869_1761511_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_041182057.1|1761507_1761783_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.9e-21
WP_069959806.1|1761775_1762132_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	54.4	2.9e-21
WP_048483447.1|1762136_1762346_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	2.0e-14
WP_011408149.1|1762345_1762813_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	2.0e-30
WP_011258475.1|1762912_1763632_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_011258476.1|1763635_1764652_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	5.5e-137
WP_011408152.1|1764698_1765541_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	2.0e-68
WP_011408153.1|1765662_1767447_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.6	4.7e-269
1767246:1767266	attR	CGCCGGCTGGACCGACGTGGC	NA	NA	NA	NA
WP_069959807.1|1767446_1768469_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	2.6e-139
WP_075251737.1|1768494_1768740_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	50.0	7.7e-13
WP_011408155.1|1768657_1769359_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.2	3.2e-104
WP_011408156.1|1769424_1770171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408157.1|1770167_1770875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408158.1|1770888_1771230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052285781.1|1771210_1771768_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
WP_011408160.1|1771716_1772118_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011408161.1|1773256_1774543_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.2	1.4e-81
WP_011408162.1|1774770_1775106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408164.1|1775812_1776217_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1776295_1776793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1776931_1778728_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1779282_1779828_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1779929_1784051_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1784271_1786914_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1788355_1789870_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187782.1|1790040_1790803_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1791114_1791627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1791689_1792808_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1792804_1793083_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1793079_1793832_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1793828_1794728_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1794811_1794892_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1795181_1797368_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1797678_1799121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1799453_1801556_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1801797_1804242_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1804255_1804780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1804979_1807007_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1807020_1807740_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	1944307	1988652	4954304	transposase,protease	Tupanvirus(16.67%)	39	NA	NA
WP_011408249.1|1944307_1945894_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_011258599.1|1946059_1947865_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	6.1e-22
WP_011258600.1|1947971_1948772_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1948802_1949180_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1949169_1949850_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1949846_1950746_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1950969_1951692_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1951840_1952563_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1952721_1954056_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1954230_1954728_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1954823_1956059_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1956287_1957664_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1957783_1958467_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1958483_1959518_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069960195.1|1959698_1961276_+	deoxyribodipyrimidine photolyase	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1961393_1962398_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1962397_1962952_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1963037_1963790_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1963876_1964083_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1965593_1966238_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1966227_1968729_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1968725_1970330_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1970326_1970560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1970556_1971579_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1971915_1972281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1972277_1972868_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1972965_1974675_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1974783_1975110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1975339_1975684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1975806_1976982_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1977137_1979966_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1980026_1981127_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1981593_1982121_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1982522_1982696_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1982856_1983111_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1983285_1983552_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1983742_1984309_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109182117.1|1985796_1987116_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1987683_1988652_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 13
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2004098	2076335	4954304	tRNA,protease,transposase,coat	Emiliania_huxleyi_virus(20.0%)	59	NA	NA
WP_109181916.1|2004098_2004861_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408287.1|2005252_2007817_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|2008796_2009144_+	RidA family protein	NA	NA	NA	NA	NA
WP_011408291.1|2009305_2010376_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408292.1|2010393_2011176_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011408293.1|2011172_2011718_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011408294.1|2011714_2013010_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_099051285.1|2013006_2013966_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011408296.1|2013890_2015141_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408297.1|2015137_2016136_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_011258658.1|2016361_2017207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|2017191_2017755_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|2017813_2018182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464748.1|2018267_2019050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408301.1|2019668_2020097_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_041182084.1|2020098_2020695_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258663.1|2020902_2022987_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|2023211_2023661_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_069960197.1|2024424_2025483_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|2025752_2027150_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|2027146_2028124_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|2028305_2030243_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|2030663_2031440_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|2031444_2032119_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|2033749_2035126_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|2035165_2035561_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|2035603_2037079_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|2037875_2038292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2038305_2038476_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|2042170_2042734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258677.1|2043206_2044523_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|2044690_2045293_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|2045366_2045813_+	membrane protein	NA	NA	NA	NA	NA
WP_075244058.1|2045890_2046121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075244057.1|2046110_2046362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258680.1|2046978_2048322_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044756910.1|2048258_2049671_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044756909.1|2049667_2050405_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|2050404_2052585_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258685.1|2053424_2054384_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_069960198.1|2054559_2058150_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	1.3e-180
WP_011408322.1|2058607_2059348_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2059344_2060601_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2060639_2061431_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2061454_2061916_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258691.1|2061912_2062926_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258692.1|2063325_2065779_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_069960199.1|2065775_2067122_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2067148_2068339_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2068341_2069169_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2069165_2069927_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2069944_2070502_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2070682_2071405_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2071461_2071839_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2071966_2072845_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2073014_2073818_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2074193_2074919_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2074921_2075254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2075300_2076335_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 14
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2131162	2258895	4954304	tRNA,transposase	Ralstonia_phage(19.23%)	96	NA	NA
WP_115801887.1|2131162_2132482_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2132816_2133743_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2133872_2134478_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2134816_2136586_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_103073520.1|2136582_2137176_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_011258751.1|2137443_2138037_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2138235_2139672_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2139913_2141116_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2141158_2143987_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2144167_2145100_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2145096_2146596_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2146933_2147197_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2147476_2147977_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2148218_2149586_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181945.1|2152608_2153371_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296175.1|2153331_2153475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|2154823_2156227_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_027703710.1|2156349_2156772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2157404_2158241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258771.1|2158250_2159237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258772.1|2159233_2160109_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_014502778.1|2160105_2160468_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2160470_2160719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2160854_2161412_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2161503_2162469_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2162494_2163844_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2163836_2164073_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2164073_2164826_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2165159_2166005_+	transporter	NA	NA	NA	NA	NA
