The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	7736	50019	5033346	transposase,protease	Ralstonia_phage(33.33%)	38	NA	NA
WP_011407164.1|7736_8573_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044756151.1|8759_9566_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9842_11036_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044756154.1|11189_11858_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11942_12704_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12750_13173_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13176_13590_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13885_14653_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14663_14933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|15007_16468_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17114_18125_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18396_19599_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19740_21879_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22089_22383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22414_22912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23158_24139_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24186_25353_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25499_26066_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011257028.1|27540_28758_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29385_30408_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30988_32242_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094187708.1|32315_33113_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080493544.1|33100_34078_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443571.1|34959_35622_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_044756160.1|35775_36570_-	peptidase	NA	NA	NA	NA	NA
WP_027704023.1|36737_37211_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|39541_40498_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756163.1|40545_41457_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257041.1|41943_42342_-	host attachment protein	NA	NA	NA	NA	NA
WP_044756164.1|42433_43126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|43295_43766_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011407233.1|45232_45544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756166.1|45798_46746_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	4.3e-43
WP_044756167.1|46886_47945_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|48083_48365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|48405_48678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|48745_48955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445831.1|49038_50019_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
>prophage 2
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	85751	142150	5033346	transposase	Acidithiobacillus_phage(37.5%)	38	NA	NA
WP_044749647.1|85751_87128_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182539.1|87293_88847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|91060_91402_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_041182843.1|91586_94145_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|94163_94424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187710.1|94483_95246_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|95253_96978_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_011257102.1|97218_98160_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|98352_99717_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|99713_101342_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_027703733.1|101815_103399_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044756187.1|103395_105630_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|105632_107390_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|107446_109336_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_027703731.1|109332_111942_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|111964_112150_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|112264_114427_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|114443_115076_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|115239_115737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749647.1|116000_117377_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_011407197.1|117396_118443_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_041182545.1|119838_120795_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_125168734.1|120847_121126_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_115862254.1|121122_122088_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_148648650.1|123176_125579_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_080256644.1|125694_126153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|126152_126485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|126501_126762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|128085_129495_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011407187.1|129843_130275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|130549_130885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|131324_132614_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443641.1|133232_134213_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|134678_135002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|135561_136527_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756190.1|138198_139575_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_155296420.1|140041_140254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756191.1|141193_142150_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	6.2e-42
>prophage 3
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	176847	322405	5033346	tail,tRNA,transposase	Arthrobacter_phage(13.64%)	99	NA	NA
WP_115862255.1|176847_177813_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187711.1|182212_183280_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257175.1|183414_183543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181912.1|183485_184013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|184835_187019_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|187030_190381_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|190377_193494_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|195421_196456_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_094187821.1|199153_199333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494036.1|199335_199662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494035.1|199677_199845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756212.1|199927_201403_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	1.4e-101
WP_012443690.1|203011_204532_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|204548_204827_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|205016_205355_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|205967_207953_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_041182297.1|208584_209547_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|209952_210765_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|210957_211569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|211985_212843_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|213080_214967_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_044756215.1|217298_220022_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	6.3e-71
WP_044757283.1|220089_222243_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.6e-27
WP_044756216.1|222239_223931_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_012443704.1|224466_226371_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|226631_226811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|226944_227412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|227569_228529_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|228513_229131_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|229173_229593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443706.1|229845_230751_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|230999_231884_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|231947_232730_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|232774_233536_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|233699_234029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|234347_235439_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|235507_237106_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|237270_238515_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_044756226.1|238966_239596_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	2.6e-52
WP_011257211.1|239802_241779_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|243166_243832_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_044756232.1|244118_245129_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|245125_245857_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_044756234.1|246210_247740_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.3e-46
WP_011407300.1|247849_250882_-	membrane protein	NA	NA	NA	NA	NA
WP_044756235.1|251180_254219_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|254383_255436_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239519.1|255604_255850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|255848_256814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756236.1|256813_259477_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_044756238.1|259673_260654_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_011257222.1|261294_261513_-	YdcH family protein	NA	NA	NA	NA	NA
WP_082322966.1|262958_264143_-|transposase	IS256-like element IS1113 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_082322873.1|264193_264871_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756239.1|264867_265410_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756241.1|265406_266225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143690736.1|266221_266446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|266510_267467_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_044756245.1|267730_267910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296421.1|267906_268104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|268296_269253_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011409779.1|271352_272390_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409777.1|274083_274929_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|275088_276294_+	aminotransferase	NA	NA	NA	NA	NA
WP_011409775.1|276346_276679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409774.1|276727_277465_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_027704185.1|277461_278934_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044756247.1|279220_280402_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|280473_281757_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_012443732.1|281753_282740_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|282784_284062_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|284058_284679_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|284821_288529_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|288723_289086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|289182_289359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260776.1|289620_290538_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|290890_291523_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_027704183.1|291538_292015_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|292018_292591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260772.1|292587_294603_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|294894_295323_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|295442_296246_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|296305_297295_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756250.1|297708_299781_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|299975_300587_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|301740_302547_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|302683_303481_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|303702_305112_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|305389_305728_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_094187712.1|305717_307193_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|307463_308519_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|308511_309939_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_011409759.1|310560_311040_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	6.1e-14
WP_027704180.1|311110_311743_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_115862256.1|312025_312991_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|313078_313615_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|313673_314201_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|314269_314815_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_044756255.1|321169_322405_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	347446	413824	5033346	tRNA,transposase	Staphylococcus_prophage(16.67%)	42	NA	NA
WP_041182856.1|347446_348403_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
WP_109182069.1|348505_349825_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187713.1|349953_350751_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|350784_351465_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_094187714.1|351539_352634_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|352643_353765_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_113090107.1|353830_354820_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|354948_355712_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|356631_356769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187716.1|357644_358443_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|358859_359894_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409728.1|359925_361413_-	MFS transporter	NA	NA	NA	NA	NA
WP_094187822.1|361511_364385_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187717.1|364726_366208_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756273.1|367624_368602_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_044756275.1|368642_370061_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|370287_371343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|372320_373793_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260708.1|374015_376730_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|376732_378433_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|378432_379692_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_041182560.1|379703_381668_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409722.1|381664_383860_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|384035_385103_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011259480.1|385328_386666_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012443789.1|387269_388187_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011260701.1|388250_389156_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|389782_390568_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|390838_391297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240508.1|391377_392133_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|392230_393196_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|393350_394253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|394325_394553_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_044756277.1|394568_395210_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|395206_395962_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|396113_397013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|397072_397825_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_094187718.1|398368_399167_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756280.1|399307_408091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|408484_410299_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012443796.1|410388_411297_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260687.1|411586_413824_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	576847	693166	5033346	integrase,tRNA,transposase	Ralstonia_phage(17.65%)	96	554979:555000	589709:589730
554979:555000	attL	GGGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_011409614.1|576847_577990_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_103057293.1|578021_578285_+	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
WP_044756339.1|580107_580983_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.2	1.2e-55
WP_044756340.1|581213_583052_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|583226_583493_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|583518_584064_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|584535_585843_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409609.1|585981_587241_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|587482_588859_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_027703952.1|589188_589722_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756341.1|589732_591109_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	8.6e-77
589709:589730	attR	ATAGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260548.1|591343_591502_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012443914.1|591566_592577_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
WP_011260546.1|592805_594476_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|594794_595178_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260544.1|595399_596302_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756343.1|596298_598800_-	helicase SNF2	NA	NA	NA	NA	NA
WP_011260542.1|598801_600433_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011260541.1|600429_601593_-	Fic family protein	NA	NA	NA	NA	NA
WP_011260540.1|601664_602681_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|602782_603103_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_044756345.1|603488_603950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756347.1|603976_604453_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|604794_606018_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|606122_606734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409603.1|606835_607585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756348.1|607775_609122_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756350.1|609106_610549_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_044756351.1|610598_612326_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_044756353.1|612684_613281_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_044756355.1|613603_614629_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_044756356.1|614644_615160_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|615269_615704_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_044756357.1|615779_616202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|616230_616701_-	thioesterase	NA	NA	NA	NA	NA
WP_075240018.1|618653_618863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703859.1|618872_620240_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|620529_623670_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011260521.1|623803_627052_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_012443931.1|627144_628389_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409596.1|628648_629965_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|630723_631539_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_082322968.1|632006_633191_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_044756360.1|633332_634568_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|634636_635026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|635414_636371_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181928.1|636406_637372_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|638610_639333_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_027703875.1|639343_640780_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012443983.1|640779_642048_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|642137_644279_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407520.1|644363_645029_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|645025_645700_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027703874.1|645696_648354_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_011257533.1|648364_649114_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|649440_649653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|650094_650316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239431.1|650325_650640_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_115862259.1|651100_652420_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260472.1|652671_654420_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|654509_655472_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_094187724.1|656234_656997_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409565.1|657053_657425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409564.1|657765_658212_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_002808376.1|658519_658735_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011260469.1|659014_660079_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_011409563.1|660157_660514_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|660741_662913_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_109181928.1|663575_664541_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|665056_666292_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044756364.1|666707_667670_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182297.1|668449_669412_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182296.1|670407_671586_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_041182719.1|671752_672709_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011260461.1|672818_673253_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|673813_674095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187784.1|674298_675061_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704068.1|675120_676437_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|676433_677210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182294.1|677886_678849_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|679068_679866_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703925.1|680021_681119_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_012444005.1|681115_682528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756368.1|682751_683558_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011258802.1|683620_684589_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444006.1|684810_685557_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|685863_686061_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|686271_686649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|686874_687216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|687328_688285_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_044756370.1|688480_688921_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011260446.1|688958_689711_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258188.1|689836_690805_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409543.1|691008_691584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187851.1|691678_692326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862261.1|692368_693166_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	762720	937399	5033346	protease,transposase	Acidithiobacillus_phage(10.71%)	127	NA	NA
WP_094187782.1|762720_763483_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409494.1|763726_764731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756399.1|764769_765699_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_044756400.1|766246_769135_-	insulinase family protein	NA	NA	NA	NA	NA
WP_044756401.1|769389_772014_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_075240061.1|772539_772767_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_012444068.1|772766_773087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960358.1|773248_774727_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.6e-47
WP_011409489.1|774934_776422_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_094187781.1|777696_778494_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|778674_780324_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_075240244.1|780251_780512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|780637_781401_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033013308.1|782127_784065_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_044756406.1|784216_784885_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260375.1|784889_785942_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011409485.1|785972_786710_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044756408.1|786740_787655_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011260372.1|788205_789006_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011260371.1|789564_790530_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260370.1|790638_791208_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011409482.1|791595_791907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|791974_794068_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_103073476.1|794141_794582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409479.1|794907_796092_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_069960323.1|796271_798407_+	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_044757316.1|798750_799149_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
WP_044756411.1|799206_799443_+	sugar transporter	NA	NA	NA	NA	NA
WP_069960324.1|799432_800287_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011260362.1|800274_800955_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_044757318.1|801160_802078_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	2.2e-12
WP_011260360.1|802593_803145_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011260359.1|803286_804654_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260358.1|804827_805451_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409473.1|805750_806470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444089.1|806641_808654_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409471.1|808775_809666_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011409470.1|809838_810600_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011260353.1|812344_813421_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027703680.1|814671_815172_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260350.1|815168_815624_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_094187721.1|816764_817563_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|817618_818587_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756415.1|818827_819760_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_012444096.1|820036_821083_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_044756417.1|821255_822602_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_044756419.1|822598_823084_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012444099.1|823087_825148_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011260340.1|825144_826263_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_012444101.1|827024_828011_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_082322882.1|828070_829555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756423.1|829551_830631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242513.1|831584_832070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444102.1|832066_833146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862310.1|833142_835278_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011409552.1|835157_836120_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_069960325.1|836826_838203_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_143690657.1|838374_838671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260336.1|839896_841036_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011260335.1|841032_842448_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_044756427.1|842948_844154_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.6	6.0e-66
WP_011409453.1|845220_845499_+	YbeD family protein	NA	NA	NA	NA	NA
WP_027703467.1|845486_846185_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_044756429.1|846199_847213_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260328.1|847612_849796_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_094187848.1|850087_850942_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260326.1|851114_852170_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_011409450.1|852292_853696_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_012444115.1|855953_856715_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409446.1|856839_857220_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027703464.1|857391_858729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260319.1|858749_859691_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_011260318.1|860029_861082_-	oxidoreductase	NA	NA	NA	NA	NA
WP_011409444.1|861241_861604_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_012444117.1|861889_863701_+	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260315.1|863697_864138_+	response regulator	NA	NA	NA	NA	NA
WP_011260314.1|864141_865644_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260313.1|865735_866251_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260312.1|866419_867157_-	pteridine reductase	NA	NA	NA	NA	NA
WP_011260311.1|867224_868409_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044756431.1|869844_871080_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260307.1|871811_874502_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_076659517.1|874652_875186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076659519.1|875270_877550_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	28.6	5.5e-20
WP_069960326.1|877546_879943_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011409433.1|880100_881267_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_044756432.1|881481_882249_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703724.1|882293_883571_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_012444129.1|883611_884679_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260300.1|884685_885714_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_044756434.1|885716_886871_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_044756435.1|887290_887896_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011260297.1|887892_889146_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011409429.1|889147_891046_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011409428.1|891047_893090_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_012444134.1|893715_893946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182013.1|894407_895373_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|899381_900144_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|900977_902210_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_144408318.1|902774_903119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187777.1|903856_904654_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187776.1|904708_905461_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044749647.1|905471_906848_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_012444143.1|907957_908224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041182545.1|908867_909824_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756446.1|910036_912610_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011409419.1|912732_913722_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011409416.1|915650_916388_-	endonuclease	NA	NA	NA	NA	NA
WP_011260284.1|916437_917253_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409415.1|917344_917995_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_094187847.1|918088_918829_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024712536.1|919030_919654_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_012444150.1|919748_920444_-	VIT family protein	NA	NA	NA	NA	NA
WP_012444151.1|920659_922024_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_075239687.1|922210_922849_-	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	1.9e-10
WP_075239943.1|922853_923117_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155296429.1|923278_924886_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409407.1|925801_926287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409406.1|926688_927255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712625.1|927254_928181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444157.1|928213_929713_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	3.3e-13
WP_042465749.1|929709_930429_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260272.1|930567_931668_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	27.6	2.8e-14
WP_011260271.1|932789_933065_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011409400.1|933129_934239_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	8.6e-35
WP_011260269.1|934940_935771_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_044749647.1|936022_937399_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 7
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1035428	1095381	5033346	tRNA,transposase	Tupanvirus(16.67%)	57	NA	NA
WP_094187715.1|1035428_1036191_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260189.1|1036226_1036874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187728.1|1037028_1037827_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260188.1|1038027_1038381_-	DMT family protein	NA	NA	NA	NA	NA
WP_044756474.1|1039345_1040185_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.6e-28
WP_094187844.1|1041276_1042167_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_044756475.1|1042507_1044991_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_044756477.1|1044987_1045587_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-26
WP_012444227.1|1045711_1046365_+	arylesterase	NA	NA	NA	NA	NA
WP_005990242.1|1046423_1047170_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	2.0e-27
WP_011409346.1|1047312_1048584_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	1.3e-10
WP_044756480.1|1049157_1049859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409344.1|1050041_1050422_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_011409343.1|1050517_1051156_+	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	25.4	2.5e-07
WP_044756482.1|1051493_1052384_+	dehydrogenase	NA	NA	NA	NA	NA
WP_011260174.1|1052383_1052875_+	membrane protein	NA	NA	NA	NA	NA
WP_011260173.1|1052929_1053820_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011260172.1|1053816_1054611_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.8	3.0e-106
WP_027704106.1|1054677_1054965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260171.1|1054961_1055456_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.9	3.0e-24
WP_011260170.1|1055509_1056466_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	S4TNS0	Salmonella_phage	25.3	1.3e-07