WP_069960295.1|2166145_2167321_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011258781.1|2167334_2168645_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_103073473.1|2168569_2169628_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258783.1|2169624_2170830_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_012445124.1|2171216_2173970_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2174112_2175252_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2175248_2176244_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057266.1|2176365_2177514_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2177513_2177654_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2178025_2179471_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2180037_2182566_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2182776_2183575_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2184645_2185413_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2185414_2185762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|2185920_2186889_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011408397.1|2189652_2190837_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2190891_2192367_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2192688_2192871_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2193019_2194219_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_069960202.1|2195079_2196048_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011257031.1|2196239_2197208_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181930.1|2197487_2198286_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|2198511_2199477_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|2201706_2202672_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2203703_2204672_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181933.1|2205848_2206951_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2207137_2207605_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_099051282.1|2207965_2208730_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2208736_2210086_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187763.1|2210235_2211034_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801888.1|2211473_2212793_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069960203.1|2213005_2213974_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.3	6.2e-98
WP_069959827.1|2214025_2214622_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2214721_2215735_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2216425_2216692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182103.1|2216935_2217031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960204.1|2217104_2220620_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2220843_2221143_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2221146_2221341_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_153296744.1|2221407_2221554_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_082323372.1|2221609_2225212_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_069959830.1|2226762_2228238_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	9.2e-101
WP_069959831.1|2228378_2232506_-	avirulence protein	NA	NA	NA	NA	NA
WP_155296580.1|2232794_2234114_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2235945_2237031_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2237358_2238057_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2238059_2238626_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2238637_2239315_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2239403_2240834_-	amino acid permease	NA	NA	NA	NA	NA
WP_011408420.1|2240910_2242392_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2242528_2243116_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2243271_2244513_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2244721_2246140_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2246174_2246474_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2246470_2248342_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011258847.1|2248631_2249651_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094187828.1|2249644_2250055_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2250072_2250675_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2250667_2252605_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2252773_2253244_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2253240_2253411_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2253407_2254160_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011258853.1|2254254_2254950_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2254946_2255591_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2255817_2256966_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2257105_2257909_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2257929_2258895_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2359952	2494136	4954304	tRNA,protease,transposase	Xanthomonas_phage(60.47%)	119	NA	NA
WP_012444952.1|2359952_2361365_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2361870_2362669_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2362982_2363309_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2363318_2364233_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2364229_2365525_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2365521_2366613_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2366609_2367737_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2367733_2368336_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2368332_2369067_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2369060_2369837_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2369826_2370447_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_069960206.1|2371032_2374887_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2375111_2375411_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2375414_2375609_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_137455828.1|2375876_2379260_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2379711_2380491_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2380532_2380631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2381384_2381570_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2381569_2381773_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2381908_2382982_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2383086_2383386_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2383749_2383989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2384095_2385580_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2385581_2385902_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2385898_2387083_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|2387137_2387308_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240058.1|2387371_2387773_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
WP_075240059.1|2388416_2388677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155297138.1|2388965_2389127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959845.1|2389541_2389853_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	100.0	1.8e-54
WP_113085484.1|2389877_2390090_-	hypothetical protein	NA	A0A1W6DXJ1	Xanthomonas_phage	100.0	2.4e-26
WP_069959846.1|2390145_2390439_-	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	100.0	3.4e-47
WP_069959847.1|2390599_2391247_-	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	100.0	2.7e-121
WP_069959848.1|2391248_2392442_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	100.0	5.5e-221
WP_011408503.1|2392441_2392771_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_069959849.1|2392770_2394177_-	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	99.6	7.9e-235
WP_011347634.1|2394313_2394544_-	hypothetical protein	NA	A0A1W6DXZ2	Xanthomonas_phage	100.0	2.2e-30
WP_042464854.1|2394555_2394759_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_069959850.1|2394762_2395059_-	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	100.0	2.8e-49
WP_080496434.1|2395055_2396096_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	99.1	7.7e-203
WP_011408508.1|2396248_2396461_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_155296581.1|2396454_2396679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970101.1|2396773_2397403_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2397527_2397710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2397831_2398143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2398212_2398975_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2399494_2400463_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168752.1|2400639_2400963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2401576_2402089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2402219_2402982_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082323370.1|2404203_2408001_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2408269_2408464_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2408467_2408767_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_109181946.1|2412341_2413104_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296744.1|2413123_2413270_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_042464821.1|2413335_2413530_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2413533_2413833_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069960207.1|2414057_2418074_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|2418247_2418469_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082323384.1|2418465_2419023_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.0	7.9e-21