WP_011260169.1|1056494_1056878_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_011260168.1|1056914_1057703_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_094187843.1|1057959_1058928_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011409338.1|1058951_1060343_-	chaperone SurA	NA	NA	NA	NA	NA
WP_011409337.1|1060339_1062781_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_011409336.1|1062908_1063817_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	30.8	3.4e-37
WP_011260163.1|1063854_1064412_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011409335.1|1064415_1064994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409334.1|1065292_1066501_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_011409333.1|1066497_1067679_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_011409332.1|1067806_1068619_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_109182116.1|1069255_1070221_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409329.1|1071304_1072201_+	gallate dioxygenase	NA	NA	NA	NA	NA
WP_011409327.1|1072637_1073639_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756484.1|1073823_1075302_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.4e-40
WP_011409325.1|1075504_1076974_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409324.1|1077057_1077885_-	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_011260149.1|1077930_1078404_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409323.1|1078531_1078939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703838.1|1079138_1079861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409321.1|1079943_1080849_-	gluconolactonase	NA	NA	NA	NA	NA
WP_012444247.1|1081043_1082153_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011409319.1|1082474_1083518_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_011409318.1|1083554_1084115_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011409317.1|1084114_1084525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057260.1|1084882_1085584_-	DMT family transporter	NA	NA	NA	NA	NA
WP_042465204.1|1085718_1085919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070807999.1|1087037_1087247_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|1087451_1088214_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260138.1|1089304_1091044_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_012444256.1|1091448_1092090_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444257.1|1092091_1092328_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011409313.1|1092442_1092907_-	response regulator	NA	NA	NA	NA	NA
WP_011260134.1|1092903_1093734_-	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_094187708.1|1093730_1094529_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|1094582_1095381_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1188374	1266022	5033346	transposase	uncultured_Caudovirales_phage(17.65%)	59	NA	NA
WP_044757331.1|1188374_1189433_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	2.7e-70
WP_082322974.1|1190250_1191207_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	3.1e-41
WP_011409252.1|1192607_1193693_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_044756504.1|1193689_1194760_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	9.7e-60
WP_011260011.1|1194767_1195463_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_011260010.1|1195459_1195909_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_044757335.1|1196238_1199193_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.1	8.1e-258
WP_027703308.1|1199660_1199843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465718.1|1200273_1201077_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033013179.1|1201165_1202377_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756506.1|1202373_1204533_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.5	6.8e-36
WP_011260005.1|1205874_1206279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409243.1|1206360_1208379_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409242.1|1208490_1210161_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_011409241.1|1210157_1210922_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027703306.1|1211021_1212755_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011409239.1|1212973_1213690_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	1.4e-22
WP_027703305.1|1213682_1214975_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_027703304.1|1215126_1215618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003484370.1|1215686_1215944_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_044756509.1|1215946_1216756_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027703303.1|1216791_1217532_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011259995.1|1217536_1218133_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094187731.1|1218376_1219175_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259994.1|1219229_1220426_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010371538.1|1220425_1221067_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011259992.1|1221417_1222599_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_011259991.1|1222662_1223067_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259990.1|1223069_1223744_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011259989.1|1223807_1224605_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011259988.1|1224735_1224915_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_011259987.1|1224911_1225196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409230.1|1225812_1227015_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_094187775.1|1227214_1227757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011409229.1|1228031_1228772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259982.1|1228971_1229850_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	35.5	1.3e-06
WP_011409228.1|1229959_1230220_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756512.1|1230279_1231761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960331.1|1231776_1235514_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011259979.1|1235510_1236494_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_044756514.1|1236490_1237321_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011409224.1|1237373_1238447_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_059317517.1|1239432_1242372_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.7	7.5e-54
WP_044756517.1|1242358_1245424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756518.1|1245571_1246531_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075242163.1|1246598_1247165_+	DNA repair protein	NA	NA	NA	NA	NA
WP_059317432.1|1247221_1248178_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	33.7	8.2e-18
WP_044756522.1|1248363_1251027_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	3.0e-41
WP_011409221.1|1251026_1251923_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075240218.1|1251919_1252384_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011409218.1|1252407_1252887_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075239710.1|1252973_1254716_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259969.1|1254797_1255343_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|1257835_1258792_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011409215.1|1259505_1260468_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
WP_044756524.1|1260653_1263323_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	5.1e-41
WP_044756525.1|1263319_1264144_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756527.1|1264136_1264751_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_094187763.1|1265224_1266022_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1271029	1338815	5033346	plate,transposase	Liberibacter_phage(22.22%)	46	NA	NA
WP_094187774.1|1271029_1272132_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_041183127.1|1272222_1272786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756533.1|1272947_1275989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756534.1|1276013_1278551_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_044756536.1|1278561_1279350_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_044756538.1|1280215_1281295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322887.1|1281291_1282770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296430.1|1282829_1285562_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_033013632.1|1285668_1286457_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059317436.1|1287441_1288521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322887.1|1288517_1289996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322889.1|1290055_1292515_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_125168764.1|1292523_1293099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242365.1|1293073_1294051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756541.1|1294047_1296765_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_044756542.1|1296775_1297564_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011409207.1|1297563_1298898_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011409206.1|1299049_1299658_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012445672.1|1300044_1300533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259944.1|1300579_1301080_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011259943.1|1301083_1302580_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1302721_1303219_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259942.1|1303366_1303855_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014502420.1|1303857_1305693_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012445670.1|1305656_1306748_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259939.1|1306833_1309563_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259938.1|1309593_1309947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756543.1|1310039_1312802_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	8.1e-42
WP_052658684.1|1312743_1313649_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756547.1|1313667_1316535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756548.1|1316539_1317559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756549.1|1317852_1318608_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011259930.1|1319329_1319593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756551.1|1319599_1319908_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_094187842.1|1319941_1320796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756553.1|1321274_1322819_-	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	24.1	4.0e-14
WP_044756555.1|1322865_1323864_-	Abi family protein	NA	NA	NA	NA	NA
WP_044756556.1|1324003_1327477_-	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_044756557.1|1328057_1328366_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011409181.1|1328418_1329411_+	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_041182476.1|1329713_1331243_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_044756558.1|1331253_1331688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187841.1|1332103_1333255_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044756559.1|1333254_1336434_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.9	1.4e-74
WP_011409172.1|1336712_1336979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1337858_1338815_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 10
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1375804	1515038	5033346	protease,tRNA,transposase	Ralstonia_phage(25.0%)	103	NA	NA
WP_011258802.1|1375804_1376773_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|1376972_1378292_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082323169.1|1378383_1379364_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_069960333.1|1379501_1382357_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_011409146.1|1382353_1383712_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_027704219.1|1384045_1385221_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011259886.1|1385217_1385862_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409145.1|1386118_1387585_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_011259884.1|1388167_1389172_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.2	3.9e-79
WP_041182225.1|1389373_1389913_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.6	9.9e-29
WP_011259882.1|1390108_1390615_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_041182224.1|1390639_1390891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259881.1|1390914_1391874_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.0	3.8e-79
WP_075240596.1|1391890_1393096_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_044756573.1|1393263_1394247_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756574.1|1394257_1394539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445617.1|1395608_1396805_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_012445616.1|1397127_1397565_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_011259875.1|1397702_1399763_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409144.1|1399762_1401355_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_011259873.1|1401490_1402216_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_011409143.1|1402212_1403934_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011409142.1|1404042_1405890_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_011259870.1|1406070_1406979_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_011409141.1|1406978_1408955_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	5.6e-29
WP_011409140.1|1409389_1410460_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259867.1|1410456_1413582_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
WP_041182725.1|1413933_1416603_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.3	1.8e-240
WP_109182116.1|1417482_1418448_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|1419795_1420707_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_044756585.1|1422568_1422874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1423433_1424390_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_080494023.1|1424383_1426018_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012445603.1|1426428_1426851_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011259859.1|1426911_1427625_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_094187763.1|1428902_1429700_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259856.1|1431530_1431806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409127.1|1432065_1432407_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259854.1|1432464_1434327_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_011259853.1|1434402_1435161_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409125.1|1435462_1436257_-	thiazole synthase	NA	NA	NA	NA	NA
WP_011259851.1|1436792_1436993_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012445601.1|1437183_1438968_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_027704094.1|1443433_1443826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1443916_1444309_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_094187763.1|1444341_1445140_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1446011_1446774_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071162276.1|1446771_1447155_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011409560.1|1447158_1448121_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840192.1|1448230_1449196_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1449340_1450309_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011409116.1|1450859_1452992_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_094187771.1|1453293_1454057_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862263.1|1454181_1455147_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1455672_1456641_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407913.1|1456977_1458192_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_155296422.1|1458279_1459599_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259831.1|1459689_1459881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409111.1|1459848_1460862_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1460895_1461129_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_044756598.1|1461602_1461896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|1462505_1463269_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181988.1|1463393_1464359_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409108.1|1464658_1465108_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|1465363_1466221_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011259826.1|1466425_1467037_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011259825.1|1467109_1469752_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_044756603.1|1470265_1470901_+	lipoprotein	NA	NA	NA	NA	NA
WP_011259823.1|1470923_1471952_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409104.1|1471948_1472848_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1472904_1473321_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011259821.1|1473332_1474448_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259820.1|1474773_1474983_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_044756605.1|1475537_1476008_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445578.1|1477423_1480537_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187763.1|1480835_1481634_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1481918_1482887_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296423.1|1483099_1484419_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259816.1|1484497_1485232_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409098.1|1485370_1485943_+	Maf-like protein	NA	NA	NA	NA	NA
WP_011259814.1|1485942_1487442_+	ribonuclease G	NA	NA	NA	NA	NA
WP_044756607.1|1487589_1491510_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_027704199.1|1491515_1492268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259808.1|1492366_1493812_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_044756609.1|1494068_1494650_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012445571.1|1494795_1496163_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_069959944.1|1496159_1496480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445570.1|1496452_1496641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704198.1|1496692_1497157_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_044756613.1|1499003_1499879_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011259802.1|1499880_1500141_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_044756614.1|1500172_1501477_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_044756616.1|1501510_1503217_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409088.1|1503360_1504680_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011259797.1|1505793_1506285_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011259796.1|1506492_1507242_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_027704197.1|1507351_1507888_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259794.1|1507998_1508478_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011409085.1|1508705_1509950_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011409084.1|1509957_1511208_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756618.1|1512491_1513454_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409081.1|1513891_1514299_+	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_012445555.1|1514339_1515038_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1631718	1700706	5033346	transposase	Acinetobacter_phage(40.0%)	46	NA	NA
WP_041182468.1|1631718_1632801_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_153296739.1|1633059_1633215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743012.1|1635591_1636128_-	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_094187768.1|1637641_1638667_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|1638810_1639608_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756654.1|1639595_1640084_-	BrxE family protein	NA	NA	NA	NA	NA
WP_011259682.1|1640115_1640436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409027.1|1640770_1641370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259680.1|1641366_1642290_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_033013473.1|1642369_1642618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143681140.1|1642823_1643309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259679.1|1643305_1643548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259678.1|1643972_1644482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155296424.1|1646837_1647047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703322.1|1650676_1650955_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_011259671.1|1650978_1652052_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_027703321.1|1652530_1654147_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_011409015.1|1654351_1655068_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409014.1|1655225_1656164_+	hydroxyproline-2-epimerase	NA	NA	NA	NA	NA
WP_011259667.1|1656163_1657426_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259666.1|1657422_1657668_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011259665.1|1657639_1658974_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756657.1|1658970_1659879_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_044756659.1|1660089_1661706_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_044756660.1|1661702_1662902_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012445434.1|1663019_1664852_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044756662.1|1664848_1666714_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044757373.1|1666776_1668363_+	amino acid permease	NA	NA	NA	NA	NA
WP_044756663.1|1668352_1670692_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_027703320.1|1670688_1670976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756665.1|1671031_1671223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756667.1|1671189_1671429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144408320.1|1672104_1672410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409006.1|1672406_1672703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756673.1|1672909_1674481_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	37.6	2.3e-70
WP_044756675.1|1674944_1677302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187767.1|1677802_1680640_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	2.4e-49
WP_044756677.1|1680878_1685243_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_033013184.1|1685239_1686826_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_044756679.1|1687147_1689493_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011408999.1|1689989_1690421_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_115862311.1|1690405_1690999_+	TonB-dependent receptor plug domain-containing protein	NA	A0A0P0I887	Acinetobacter_phage	33.0	2.1e-11
WP_044756683.1|1694321_1696697_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_094187766.1|1696811_1697610_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296425.1|1698449_1699415_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182719.1|1699749_1700706_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
>prophage 12
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1708401	1770971	5033346	plate,transposase	Ralstonia_phage(37.5%)	49	NA	NA
WP_115862266.1|1708401_1709367_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|1709731_1709911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756692.1|1710350_1711313_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408980.1|1711565_1712549_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011408979.1|1712988_1713246_+	stress-induced protein	NA	NA	NA	NA	NA
WP_011257310.1|1714544_1715780_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757376.1|1716536_1717307_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_044756695.1|1717676_1718969_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011259625.1|1718952_1720215_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408975.1|1720226_1720658_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408974.1|1720716_1721082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408973.1|1721181_1721943_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012445389.1|1722164_1722812_+	response regulator	NA	NA	NA	NA	NA
WP_094187765.1|1722915_1723678_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756696.1|1724204_1727906_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_011259619.1|1728316_1729303_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_041182194.1|1729335_1731126_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011408968.1|1731474_1731735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408967.1|1731761_1731995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259617.1|1732010_1732433_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408966.1|1732429_1732786_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|1732874_1733474_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_041182192.1|1733487_1735311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756697.1|1735968_1738803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1738833_1739577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756990.1|1741481_1742438_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_044749647.1|1742893_1744270_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|1744364_1745321_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_133262016.1|1745384_1745585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756701.1|1745602_1747594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1747646_1748603_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756703.1|1748622_1749858_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1750006_1750975_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182069.1|1751174_1752494_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_024711387.1|1753810_1754317_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_044756705.1|1754309_1755824_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011259605.1|1755923_1756427_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259604.1|1756462_1757296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259603.1|1757283_1757787_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012444494.1|1757790_1759668_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069960336.1|1759631_1760642_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_044756710.1|1760674_1763380_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_027703476.1|1763568_1764066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|1764131_1764626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408952.1|1765013_1765472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|1765736_1767674_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408951.1|1767682_1768222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756713.1|1768218_1769637_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_044756715.1|1769633_1770971_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1880553	1892328	5033346	tRNA	Pseudomonas_phage(22.22%)	13	NA	NA
WP_011408886.1|1880553_1882230_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
WP_011408885.1|1882318_1882960_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408884.1|1883132_1884167_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_012444556.1|1884469_1884958_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_044756742.1|1885059_1887708_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_003481884.1|1887847_1888060_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_103057523.1|1888662_1889190_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_012444559.1|1889577_1889877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181974.1|1889899_1890127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756743.1|1890062_1890758_+	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_011259505.1|1890762_1891512_+	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011259504.1|1891755_1891986_+	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259503.1|1892028_1892328_+	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
>prophage 14
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	1917418	2076375	5033346	tRNA,transposase	uncultured_Caudovirales_phage(26.67%)	108	NA	NA
WP_044756746.1|1917418_1918393_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	6.0e-32
WP_069960338.1|1918461_1918827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259476.1|1919719_1920286_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_011259475.1|1920407_1921178_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	3.4e-14
WP_011408867.1|1921316_1922213_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	32.7	8.5e-33
WP_011259473.1|1922283_1922673_-	VOC family protein	NA	NA	NA	NA	NA
WP_011259472.1|1922669_1923467_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408865.1|1923581_1923830_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_011408864.1|1923826_1925686_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259469.1|1925687_1925942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408863.1|1926001_1926226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259467.1|1926253_1926562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259466.1|1926795_1927998_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011259465.1|1927994_1928714_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|1928766_1929529_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756747.1|1929939_1930656_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011259464.1|1930895_1932020_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_012444585.1|1932019_1932463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259463.1|1932471_1935714_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011408858.1|1935710_1936187_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259461.1|1936203_1937124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408857.1|1937120_1938860_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_109182069.1|1939406_1940726_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|1942389_1943346_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408855.1|1943640_1944018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959908.1|1944178_1944880_-|transposase	transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_041182178.1|1947686_1948634_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503214.1|1948887_1950012_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_011408850.1|1950216_1951734_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	3.8e-86
WP_011408849.1|1951875_1953012_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_011259451.1|1953376_1955554_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408848.1|1955565_1956435_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259449.1|1956611_1958294_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_044756750.1|1958943_1961712_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1961859_1962108_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1962104_1962515_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012444596.1|1962580_1965172_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259442.1|1965525_1966341_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011408846.1|1966996_1969240_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259440.1|1969348_1970425_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011259439.1|1970421_1971018_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011408845.1|1971014_1971881_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_094187759.1|1972134_1974525_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.8e-09
WP_094187834.1|1974603_1974948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408841.1|1976814_1977297_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259433.1|1977432_1978230_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_113255743.1|1978299_1978509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408839.1|1979187_1981449_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_044756753.1|1981842_1984104_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_044757389.1|1984697_1986773_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_069960361.1|1987456_1989568_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	4.6e-13
WP_069960339.1|1990296_1992543_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_115840174.1|1992782_1993748_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|1993872_1994635_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756756.1|1995060_1997403_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_011408833.1|1997416_1998178_-	transporter	NA	NA	NA	NA	NA
WP_103073514.1|1998493_1999180_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408830.1|2000862_2001117_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011408829.1|2001284_2003294_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2003327_2003693_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259421.1|2003689_2003998_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_042465006.1|2004098_2005121_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259419.1|2005117_2005900_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011408827.1|2005901_2006876_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259417.1|2006882_2007623_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_027703781.1|2007711_2008065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242238.1|2008061_2008577_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011408825.1|2008599_2008992_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_044756757.1|2009143_2009851_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_125168759.1|2009926_2010274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2010275_2012081_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2012335_2012788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187833.1|2013837_2016879_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168758.1|2017187_2017688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2018344_2019313_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011259411.1|2019812_2020448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182107.1|2020509_2020887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057251.1|2020828_2021137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259409.1|2021133_2021550_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011258802.1|2024168_2025137_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408800.1|2025803_2026940_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_011259402.1|2027258_2029001_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011259401.1|2029159_2030116_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_041182172.1|2030112_2032629_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011408798.1|2032789_2033785_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011257851.1|2034491_2035457_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444648.1|2036432_2039603_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012444649.1|2039615_2040920_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027703873.1|2040934_2041594_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756763.1|2041871_2046896_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_044756764.1|2047344_2048328_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	1.6e-96