WP_125168753.1|2420168_2420414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2420397_2421354_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|2421768_2422737_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_041182129.1|2422881_2423847_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2423824_2427925_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2428233_2429418_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2429468_2430368_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2430534_2431041_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2431515_2432148_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2432147_2434004_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011408525.1|2434000_2435500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2435442_2435907_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2435903_2436683_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2436974_2438015_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2438011_2439781_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2439777_2440242_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2440245_2440908_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2440936_2443345_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2443598_2444564_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2445957_2446692_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2446684_2447926_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2447949_2448402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2448352_2448601_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2448711_2449494_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2449510_2449720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2449723_2451514_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2451548_2451935_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2451931_2452327_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2452386_2452653_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2452596_2453469_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2453597_2454695_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2455126_2456557_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2456553_2457561_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2457557_2458277_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2458379_2460296_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2460351_2461011_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2462637_2462841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2463856_2464237_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2464450_2467846_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2469411_2470174_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408544.1|2472069_2472303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2472469_2473444_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_069960088.1|2474207_2475089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408549.1|2476789_2477923_+	phospholipase A	NA	NA	NA	NA	NA
WP_011408550.1|2478351_2478804_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_125168754.1|2478491_2478986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259006.1|2479122_2480640_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_012444869.1|2480973_2482854_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011408551.1|2483042_2483822_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2483972_2484458_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_027703343.1|2486914_2487154_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_069959861.1|2487405_2488119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2489643_2490144_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757420.1|2490305_2490884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259015.1|2490975_2491476_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069960208.1|2491542_2492376_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_069960296.1|2492426_2492741_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|2492924_2493113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408557.1|2493527_2494136_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 16
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2583180	2631333	4954304	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2583180_2584575_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2584576_2584834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2584830_2585136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2585132_2585459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2586185_2586848_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2586936_2587467_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2589690_2590962_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2591133_2592501_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2592804_2594250_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2594246_2594933_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2594905_2595925_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2595966_2596527_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2596547_2597504_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2597671_2598448_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2598931_2601067_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2601063_2601255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2603029_2603536_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2603576_2604104_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2604100_2604592_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2604615_2605191_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2605267_2606221_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2606309_2607182_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_103057219.1|2607178_2607946_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2608136_2608835_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2608998_2609781_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2609789_2610170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2610166_2610877_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2612187_2612736_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258802.1|2612907_2613876_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408623.1|2614480_2615716_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2616279_2616600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2616939_2618190_+	porin	NA	NA	NA	NA	NA
WP_103057309.1|2618324_2619398_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_011408626.1|2619585_2620677_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2620789_2621764_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2621763_2622633_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2622655_2623486_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2623614_2624325_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_012444782.1|2624457_2624853_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2625130_2625772_+	ribonuclease T	NA	NA	NA	NA	NA
WP_129593080.1|2625842_2627162_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756859.1|2627398_2628460_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325607.1|2628510_2629695_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_155297139.1|2629944_2631333_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2637983	2709115	4954304	tRNA,protease,transposase	uncultured_Mediterranean_phage(33.33%)	52	NA	NA
WP_011259125.1|2637983_2639129_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2639198_2640269_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2640455_2640887_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069960212.1|2641010_2642507_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2642851_2643559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325608.1|2644848_2646225_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.0e-77
WP_069960215.1|2646905_2648027_-	phytase	NA	NA	NA	NA	NA
WP_103057360.1|2650293_2650719_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2650911_2651544_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2651940_2652703_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2652983_2654015_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2654021_2655815_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2655811_2656096_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408650.1|2656327_2656813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2656871_2657378_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_069960299.1|2657374_2657995_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2658235_2660140_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2660227_2661285_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2661382_2662702_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2662935_2664093_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181928.1|2664369_2665335_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2665312_2666788_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011257031.1|2669327_2670296_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075243670.1|2670563_2670803_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2672677_2673898_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2674212_2675610_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|2675620_2676841_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2676837_2677476_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2677546_2678407_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2678403_2679192_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2679202_2680408_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2680426_2680852_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2681071_2681704_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2681728_2684101_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2684258_2685464_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_069959870.1|2685784_2687116_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.1e-41
WP_011408659.1|2687112_2687463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2687494_2687902_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2687898_2688225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2688256_2689633_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2689869_2694036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103073501.1|2694148_2694778_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_069960218.1|2694884_2696813_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2696975_2699336_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_069959872.1|2699619_2700588_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2700645_2701767_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2703194_2703947_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2704027_2704246_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2704526_2706809_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2706952_2707273_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2707523_2707982_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2707978_2709115_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2790857	2819494	4954304	transposase	Ralstonia_phage(80.0%)	12	NA	NA
WP_011407175.1|2790857_2791826_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_128896930.1|2791920_2792457_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_103073433.1|2792489_2797325_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.4e-09
WP_011258802.1|2798660_2799629_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|2801692_2802661_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_128415342.1|2804285_2804765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2812898_2813291_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2813299_2813761_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2814181_2814580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2816283_2817249_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323388.1|2817255_2818401_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959881.1|2818525_2819494_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
>prophage 19
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2841805	2902406	4954304	tRNA,protease,transposase	Moumouvirus(10.0%)	53	NA	NA
WP_011259285.1|2841805_2843236_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2843733_2844171_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2844167_2845418_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2845485_2846547_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2846689_2847730_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_024710406.1|2847820_2848102_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2848098_2849448_+	dihydroorotase	NA	NA	NA	NA	NA