WP_027703772.1|2048452_2049439_-	response regulator	NA	W8CYM9	Bacillus_phage	27.6	9.7e-06
WP_027703773.1|2049472_2053567_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_044756765.1|2053708_2055013_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_011408788.1|2055183_2056038_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408787.1|2056204_2059342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259384.1|2059402_2060755_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_041182645.1|2060809_2061142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960340.1|2061284_2063024_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011259382.1|2063030_2063876_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011259381.1|2063872_2066221_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_094187755.1|2066180_2066489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408784.1|2066794_2068075_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_012444665.1|2068382_2069627_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
WP_011408783.1|2069763_2071080_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259377.1|2071079_2072459_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408781.1|2073366_2074752_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_115801894.1|2075055_2076375_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	2092853	2137490	5033346	transposase,tRNA,protease	Geobacillus_virus(11.11%)	37	NA	NA
WP_044756769.1|2092853_2094308_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011259357.1|2096243_2097230_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011259356.1|2097759_2098404_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259355.1|2098403_2099663_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_012444683.1|2099670_2100414_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011259353.1|2100806_2101442_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259352.1|2101520_2101961_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011408764.1|2101993_2102320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408763.1|2102530_2102947_-	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_109181970.1|2107439_2108405_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2108985_2110170_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_012445118.1|2110573_2111542_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_041182719.1|2111943_2112900_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_080256628.1|2113160_2113349_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408759.1|2113833_2114112_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703932.1|2114099_2114390_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153296741.1|2114650_2114848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015463309.1|2114991_2115171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259346.1|2115393_2115528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011259345.1|2116034_2116436_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011408757.1|2116849_2117200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408756.1|2117528_2118620_-	ribonuclease D	NA	NA	NA	NA	NA
WP_041182165.1|2118891_2120727_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_094187754.1|2121043_2121790_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259340.1|2122007_2123270_+	virulence factor	NA	NA	NA	NA	NA
WP_011408753.1|2123565_2124903_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011408752.1|2125048_2126116_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011259337.1|2126140_2127628_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011259336.1|2127624_2128125_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011408751.1|2128177_2129911_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259334.1|2130048_2131926_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_041182163.1|2131925_2132873_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011408749.1|2132906_2133878_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011259331.1|2134051_2134627_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408747.1|2134786_2135527_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_044756773.1|2135614_2136514_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011259328.1|2136611_2137490_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 16
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	2169709	2240063	5033346	tRNA,transposase	Streptococcus_phage(18.18%)	44	NA	NA
WP_094187753.1|2169709_2170508_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2171495_2172464_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862269.1|2172600_2173920_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444728.1|2174143_2174632_+	general stress protein	NA	NA	NA	NA	NA
WP_011259294.1|2175003_2175267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187752.1|2176138_2177038_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_011259290.1|2176977_2178327_-	dihydroorotase	NA	NA	NA	NA	NA
WP_027703612.1|2178323_2178605_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075239108.1|2178695_2179724_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011259288.1|2179866_2180928_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_011259287.1|2180995_2182246_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408724.1|2182242_2182680_-	SufE family protein	NA	NA	NA	NA	NA
WP_011259285.1|2183177_2184608_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_027703614.1|2184778_2185273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259283.1|2185585_2186611_+	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2186682_2187924_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011408722.1|2188165_2188618_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259280.1|2188623_2189724_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_044756778.1|2189763_2191107_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_044756779.1|2191719_2192670_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408717.1|2192793_2194089_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_094187751.1|2194085_2194454_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011259275.1|2194453_2194714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756780.1|2194727_2195882_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.2	1.0e-46
WP_011408714.1|2196137_2197382_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_044756781.1|2197749_2199663_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_044756783.1|2199643_2200909_-	MFS transporter	NA	NA	NA	NA	NA
WP_011259269.1|2201129_2201240_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011259267.1|2201618_2201882_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044756785.1|2201930_2203031_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_075239845.1|2203182_2204919_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_011408708.1|2204915_2206601_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_011408707.1|2206769_2208068_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801893.1|2208074_2209040_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044749647.1|2209145_2210522_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_011408704.1|2212351_2212582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259261.1|2213086_2213548_-	cytochrome c	NA	NA	NA	NA	NA
WP_011259260.1|2213556_2213949_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_044756786.1|2218805_2221874_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.1	9.6e-60
WP_128415342.1|2222082_2222562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082322907.1|2225334_2230305_+	glutamate synthase	NA	NA	NA	NA	NA
WP_041182545.1|2231856_2232813_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_155296426.1|2238928_2239132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2239106_2240063_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 17
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	2320192	2366009	5033346	transposase,tRNA,protease	uncultured_Mediterranean_phage(11.11%)	33	NA	NA
WP_011408666.1|2320192_2321329_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011408665.1|2321325_2321784_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005914463.1|2322034_2322355_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408664.1|2322498_2324781_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_002813418.1|2325061_2325280_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_042465566.1|2325360_2326113_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011408662.1|2327540_2328662_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259181.1|2328719_2329688_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011259180.1|2329971_2332332_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259179.1|2332494_2334423_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259178.1|2334529_2335159_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259177.1|2335271_2339438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2339674_2341051_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259175.1|2341082_2341409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2341405_2341813_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011408659.1|2341844_2342195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259173.1|2342191_2343523_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011259172.1|2343843_2345049_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259171.1|2345206_2347579_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259170.1|2347603_2348236_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2348455_2348881_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259169.1|2348899_2350105_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011408658.1|2350115_2350904_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259167.1|2350900_2351761_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756799.1|2351831_2352470_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259165.1|2352466_2353687_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259164.1|2353697_2355095_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259163.1|2355409_2356630_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_044756800.1|2356826_2357885_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082322909.1|2358475_2358778_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115862270.1|2362152_2363472_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115862271.1|2363590_2365066_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.6e-76
WP_109181928.1|2365043_2366009_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	2465989	2533295	5033346	tRNA,transposase	Xanthomonas_phage(57.14%)	50	NA	NA
WP_011258918.1|2465989_2467048_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258919.1|2467099_2467666_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_094187745.1|2467662_2468892_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408474.1|2469009_2470275_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011408475.1|2470255_2470987_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_094187744.1|2471127_2472291_-	MFS transporter	NA	NA	NA	NA	NA
WP_082322979.1|2472453_2473410_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.1	3.7e-42
WP_012444969.1|2473969_2474104_-	aspartate racemase	NA	NA	NA	NA	NA
WP_094187825.1|2474294_2475164_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011408479.1|2475199_2476252_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011258927.1|2476248_2477304_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_027703856.1|2477309_2478083_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408481.1|2478079_2478364_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_044756815.1|2478952_2480485_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_153296743.1|2481526_2481694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408482.1|2481787_2484295_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_011258933.1|2484291_2485260_+	homoserine kinase	NA	NA	NA	NA	NA
WP_024710669.1|2488206_2488521_-	EthD family reductase	NA	NA	NA	NA	NA
WP_011258935.1|2488682_2489987_+	threonine synthase	NA	NA	NA	NA	NA
WP_041182115.1|2490089_2490833_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_113224536.1|2491831_2492056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444952.1|2492097_2493510_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187743.1|2494015_2494814_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2495127_2495454_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2495463_2496378_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2496374_2497670_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_027703958.1|2497666_2498758_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2498754_2499882_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2499878_2500481_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2500477_2501212_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2501205_2501982_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2501971_2502592_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_044756818.1|2503177_2507032_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2507255_2507555_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_012444931.1|2507558_2507753_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_144408324.1|2508021_2511516_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_113022320.1|2514849_2515776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057499.1|2516312_2517065_-	Type II secretory pathway, component ExeA	NA	NA	NA	NA	NA
WP_033013458.1|2517342_2519208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444939.1|2519197_2519923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2520029_2520986_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187742.1|2520986_2521731_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168751.1|2521765_2522077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|2522198_2522381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239627.1|2523004_2523103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756821.1|2523144_2523924_+	pectate lyase	NA	NA	NA	NA	NA
WP_044756822.1|2524454_2527751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444931.1|2528019_2528214_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408491.1|2528217_2528517_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_094187715.1|2532532_2533295_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	2538340	2605157	5033346	transposase	uncultured_Caudovirales_phage(25.0%)	55	NA	NA
WP_011258057.1|2538340_2538562_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2538558_2539230_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011409560.1|2540408_2541371_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2542183_2543140_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756826.1|2544191_2545091_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	9.7e-37
WP_012444921.1|2545257_2545764_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2546238_2546871_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2546870_2548727_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_094187740.1|2548723_2550223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2550165_2550630_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_069960087.1|2550626_2551427_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2551696_2552737_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2552733_2554503_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2554499_2554964_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2554967_2555630_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2555658_2558067_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_115862272.1|2558320_2559286_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2560679_2561414_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2561406_2562648_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2562671_2563124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756828.1|2563074_2563323_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2563433_2564216_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2564232_2564442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444909.1|2564445_2566236_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2566270_2566657_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2566653_2567049_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2567108_2567375_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2567318_2568191_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2568319_2569417_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2569848_2571279_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2571275_2572283_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2572279_2572999_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2573101_2575018_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2575073_2575733_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_044756829.1|2575953_2577330_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_094187715.1|2577363_2578127_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703995.1|2578169_2578373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444899.1|2578944_2579121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2579388_2579769_+	response regulator	NA	NA	NA	NA	NA
WP_044756830.1|2579983_2583379_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_012444894.1|2584373_2587334_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_026144156.1|2588329_2588686_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_044756831.1|2588949_2590254_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	58.9	2.0e-128
WP_012444891.1|2590272_2590998_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	3.1e-86
WP_012444890.1|2590994_2591408_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_012444889.1|2591418_2591949_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_027703900.1|2591945_2592293_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703901.1|2593503_2595084_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012444885.1|2595367_2596387_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_044756832.1|2596437_2597913_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.7	4.3e-98
WP_044756833.1|2598163_2599378_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_012444882.1|2599459_2601688_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_080256634.1|2601684_2602809_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.6e-15
WP_128415445.1|2603280_2603787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862273.1|2603837_2605157_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	2723773	2894621	5033346	tRNA,transposase	uncultured_Mediterranean_phage(30.77%)	113	NA	NA
WP_011259079.1|2723773_2725168_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	4.5e-81
WP_011259080.1|2725169_2725427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2725423_2725729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259081.1|2725725_2726052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2726772_2727435_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2727523_2728054_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011259085.1|2728066_2728714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259087.1|2730254_2731526_+	kynureninase	NA	NA	NA	NA	NA
WP_011259088.1|2731697_2733065_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_012444800.1|2733368_2734814_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_044756855.1|2734810_2735497_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2735469_2736489_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2736530_2737091_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2737111_2738068_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2738235_2739012_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2739495_2741631_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2741627_2741819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2743592_2744099_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2744139_2744667_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2744663_2745155_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_012444795.1|2745178_2745754_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2745830_2746784_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_012444794.1|2746872_2747745_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_094187824.1|2747741_2748509_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2748693_2749392_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_044756856.1|2749555_2750338_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2750346_2750727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2750723_2751434_+	endonuclease III	NA	NA	NA	NA	NA
WP_012444789.1|2752745_2753294_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_094187715.1|2753420_2754184_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444787.1|2755017_2756268_+	porin	NA	NA	NA	NA	NA
WP_094187823.1|2756402_2757476_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_012444785.1|2757661_2758753_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_011259112.1|2758865_2759840_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011259113.1|2759839_2760709_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2760731_2761562_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2761690_2762401_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_012444782.1|2762533_2762929_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2763206_2763848_+	ribonuclease T	NA	NA	NA	NA	NA
WP_115862274.1|2763918_2765238_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756859.1|2765474_2766536_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2767650_2768607_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862275.1|2769079_2770468_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408636.1|2773085_2773448_+	recombinase	NA	NA	NA	NA	NA
WP_011259122.1|2773528_2774497_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011259123.1|2774591_2776436_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259124.1|2776632_2776986_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259125.1|2777117_2778263_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2778332_2779403_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2779568_2780000_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2780123_2781620_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011408639.1|2781579_2781894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|2781964_2782672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|2784838_2785807_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_044749647.1|2786410_2787787_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|2787946_2788903_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756862.1|2789516_2791859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2791883_2792612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756864.1|2792640_2795475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259405.1|2795471_2796401_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756866.1|2796409_2799172_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	3.3e-43
WP_082322915.1|2800737_2803227_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|2803266_2803656_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408813.1|2803810_2804770_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2804702_2805017_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2806531_2807488_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011408645.1|2808936_2810058_-	phytase	NA	NA	NA	NA	NA
WP_103057211.1|2812324_2812750_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2812942_2813575_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187735.1|2813971_2814734_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2815014_2816046_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2816052_2817846_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2817842_2818127_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408650.1|2818358_2818844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2818902_2819409_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2819405_2820026_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2820266_2822171_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_115862276.1|2823415_2824735_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_144408326.1|2824939_2828338_+	avirulence protein	NA	NA	NA	NA	NA
WP_069960346.1|2831614_2835337_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|2835605_2835800_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|2835803_2836103_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_082322917.1|2836242_2839842_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_109182103.1|2839915_2840011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296745.1|2840248_2840521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258825.1|2841211_2842225_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258824.1|2842324_2842909_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011259046.1|2842972_2843941_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258822.1|2844494_2845844_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_099051282.1|2845850_2846615_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2846975_2847443_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_094187738.1|2847629_2848731_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_044756878.1|2852517_2853732_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	6.2e-55
WP_044756879.1|2854078_2855278_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2855426_2855609_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2857622_2858579_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181957.1|2860774_2861740_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|2861740_2862494_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862275.1|2863486_2864875_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408636.1|2867492_2867855_+	recombinase	NA	NA	NA	NA	NA
WP_011259122.1|2867935_2868904_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011259123.1|2868998_2870843_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259124.1|2871039_2871393_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259125.1|2871524_2872670_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_011259129.1|2876370_2877078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296427.1|2877795_2877954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756879.1|2882986_2884186_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2884334_2884517_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2886530_2887487_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181957.1|2889682_2890648_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|2890648_2891402_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445118.1|2892232_2893201_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011258442.1|2893385_2894621_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	2925293	3001634	5033346	coat,transposase	Streptococcus_phage(15.38%)	57	NA	NA
WP_041182545.1|2925293_2926250_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_153296746.1|2926811_2926955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|2926914_2927678_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258759.1|2930701_2932069_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_011258758.1|2932315_2932816_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2933095_2933359_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_012445147.1|2933697_2935194_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258755.1|2935190_2936123_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2936303_2939132_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_044756893.1|2939174_2940377_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258752.1|2940618_2942055_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258751.1|2942253_2942847_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258750.1|2943114_2943708_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011408359.1|2943704_2945474_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_011258748.1|2945812_2946418_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408358.1|2946547_2947474_+	TolC family protein	NA	NA	NA	NA	NA
WP_109181923.1|2947808_2949128_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408356.1|2949497_2950619_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_011408355.1|2950615_2951524_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_011258743.1|2952052_2953183_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_011408354.1|2953342_2955268_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	7.6e-148
WP_011258741.1|2955409_2955928_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011258740.1|2956028_2957081_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_011408352.1|2957197_2958862_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011408351.1|2959304_2959715_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2959819_2960215_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011408349.1|2960561_2960837_-	RnfH family protein	NA	NA	NA	NA	NA
WP_011258735.1|2960850_2961282_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_011408348.1|2961342_2961846_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.6	3.4e-23
WP_011258733.1|2962558_2963035_+	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_011258732.1|2963072_2964866_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258731.1|2965131_2965821_+	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.2	5.4e-11
WP_011258730.1|2966218_2968135_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_011258729.1|2968171_2969164_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_011258728.1|2969406_2969670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862278.1|2970770_2971736_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258724.1|2973181_2973430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|2973624_2974387_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703878.1|2974384_2975119_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258722.1|2975169_2976750_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703877.1|2976756_2977950_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445166.1|2977960_2979478_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012445167.1|2979474_2979915_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258718.1|2980036_2980888_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011258717.1|2980948_2983192_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.1e-81
WP_033013399.1|2983647_2984184_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012445169.1|2984279_2986697_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_011258714.1|2988076_2990203_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_094187734.1|2990579_2991686_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011258712.1|2991754_2993449_-	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_044756901.1|2993743_2994874_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011408335.1|2994878_2995379_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_011408334.1|2995375_2995732_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_012445174.1|2996194_2997391_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_011408332.1|2997407_3000017_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_011258707.1|3000013_3000790_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_033003618.1|3001109_3001634_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 22
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3004777	3064079	5033346	tRNA,coat,transposase,protease	Acidithiobacillus_phage(40.0%)	44	NA	NA
WP_011258703.1|3004777_3005812_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756904.1|3005858_3006191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|3006193_3006919_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756905.1|3007294_3008098_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|3008267_3009146_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|3009273_3009651_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|3009707_3010430_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|3010610_3011168_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|3011185_3011947_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|3011943_3012771_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|3012773_3013964_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_044756906.1|3013990_3015337_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258692.1|3015333_3017787_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_044756907.1|3018155_3019169_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|3019165_3019627_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|3019650_3020442_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|3020480_3021737_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011408322.1|3021733_3022474_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_011408321.1|3022931_3026522_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011258685.1|3026697_3027657_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_044756908.1|3028496_3030677_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756909.1|3030676_3031414_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_044756910.1|3031410_3032823_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258680.1|3032759_3034103_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|3034838_3036215_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044749647.1|3036357_3037734_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_012445196.1|3037962_3038229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757443.1|3038306_3038753_-	membrane protein	NA	NA	NA	NA	NA
WP_011408316.1|3038826_3039429_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011258677.1|3039596_3040913_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_012445198.1|3041385_3041949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|3045644_3045815_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011408313.1|3045828_3046245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756912.1|3047043_3048519_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.8	3.7e-102