WP_094187752.1|2849387_2850287_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_094187715.1|2851184_2851947_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2851973_2852237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2852608_2853097_-	general stress protein	NA	NA	NA	NA	NA
WP_011408734.1|2853320_2854640_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2854776_2855745_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|2855944_2857261_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2857620_2858802_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2860390_2862061_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2862277_2862967_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2862995_2863700_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2863773_2864493_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_011408737.1|2864523_2865873_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_099051322.1|2865880_2866717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2866875_2867442_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2867543_2868572_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2868790_2870908_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187831.1|2870904_2871825_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2871885_2872650_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2872768_2873602_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2873854_2874466_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2874720_2875161_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2875157_2875583_+	barstar family protein	NA	NA	NA	NA	NA
WP_027703271.1|2876031_2877927_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.8e-48
WP_069959885.1|2878016_2879393_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_011259319.1|2879495_2880056_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2880153_2881710_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2881993_2882869_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012444709.1|2883069_2883768_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2883938_2884148_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2884417_2884903_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2884973_2885522_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2885518_2886700_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2886923_2888993_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2889092_2889971_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2890068_2890968_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2891055_2891796_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2891955_2892531_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2892704_2893676_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2893709_2894651_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2894650_2896528_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2896665_2898399_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_012444701.1|2898451_2898952_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2898948_2900436_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2900460_2901528_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2901642_2902406_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2905601	2977809	4954304	tRNA,protease,transposase	Bacillus_phage(18.18%)	55	NA	NA
WP_094187754.1|2905601_2906349_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2906665_2908501_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2908772_2909864_+	ribonuclease D	NA	NA	NA	NA	NA
WP_080493491.1|2909939_2910329_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_011408757.1|2910192_2910543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2910956_2911358_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011259346.1|2911864_2911999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015463309.1|2912221_2912401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004541336.1|2912544_2912742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2913002_2913293_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2913280_2913559_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2914043_2914232_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408397.1|2915004_2916189_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|2916769_2917735_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408763.1|2922227_2922644_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2922854_2923181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2923213_2923654_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2923732_2924368_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_103057267.1|2924761_2925505_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2925512_2926772_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2926771_2927416_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2927945_2928932_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2930867_2932322_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2932745_2933732_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2934143_2934806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2934860_2935346_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2935345_2935864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2935958_2936837_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2936833_2938114_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2938129_2939131_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2939282_2940647_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2940901_2941312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2941467_2942298_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2942611_2943859_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259371.1|2944004_2945516_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2945502_2947089_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2947085_2948288_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115840172.1|2948794_2950183_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2950416_2951802_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2952709_2954089_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2954088_2955405_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012444665.1|2955541_2956786_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
WP_041182168.1|2957093_2958374_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_094187755.1|2958679_2958988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2958947_2961296_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2961292_2962138_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011408786.1|2962144_2963869_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_041182645.1|2964011_2964344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259384.1|2964398_2965751_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_027703775.1|2965811_2968949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259386.1|2969115_2969970_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_027703774.1|2970140_2971445_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_069960220.1|2971586_2975681_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_027703772.1|2975714_2976701_+	response regulator	NA	W8CYM9	Bacillus_phage	27.6	9.7e-06
WP_069960221.1|2976825_2977809_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	4.5e-96
>prophage 21
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	2989696	3070566	4954304	transposase	uncultured_Caudovirales_phage(58.33%)	50	NA	NA
WP_109181969.1|2989696_2990662_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2991368_2992364_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059317461.1|2992524_2995041_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2995037_2995994_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_011259402.1|2996152_2997895_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011408800.1|2998212_2999349_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258188.1|3000015_3000984_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069959892.1|3001278_3003624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|3003641_3004373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959893.1|3004404_3006747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|3006771_3007500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|3007528_3009871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|3009895_3010639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960223.1|3010669_3013504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444637.1|3013500_3014430_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082325592.1|3018764_3021356_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|3021395_3021785_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_041182637.1|3025525_3025915_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408813.1|3026069_3027029_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3026961_3027276_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_155297140.1|3027503_3028823_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027703777.1|3028889_3029282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113124205.1|3029664_3032706_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959900.1|3033755_3034208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959901.1|3034462_3036268_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|3036269_3036617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|3036692_3037400_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011259416.1|3037551_3037944_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075251701.1|3037966_3038482_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959903.1|3038478_3038832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|3038920_3039661_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|3039667_3040642_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_069959904.1|3040643_3041426_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|3041422_3042445_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3042545_3042854_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3042850_3043216_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259422.1|3043249_3045259_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_069960094.1|3045433_3045688_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103073514.1|3047370_3048057_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408833.1|3048372_3049134_+	transporter	NA	NA	NA	NA	NA
WP_044756756.1|3049147_3051490_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_115840174.1|3051986_3052952_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960225.1|3053191_3055438_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	4.9e-13
WP_042465628.1|3056166_3058278_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_069959907.1|3058962_3061038_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|3061630_3063892_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|3064285_3066547_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011259433.1|3067504_3068302_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3068437_3068920_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3069768_3070566_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	3149748	3161523	4954304	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3149748_3150048_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3150090_3150321_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3150564_3151314_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3151318_3152014_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_109181974.1|3151949_3152177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3152199_3152499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3152886_3153291_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3154016_3154229_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3154368_3157017_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3157118_3157607_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3157909_3158944_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3159116_3159758_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3159846_3161523_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 23