WP_011408311.1|3048561_3048957_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_044756913.1|3048996_3050373_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011258670.1|3052008_3052683_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|3052687_3053464_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258668.1|3054736_3056674_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258667.1|3056855_3057833_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_044756914.1|3057829_3059227_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_044756915.1|3059498_3060557_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445211.1|3061320_3061770_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011258663.1|3061994_3064079_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3095133	3140586	5033346	protease,transposase	Tupanvirus(15.38%)	41	NA	NA
WP_094187731.1|3095133_3095932_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862279.1|3096048_3097368_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259046.1|3097580_3098549_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258631.1|3098805_3099072_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|3099246_3099501_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|3099661_3099835_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012445235.1|3100236_3100764_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|3101232_3102333_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011258626.1|3102393_3105222_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011408270.1|3105377_3106553_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011408269.1|3106675_3107020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258624.1|3107249_3107576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408268.1|3107684_3109394_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011408267.1|3109491_3110082_+	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011258621.1|3110078_3110444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445237.1|3110780_3111803_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_044756920.1|3111799_3112033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756921.1|3112029_3113634_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	6.4e-15
WP_044756922.1|3113630_3116132_+	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_012445240.1|3116121_3116766_+	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_003488188.1|3118276_3118483_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_044756923.1|3118569_3119322_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_011408257.1|3119407_3119962_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044757445.1|3119961_3120966_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_012445245.1|3121082_3122660_-	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_012445246.1|3122840_3123875_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041182416.1|3123891_3124575_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_109182069.1|3124758_3126078_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3126178_3127135_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756425.1|3127229_3128606_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_012445230.1|3128834_3130070_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258607.1|3130165_3130663_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_027703339.1|3130837_3132172_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.8	1.7e-29
WP_011408250.1|3132330_3133053_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011258604.1|3133201_3133924_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011258603.1|3134147_3135047_-	GTPase Era	NA	NA	NA	NA	NA
WP_012445253.1|3135043_3135724_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	9.9e-18
WP_011258601.1|3135713_3136091_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258600.1|3136121_3136922_-	signal peptidase I	NA	NA	NA	NA	NA
WP_011258599.1|3137028_3138834_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	6.1e-22
WP_011408249.1|3138999_3140586_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
>prophage 24
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3234108	3394645	5033346	tRNA,transposase	Staphylococcus_prophage(19.23%)	103	NA	NA
WP_011407237.1|3234108_3235065_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_059317522.1|3235216_3235600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756939.1|3236505_3237750_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|3237746_3238025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242902.1|3238102_3238504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|3238786_3239158_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_041183382.1|3239154_3239421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296428.1|3239686_3239833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|3239866_3240823_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258527.1|3241189_3242653_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|3242788_3245131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408196.1|3245410_3247252_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_027703763.1|3247301_3249833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408193.1|3250450_3250651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445314.1|3250708_3251029_-	RebB protein	NA	NA	NA	NA	NA
WP_011258521.1|3251408_3252512_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_080493519.1|3252654_3254613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703765.1|3254722_3255454_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_027703766.1|3255450_3256515_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_115862280.1|3261163_3262483_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757453.1|3262615_3263698_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756940.1|3263709_3264333_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756941.1|3264583_3265060_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|3265093_3266296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756942.1|3266303_3273230_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|3273343_3275380_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|3275419_3275950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258508.1|3275949_3276312_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|3276329_3276731_-	response regulator	NA	NA	NA	NA	NA
WP_044756943.1|3276980_3277931_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|3277927_3278803_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_044757457.1|3279098_3280049_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	48.8	1.4e-65
WP_012445327.1|3280011_3280731_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044756945.1|3280744_3282772_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	2.7e-95
WP_044756946.1|3282973_3283498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756947.1|3283510_3285955_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|3286196_3288299_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044757459.1|3288631_3290074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756951.1|3290391_3292578_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|3292867_3292948_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_044756952.1|3293031_3293931_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|3293927_3294680_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_012445334.1|3294676_3294955_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_012445335.1|3294951_3296070_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|3296132_3296645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703396.1|3297073_3298588_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_044756953.1|3300029_3302684_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756954.1|3302904_3307026_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|3307127_3307673_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258487.1|3308228_3310025_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408165.1|3310163_3310661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703393.1|3310739_3311144_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|3311774_3312449_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_044756955.1|3312827_3314204_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.4e-58
WP_094187715.1|3314270_3315033_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012443979.1|3315084_3316320_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408117.1|3316439_3317123_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_011258440.1|3317165_3317984_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408116.1|3317990_3318509_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_041182054.1|3318566_3319886_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_044756956.1|3320145_3321186_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011408114.1|3321175_3321625_-	protein TolR	NA	NA	NA	NA	NA
WP_012445351.1|3321781_3322561_-	protein TolQ	NA	NA	NA	NA	NA
WP_011258434.1|3322572_3323031_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010363979.1|3323083_3324121_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258433.1|3324249_3326157_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_011258432.1|3326356_3326941_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258431.1|3327098_3327623_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258430.1|3327737_3328466_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_044756957.1|3328555_3329233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258428.1|3329332_3329860_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408113.1|3330371_3332138_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011258426.1|3332295_3333072_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_012445361.1|3333569_3333863_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_044756958.1|3334303_3335542_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756961.1|3338125_3339682_-	membrane protein	NA	NA	NA	NA	NA
WP_012445369.1|3341067_3342462_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_041182545.1|3343832_3344789_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011408105.1|3346490_3349046_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
WP_094187728.1|3350932_3351731_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_052658715.1|3352774_3354598_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_041182545.1|3355210_3356167_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756968.1|3356242_3357211_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.1e-99
WP_082322985.1|3357125_3357824_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.8	8.6e-25
WP_011258802.1|3357875_3358844_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144408327.1|3358954_3359335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182069.1|3359401_3360721_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3360920_3361889_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862281.1|3362025_3363345_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3365964_3366921_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_052658695.1|3372117_3372399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041182622.1|3373969_3374545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756972.1|3374548_3379243_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.6	1.5e-24
WP_044756973.1|3379386_3381006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444470.1|3381029_3383276_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_033013173.1|3383500_3385198_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010365831.1|3385547_3385883_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_033013172.1|3385882_3386509_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_011408097.1|3386511_3388512_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011258402.1|3388511_3389447_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011258401.1|3389960_3390911_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011408096.1|3390998_3391499_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258399.1|3391813_3394645_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
>prophage 25
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3445574	3458022	5033346	transposase	uncultured_marine_virus(33.33%)	9	NA	NA
WP_115862282.1|3445574_3446894_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082322932.1|3447454_3447625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756487.1|3447745_3448960_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_011257031.1|3449131_3450100_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_129593115.1|3450151_3450667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756978.1|3450639_3453402_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_041182545.1|3453425_3454382_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862283.1|3455897_3457217_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3457259_3458022_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3498858	3539137	5033346	tRNA,transposase	Staphylococcus_prophage(18.18%)	35	NA	NA
WP_059317479.1|3498858_3499830_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.5	1.2e-32
WP_094187725.1|3499881_3500292_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|3500390_3501116_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011258308.1|3501532_3502987_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011408037.1|3503053_3504484_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|3504705_3505260_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|3505476_3507417_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_027704133.1|3507592_3508231_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033013599.1|3510464_3511628_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408033.1|3511785_3512577_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258299.1|3512722_3512938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258298.1|3512937_3513705_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258297.1|3513766_3514597_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027704135.1|3514669_3515098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408030.1|3515229_3515709_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|3515959_3516175_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011258293.1|3516402_3516888_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|3518449_3518653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|3519430_3519889_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|3520294_3520801_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258289.1|3520814_3522218_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075242217.1|3523403_3524135_-	nitrilase	NA	NA	NA	NA	NA
WP_044756990.1|3524208_3525165_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_011408020.1|3525638_3526451_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011258802.1|3526513_3527482_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862284.1|3527681_3529001_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296748.1|3530322_3530469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408018.1|3530456_3530840_-	membrane protein	NA	NA	NA	NA	NA
WP_011258280.1|3531355_3532168_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_069960350.1|3532228_3533287_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	1.1e-71
WP_044756992.1|3533281_3534451_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	8.3e-97
WP_011408014.1|3534636_3535020_-	membrane protein	NA	NA	NA	NA	NA
WP_012444370.1|3535754_3536567_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_115862285.1|3536637_3537957_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756993.1|3538078_3539137_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3575622	3651198	5033346	transposase	uncultured_Caudovirales_phage(22.22%)	60	NA	NA
WP_011258802.1|3575622_3576591_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182394.1|3577420_3577969_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_080497155.1|3578363_3578969_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258248.1|3578961_3579909_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044757009.1|3579905_3582329_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
WP_044757488.1|3582338_3583751_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_080493518.1|3583740_3584427_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_027704078.1|3584387_3585248_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082322986.1|3585302_3587705_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	3.5e-41
WP_012445686.1|3588752_3589610_-	pirin family protein	NA	NA	NA	NA	NA
WP_044757012.1|3589841_3591914_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005926176.1|3591913_3592138_+	putative selenoprotein	NA	NA	NA	NA	NA
WP_094187854.1|3592675_3593353_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_115862286.1|3593731_3594697_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757015.1|3597206_3598691_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.1e-13