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	3201833	3280731	4954304	plate,transposase	Xanthomonas_phage(50.0%)	58	NA	NA
WP_011407237.1|3201833_3202790_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011259549.1|3202888_3204001_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041182180.1|3203997_3205128_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011408908.1|3205249_3205948_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027703449.1|3205944_3207180_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011259553.1|3207192_3208035_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011259554.1|3208315_3209167_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_041182463.1|3209212_3210346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259555.1|3210342_3211293_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259556.1|3211289_3212543_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_012444529.1|3212539_3213652_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.1	4.1e-29
WP_069959914.1|3213651_3214584_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069959915.1|3214570_3215524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408914.1|3215527_3216199_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011259561.1|3216195_3216627_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_027703451.1|3217021_3217552_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_012444527.1|3217635_3218976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408918.1|3219001_3219394_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013216.1|3219836_3220625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408920.1|3220688_3221270_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011408921.1|3221161_3221923_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011259567.1|3221919_3223245_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
WP_011259568.1|3223255_3224014_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011408923.1|3224010_3224217_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011259569.1|3224213_3224684_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408924.1|3224747_3226736_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011259571.1|3226732_3227275_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_027703454.1|3227274_3227772_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011408926.1|3227771_3228476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960228.1|3228684_3232404_+	avirulence protein	NA	NA	NA	NA	NA
WP_155296488.1|3232459_3232606_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	77.8	4.1e-06
WP_042464821.1|3232672_3232867_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|3232870_3233170_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069960229.1|3233393_3237845_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|3238113_3238308_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408930.1|3238311_3238611_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	3.2e-45
WP_011408931.1|3238834_3243175_+	avirulence protein	NA	NA	NA	NA	NA
WP_069960230.1|3244237_3245713_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	7.0e-101
WP_069960231.1|3245795_3248384_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3248440_3249553_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756724.1|3249677_3250256_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756721.1|3251756_3253844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3254229_3255327_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3255743_3258824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3261859_3262567_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3262563_3263556_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3263552_3266012_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3266125_3267106_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3267114_3268143_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3268309_3269107_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3269169_3269967_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|3270027_3270354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959922.1|3270350_3273254_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3273250_3273973_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3273969_3274617_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_044756717.1|3274613_3278072_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012444499.1|3278075_3279392_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3279393_3280731_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 24
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	3289732	3355417	4954304	plate,transposase	Ralstonia_phage(83.33%)	50	NA	NA
WP_011408954.1|3289732_3290743_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3290706_3292584_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3292587_3293091_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3293078_3293912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3293947_3294451_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_024711387.1|3296056_3296563_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3297920_3298889_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_155296489.1|3299024_3300344_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3300514_3301750_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3301935_3302904_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3302955_3304872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3304896_3305634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3305664_3308007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3308024_3308771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3308799_3311634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3312291_3314121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3314134_3314734_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3314821_3315178_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3315174_3315597_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3315612_3315846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960235.1|3315872_3316133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960236.1|3316481_3318266_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011259619.1|3318298_3319285_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3319695_3323409_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3323934_3324698_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3324801_3325449_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3325670_3326432_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011257031.1|3326589_3327558_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408974.1|3327691_3328057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3328115_3328547_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3328558_3329821_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3329804_3331097_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3331466_3332237_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3332993_3334229_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3335528_3335786_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3336225_3337209_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3337524_3338493_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407489.1|3338629_3339949_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408981.1|3340098_3341061_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3341310_3341469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3341500_3341680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3342044_3343010_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3344217_3345195_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3346003_3346198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3347591_3347954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3347937_3348507_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3348544_3349798_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3350003_3350381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3352309_3353545_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3354382_3355417_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 25
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	3497583	3625682	4954304	tRNA,protease,integrase,transposase	Ralstonia_phage(14.29%)	102	3598991:3599050	3618620:3619431
WP_094187736.1|3497583_3498347_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|3499179_3499425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|3499370_3501737_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3501733_3502408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3502617_3503556_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3503678_3505028_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3505024_3505912_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3506229_3507036_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3507481_3508699_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_069959939.1|3508804_3509773_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	23.7	5.4e-09
WP_011259764.1|3510115_3510784_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3510780_3511554_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_103057773.1|3512127_3514194_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3514760_3515786_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3515870_3516944_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3516936_3518040_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3518050_3518977_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_069959940.1|3519057_3519708_+	SCO family protein	NA	NA	NA	NA	NA
WP_069959941.1|3519704_3520553_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_069959942.1|3521103_3522687_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103073413.1|3522873_3523329_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	5.4e-12
WP_011409074.1|3523397_3523865_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_103057205.1|3524109_3525327_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3525287_3525575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960098.1|3525685_3526192_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|3526313_3527714_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|3527976_3528552_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3528548_3528983_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3529010_3529178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3529842_3530028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3530062_3530632_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3530724_3531576_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3532963_3534979_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3535249_3535948_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3535988_3536396_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3536833_3537796_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3539079_3540330_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3540337_3541582_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3541809_3542289_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3542399_3542936_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3543045_3543795_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3544002_3544494_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_125168763.1|3544506_3544734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409088.1|3545607_3546927_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011259800.1|3547071_3548778_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011259801.1|3548811_3550116_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3550147_3550408_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011259803.1|3550409_3551285_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3553119_3553584_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3553635_3553824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959944.1|3553796_3554117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445571.1|3554113_3555481_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011259807.1|3555626_3556208_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3556464_3557910_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011409097.1|3558756_3562677_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011259814.1|3562810_3564310_-	ribonuclease G	NA	NA	NA	NA	NA
WP_011409098.1|3564309_3564882_-	Maf-like protein	NA	NA	NA	NA	NA
WP_011409099.1|3565020_3565755_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409100.1|3566226_3569340_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3570758_3571229_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_109181984.1|3571783_3572257_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3572314_3573430_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3573441_3573858_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027703805.1|3573914_3574814_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3574810_3575839_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3575861_3576497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259825.1|3577010_3579653_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3579725_3580337_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3580541_3581399_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3581654_3582104_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3582403_3583369_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181946.1|3583493_3584256_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3584866_3585160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3585633_3585867_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3585900_3586914_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3586881_3587073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3587163_3588483_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3588570_3589785_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3589930_3590458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182722.1|3590454_3591420_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3591660_3592423_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3592725_3594858_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258351.1|3595408_3596377_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.9e-99
WP_011258803.1|3596537_3597506_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_082323400.1|3598581_3598995_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3598991:3599050	attL	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGA	NA	NA	NA	NA
WP_094187715.1|3598991_3599755_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3600626_3601424_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3601457_3601850_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3601940_3602333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3604671_3605091_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3606807_3608592_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3608782_3608983_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3609518_3610313_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3610614_3611373_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3611448_3613311_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3613368_3613710_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3613969_3614245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3617292_3618006_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|3618066_3618489_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3618620_3619384_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3622457_3623369_-	RNA methyltransferase	NA	NA	NA	NA	NA
3618620:3619431	attR	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGACATCCAGCTTCTCGAAGCGCGTGAAAATCCGTCGGTAGCCCTTCAAGCGACGGAACAGCCTCTCCACTTCGTTGCGCCGCTTGTACATTTCCTTGTCGTACTCCCAAGGATCGACCCGATTGGACTTGGGTGGAACCACCGGCACGAAGCCAAGATCGAGCGCCAACTGGCGGGTTTCATTGCCTTCGTAAGCGCGATCCATCAGCAGATGAACCGGCCGCTCCACTGGCCCCAGGTGTTCAAGCAACGCGCGGCCTGCGGGTGCGTCATGTGCGTTGCCAGGCGTCAATCCGAACGTGATGGCTGTTCGAGCATCTGCGGCAACCATATGAATTTTGGTGTTCCATCCGCCGCGCGATTTCCCGATGGATTGTGGGCCGTTTTTTTTAATGCGCCAGTGCCATCCGGATGCACCTTGATGCTGGTGGAGTCCAGCGAGACCGCTTCGATTTTGATGCGCACGATCTGGCAGGTCTGCAATTGGGCGAACATCCGGTCCAGCACACCGGACTTGGCCCAACGGTTAATGCGCGTGTACACCGTATGCCAGTTGCCAAAGCGCTCGGGCAGACCGCGCCATTTGCAGCCATGCTCTGCGACGTAAAGAAGGGCGTTGACTACCTGCAGGTTGGTCATGCTGACATTGCCGCGTTGCAAAGGTAGGCAATGCTCGATGAGTGCAAATTGTGCTGGCGTGATCTCCATGCCCAATAGTTTAATCGCTCGAGACATTAATGTTAACAGGCCCTAGC	NA	NA	NA	NA
WP_109182013.1|3624716_3625682_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	3663795	3746248	4954304	plate,transposase	Ralstonia_phage(14.29%)	51	NA	NA
WP_069960302.1|3663795_3664797_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011259891.1|3665823_3667929_+	catalase	NA	A0A2K9L572	Tupanvirus	48.1	5.1e-137
WP_027703311.1|3668754_3669993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960247.1|3670220_3672362_-	outer protein P	NA	NA	NA	NA	NA
WP_011407175.1|3673124_3674093_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3675113_3676148_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3676531_3677257_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3677388_3677850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3681296_3683417_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3683683_3684529_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3685520_3686489_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3686813_3688784_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3689212_3690610_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3690722_3691541_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011409162.1|3691851_3695049_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
WP_011259908.1|3695284_3696703_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_082348427.1|3696712_3697315_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259910.1|3697364_3697970_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3698119_3698341_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3698350_3698776_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_011409167.1|3700290_3701070_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3701284_3701914_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3701974_3702730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757351.1|3703085_3703835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960248.1|3704242_3705817_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_039440923.1|3706065_3706332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959954.1|3706609_3709789_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	4.6e-73
WP_069959955.1|3709788_3710463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959956.1|3710462_3711209_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075242182.1|3711205_3712717_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_044756558.1|3712709_3713144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960304.1|3713154_3714684_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.1	1.3e-44
WP_011409181.1|3714986_3715979_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|3716031_3716340_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069960249.1|3716920_3720394_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_041182233.1|3720533_3721532_+	Abi family protein	NA	NA	NA	NA	NA
WP_069960250.1|3721578_3723123_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	1.5e-13
WP_082325609.1|3723112_3724393_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_069960252.1|3724740_3725004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325594.1|3725726_3726482_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069960253.1|3726775_3727798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325595.1|3727807_3729751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960254.1|3729662_3730688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959964.1|3732545_3733562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960255.1|3733570_3736438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052658684.1|3736456_3737362_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069959966.1|3737303_3740066_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	2.5e-43
WP_011259938.1|3740158_3740512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3740542_3743272_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3743357_3744449_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3744412_3746248_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 27
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	3834817	3845644	4954304	transposase	Burkholderia_virus(28.57%)	8	NA	NA
WP_027703307.1|3834817_3835621_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.3	4.5e-25
WP_027703308.1|3836051_3836234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960107.1|3836701_3839656_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	9.0e-257
WP_011260010.1|3839985_3840435_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_011409250.1|3840431_3841127_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
WP_011409251.1|3841134_3842205_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_011409252.1|3842201_3843287_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_069960108.1|3844687_3845644_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
>prophage 28
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	4150449	4267451	4954304	protease,transposase	Ralstonia_phage(15.79%)	76	NA	NA
WP_155296496.1|4150449_4152057_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4152218_4152482_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4152486_4153146_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4153332_4154697_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4154912_4155608_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4156554_4157178_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409414.1|4157379_4158120_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4158213_4158864_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4158955_4159771_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4159820_4160558_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4162486_4163476_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4163598_4166172_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4166364_4167127_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4167200_4168169_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409421.1|4168901_4169168_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4170099_4170898_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4172544_4173777_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_069960263.1|4173816_4174779_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4174954_4175911_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4176122_4177091_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4177426_4178189_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4183026_4183257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959761.1|4183418_4184654_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011409428.1|4185200_4187243_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4187244_4189143_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4189144_4190398_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_069959998.1|4190394_4191000_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4191418_4192573_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4192575_4193604_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4193600_4194677_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4194717_4195995_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_044756432.1|4196039_4196807_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4197021_4198188_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4200743_4203641_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_069960264.1|4203791_4206482_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260311.1|4208561_4209746_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4209813_4210551_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4210719_4211235_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4211326_4212829_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4212832_4213273_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4213269_4215081_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|4215366_4215729_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4215888_4216941_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4217280_4218222_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4218242_4219580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4219751_4220132_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4220256_4221018_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4223266_4224670_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4224792_4225848_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4226020_4226875_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4227166_4229350_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_044756429.1|4229749_4230763_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_027703467.1|4230777_4231476_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4231463_4231742_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4232807_4234013_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4234513_4235929_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4235925_4237065_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_069960265.1|4239454_4240411_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.4e-41
WP_143698369.1|4240418_4241177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239457.1|4241182_4242907_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	24.3	2.6e-22
WP_082325596.1|4242903_4245681_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011260340.1|4246442_4247561_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_011260341.1|4247557_4249618_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011409462.1|4249621_4250107_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_069960266.1|4250103_4251498_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012444096.1|4251670_4252717_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_011260344.1|4252993_4253926_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_069960002.1|4255119_4255575_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_069960003.1|4255571_4256072_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260353.1|4257322_4258399_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011409470.1|4260137_4260899_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011409471.1|4261071_4261962_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011409472.1|4262083_4264096_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409473.1|4264267_4264987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182583.1|4265295_4265910_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260359.1|4266083_4267451_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
>prophage 29
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	4305503	4437115	4954304	tRNA,transposase	Ralstonia_phage(30.0%)	105	NA	NA
WP_094187715.1|4305503_4306267_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4307314_4308100_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4308353_4310027_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4310570_4311017_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4311347_4311632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4312226_4313138_-	magnesium transporter	NA	NA	NA	NA	NA
WP_027703842.1|4313383_4314379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757313.1|4314472_4315849_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_069960010.1|4317015_4318716_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_012444044.1|4319124_4320897_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_094187849.1|4321172_4322057_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044757311.1|4322245_4323124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493954.1|4323323_4323719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4325163_4326255_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011409507.1|4328157_4330482_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069960011.1|4330677_4332624_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4332998_4333190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4333579_4335163_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4335510_4336107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960267.1|4337455_4338304_-	threonine aldolase	NA	NA	NA	NA	NA
WP_011409514.1|4338338_4339814_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4340432_4341362_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4341596_4342088_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4342084_4342756_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4343150_4343480_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_044757306.1|4345087_4345765_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.3	8.8e-75
WP_011409520.1|4348282_4348768_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4349306_4352135_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4352134_4352509_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069960013.1|4352505_4354050_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_044756383.1|4354046_4354553_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4354549_4354834_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4354830_4355184_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_094187804.1|4355735_4356498_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4356969_4357938_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409528.1|4358369_4359695_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011409529.1|4360059_4361130_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_069960268.1|4361293_4361788_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4362144_4362735_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_044756377.1|4362746_4364255_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.8	1.3e-62
WP_011260428.1|4364697_4365591_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075242274.1|4366959_4367625_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_115801908.1|4368257_4369223_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4369755_4370136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4370296_4371060_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103073472.1|4371154_4372060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260437.1|4372128_4373424_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_069960017.1|4373539_4374064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4374489_4375755_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4375751_4376729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4376832_4377636_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4377811_4378621_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4378628_4379427_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187851.1|4379469_4380117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4380211_4380787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118886921.1|4380998_4382318_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4382467_4383436_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260446.1|4383561_4384314_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4384351_4384792_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4384998_4385340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4385565_4385943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4386153_4386351_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_069960019.1|4386657_4387404_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260452.1|4387496_4388303_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4388523_4389936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4389932_4391030_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4391184_4391983_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4392036_4392835_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4393054_4394017_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4394464_4395228_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4395509_4396286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4396282_4397599_+	amino acid permease	NA	NA	NA	NA	NA
WP_069960021.1|4398115_4399351_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4399944_4400226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960022.1|4400786_4401224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4401226_4402195_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296584.1|4402271_4402421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409559.1|4402555_4403734_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4404729_4405692_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4408025_4410197_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4410424_4410781_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4410859_4411924_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_002808376.1|4412204_4412420_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069960024.1|4412727_4413174_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	4.7e-24
WP_143700951.1|4413514_4413886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960025.1|4414651_4415614_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4415703_4417452_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_151420490.1|4417695_4419015_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155296490.1|4419085_4419250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4419249_4419516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4419740_4420787_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_069960027.1|4420970_4422551_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4422939_4423836_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4423838_4425002_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4425012_4425588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4425615_4426335_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4426395_4426614_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4426706_4427582_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_024743269.1|4427620_4428217_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4428213_4428387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4428367_4429972_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4430010_4430964_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011409574.1|4430980_4431457_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4431733_4434934_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_155297142.1|4436149_4437115_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	4449328	4523792	4954304	tRNA,integrase,transposase	Leptospira_phage(16.67%)	53	4507935:4507954	4521994:4522013
WP_094187806.1|4449328_4450430_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4451033_4453265_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_069960113.1|4453454_4455167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960029.1|4455315_4456692_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_115801910.1|4458899_4459698_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296585.1|4460883_4461180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240159.1|4461798_4462029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4462286_4463255_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069960033.1|4463421_4464393_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4464585_4465770_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4466237_4467053_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_069960034.1|4467811_4469128_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4469387_4470632_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4470724_4473973_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4474106_4477247_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4477536_4478904_-	VOC family protein	NA	NA	NA	NA	NA
WP_012443929.1|4478913_4479123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182121.1|4479648_4480614_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4482460_4482931_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4482959_4483382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4483457_4483892_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4484001_4484517_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4484532_4485558_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4485880_4486477_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_069960036.1|4486834_4488562_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4488611_4490054_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4490038_4491385_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4491575_4492325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4492426_4493038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4493142_4494366_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4494707_4495184_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4495210_4495672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4496057_4496378_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4496479_4497496_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4497567_4498731_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4498727_4500359_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_042465275.1|4500360_4502862_+	helicase SNF2	NA	NA	NA	NA	NA
WP_011260544.1|4502858_4503761_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4503982_4504366_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4504684_4506355_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4506583_4507594_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4507658_4507817_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
4507935:4507954	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260549.1|4508051_4509428_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4509438_4509972_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4510400_4511660_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4511798_4513106_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4515190_4516225_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4516575_4517121_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4517146_4517413_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4517587_4519426_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4519656_4520532_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_103057293.1|4522354_4522618_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4521994:4522013	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_041182307.1|4522811_4523792_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	5.3e-97
>prophage 31
NZ_CP013677	Xanthomonas oryzae pv. oryzae strain PXO524, complete genome	4954304	4645124	4787496	4954304	tRNA,tail,transposase	Arthrobacter_phage(20.0%)	92	NA	NA
WP_155297143.1|4645124_4646090_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4646190_4646616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4646658_4647421_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4647483_4648515_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4649875_4651132_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4651128_4652019_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4652015_4652411_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4652430_4653009_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_143698279.1|4652894_4653758_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_155296491.1|4653754_4655074_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4659858_4661943_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4662042_4664070_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4664312_4665923_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4665933_4667097_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4667225_4667846_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4668176_4668365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4668407_4668743_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4670367_4670679_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4671797_4672316_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_012443806.1|4672587_4674306_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4674396_4674783_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4674844_4676170_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_050580196.1|4676284_4677598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4677696_4678422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4678638_4679301_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4679379_4680474_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069960280.1|4681978_4684738_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	4.6e-146
WP_069960281.1|4684990_4686580_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011260687.1|4686579_4688817_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_059317416.1|4689106_4690015_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260689.1|4690104_4691919_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4692312_4701138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801913.1|4701236_4702034_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4702578_4703331_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4703390_4704290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4704441_4705197_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_044756277.1|4705193_4705835_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4705850_4706078_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4706150_4707053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4707207_4708173_+	ferrochelatase	NA	NA	NA	NA	NA
WP_011409719.1|4709836_4710622_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260701.1|4711248_4712154_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_012443789.1|4712217_4713135_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011259480.1|4713738_4715076_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4715301_4716369_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012443784.1|4716544_4718740_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_041182560.1|4718736_4720701_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_012443782.1|4720712_4721972_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4721971_4723672_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_012443780.1|4723674_4726389_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4726611_4728084_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_012443777.1|4729061_4730117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960282.1|4730343_4731762_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_069960283.1|4731802_4732780_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_113014009.1|4734196_4735678_-	MFS transporter	NA	NA	NA	NA	NA
WP_113124206.1|4736019_4738893_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703497.1|4738991_4740479_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4740510_4741545_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_094187716.1|4741961_4742759_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|4743635_4743773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|4744065_4745022_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187710.1|4745749_4746512_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4746529_4747630_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4747695_4748817_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011260726.1|4748826_4749921_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4749995_4750676_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4750708_4751507_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4751635_4752955_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4753057_4754014_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4755480_4755939_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4756040_4756469_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4756715_4757579_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4760755_4761022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4761183_4761432_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4761640_4762399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4762395_4763091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325599.1|4763189_4763465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325600.1|4763382_4764000_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011409747.1|4764002_4764437_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4764552_4764798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4765133_4765466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260744.1|4765714_4765813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4765915_4767310_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4768238_4768529_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_012443754.1|4768546_4768828_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_069960050.1|4768922_4771175_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.9	1.8e-10
WP_044756262.1|4771362_4775436_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_044756261.1|4775432_4778846_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_125168771.1|4778893_4779184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4785759_4786305_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4786373_4786901_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4786959_4787496_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