WP_011258239.1|3598973_3599510_-	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_044757016.1|3599785_3600784_+	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_044757017.1|3600968_3601763_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258236.1|3602079_3603486_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258235.1|3603466_3604822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258234.1|3604818_3605277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757019.1|3605260_3607870_-	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012445697.1|3608969_3609851_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_027703692.1|3610949_3611549_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258228.1|3611701_3612136_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011258227.1|3612645_3613593_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_011407969.1|3613606_3614074_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_011258225.1|3614066_3614633_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_011407966.1|3615897_3616470_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_041182545.1|3616537_3617494_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044757021.1|3618167_3619298_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011258220.1|3619411_3620449_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407962.1|3620812_3621505_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011407961.1|3621548_3622409_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011258216.1|3624443_3624869_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_044757022.1|3624974_3625616_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_027703896.1|3625673_3626015_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_011258213.1|3626072_3626615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|3626670_3627267_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_099051294.1|3627384_3627765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407955.1|3627871_3628090_-	peptidase	NA	NA	NA	NA	NA
WP_003487757.1|3628194_3628662_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407954.1|3628833_3629292_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_044757023.1|3629307_3630765_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407952.1|3631022_3631787_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
WP_011258208.1|3631786_3633049_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011258207.1|3633045_3634290_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_011258206.1|3634491_3635031_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258205.1|3635027_3635357_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_109181895.1|3637292_3638258_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168743.1|3638978_3639245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239693.1|3639522_3640677_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_011258200.1|3640676_3641999_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011407948.1|3642025_3643066_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011407947.1|3643083_3643944_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407946.1|3643978_3644578_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082322940.1|3644644_3645580_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_075239694.1|3645645_3646998_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_082322987.1|3647089_3648274_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	6.5e-41
WP_011257310.1|3649962_3651198_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3660848	3736639	5033346	tRNA,transposase	Acinetobacter_phage(33.33%)	49	NA	NA
WP_044757030.1|3660848_3662324_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	2.9e-99
WP_033013356.1|3662406_3663225_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011258183.1|3664335_3665181_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	31.7	8.6e-11
WP_027703789.1|3665204_3665630_-	YcxB family protein	NA	NA	NA	NA	NA
WP_041182018.1|3665902_3667819_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	8.6e-67
WP_082322988.1|3668949_3669906_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011258179.1|3671907_3672348_+	VOC family protein	NA	NA	NA	NA	NA
WP_011258178.1|3672621_3675009_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_012445735.1|3675341_3677741_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	4.9e-11
WP_012445737.1|3678839_3680549_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_011258173.1|3681958_3682720_+	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_044757032.1|3682720_3684862_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011258171.1|3685097_3686324_+	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
WP_011258170.1|3686320_3688123_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011258169.1|3688119_3689316_+	MFS transporter	NA	NA	NA	NA	NA
WP_027703817.1|3689293_3691063_+	iron transporter	NA	NA	NA	NA	NA
WP_027703818.1|3691059_3692256_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011258166.1|3692430_3693165_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011258165.1|3693161_3693752_-	fructose 2,6-bisphosphatase	NA	NA	NA	NA	NA
WP_011407923.1|3693748_3694795_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|3694791_3695313_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011258162.1|3695826_3696438_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_027703819.1|3696434_3697034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258160.1|3697033_3697627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258158.1|3699399_3701277_-	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_109181892.1|3704333_3704483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757036.1|3704513_3705425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407916.1|3705549_3708135_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_011258151.1|3708580_3708886_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012445759.1|3708915_3709191_+	glutathione transferase	NA	NA	NA	NA	NA
WP_094187788.1|3709876_3710674_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|3711368_3712583_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407912.1|3713002_3713410_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_044757505.1|3713750_3715241_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_044757038.1|3715866_3716274_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_044757039.1|3716397_3717177_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_011407909.1|3717270_3717783_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3717826_3718084_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407908.1|3718193_3718991_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_044757040.1|3718981_3720052_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407905.1|3721624_3723001_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3724532_3725324_+	membrane protein	NA	NA	NA	NA	NA
WP_027704032.1|3725611_3726661_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_044757042.1|3726908_3728492_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_115862287.1|3728989_3729955_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082322943.1|3730645_3731533_-	HutD family protein	NA	NA	NA	NA	NA
WP_005919170.1|3733235_3733568_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407897.1|3733767_3735261_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_044757045.1|3735580_3736639_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3765796	3919409	5033346	transposase	Xanthomonas_phage(36.36%)	112	NA	NA
WP_011257570.1|3765796_3767032_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3767453_3768842_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3769597_3770539_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3770852_3771617_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3771809_3773192_+	APC family permease	NA	NA	NA	NA	NA
WP_011258087.1|3773631_3775029_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012445797.1|3775591_3775990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3776134_3777139_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3777176_3778694_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_044757048.1|3778734_3779781_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|3779791_3780544_-	SapC family protein	NA	NA	NA	NA	NA
WP_094187791.1|3780875_3784022_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044757049.1|3785080_3787087_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3787306_3787753_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3789780_3790947_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3790948_3791521_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3791533_3791938_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_094187792.1|3791975_3792647_-	YjfK family protein	NA	NA	NA	NA	NA
WP_027703610.1|3792649_3793732_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3793757_3794531_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3794543_3794960_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3795140_3795740_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3795906_3796449_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011258068.1|3796445_3797558_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3797859_3798111_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|3798125_3799190_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_044757050.1|3800661_3804378_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|3804646_3804841_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408408.1|3804844_3805144_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_044757051.1|3805367_3809816_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3810084_3810279_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011407858.1|3810282_3810582_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	1.4e-45
WP_082322945.1|3810721_3814216_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182763.1|3814484_3814679_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3814682_3814982_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_011407855.1|3815205_3818214_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182763.1|3818482_3818677_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3818680_3818980_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_044757053.1|3819203_3823331_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|3823504_3823726_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012445821.1|3823722_3824394_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012445822.1|3824415_3825285_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_027703881.1|3829246_3830536_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3833926_3834376_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3835818_3836322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258050.1|3836346_3836772_-	cytochrome c	NA	NA	NA	NA	NA
WP_094187794.1|3836768_3838352_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011407842.1|3839912_3840530_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258048.1|3840776_3842003_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011258047.1|3842075_3842948_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3844208_3845007_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407839.1|3845087_3845747_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011407838.1|3845898_3847986_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012445831.1|3848162_3849143_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_011407835.1|3849576_3850464_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_094187728.1|3850506_3851304_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704066.1|3851529_3851919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407833.1|3851998_3852676_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704076.1|3853138_3854458_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_115801876.1|3854567_3855533_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3855621_3856385_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3856772_3857774_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3858430_3858571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445035.1|3859648_3860884_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_153296751.1|3861064_3861214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445839.1|3862964_3863738_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011258028.1|3863751_3864582_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3864652_3865429_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258026.1|3865439_3866132_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3866131_3866746_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3867088_3867673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703579.1|3867669_3868992_-	TonB family protein	NA	NA	NA	NA	NA
WP_011407820.1|3868981_3869347_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703580.1|3869446_3870808_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_044757056.1|3870825_3871524_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_044757057.1|3871546_3872209_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407815.1|3872189_3873029_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3873028_3873703_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_044757058.1|3873699_3875199_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069960293.1|3875195_3875843_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011258012.1|3878130_3879306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703583.1|3879435_3882150_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407808.1|3882469_3883462_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011258009.1|3883464_3884181_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011258007.1|3884999_3887000_-	transketolase	NA	NA	NA	NA	NA
WP_027703585.1|3887226_3888507_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3888704_3889022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3889317_3891075_-	membrane protein	NA	NA	NA	NA	NA
WP_027703586.1|3891071_3892889_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258003.1|3892885_3893893_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|3893889_3894351_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3894353_3895316_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012445859.1|3895336_3896356_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115862288.1|3896978_3898013_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258092.1|3898083_3899319_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|3899461_3900259_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3900330_3902280_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3902299_3902833_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3902829_3903495_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_044757059.1|3903491_3904250_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407795.1|3904249_3905308_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_094187795.1|3905430_3907953_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_041182719.1|3908020_3908977_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011407794.1|3909321_3909972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407793.1|3910348_3911638_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3911851_3912094_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_044757060.1|3912165_3913104_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257988.1|3913229_3915383_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257987.1|3915403_3915784_-	RidA family protein	NA	NA	NA	NA	NA
WP_011257986.1|3915863_3918035_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011407791.1|3918163_3918463_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_094187796.1|3918610_3919409_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	3978603	4046963	5033346	protease,integrase,transposase	Ralstonia_phage(23.53%)	54	3978041:3978100	4045086:4045150
3978041:3978100	attL	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACT	NA	NA	NA	NA
WP_044757070.1|3978603_3979839_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044757071.1|3980827_3982429_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|3983045_3983792_-	cellulase	NA	NA	NA	NA	NA
WP_113195645.1|3984264_3985023_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|3985539_3986055_-	peptide deformylase	NA	NA	NA	NA	NA
WP_044757517.1|3986376_3986799_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.9	5.2e-41
WP_012445908.1|3987570_3989439_-	membrane protein	NA	NA	NA	NA	NA
WP_011407746.1|3989477_3990431_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|3990436_3991393_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011257916.1|3991385_3993338_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|3993334_3993868_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|3993987_3994338_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3994439_3995033_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|3995130_3995451_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_044757072.1|3995457_3997554_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_044757073.1|3998115_3998562_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|3998558_3998804_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|3998800_3999298_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|3999322_3999682_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044757074.1|3999699_4000731_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|4000730_4001480_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|4001479_4002229_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257903.1|4002249_4003299_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|4003509_4003914_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407739.1|4004024_4004711_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_115862289.1|4004809_4005775_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257899.1|4005857_4006415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239641.1|4006476_4006740_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757075.1|4006736_4008431_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_044757076.1|4008427_4010635_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_075239641.1|4010696_4010960_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757077.1|4010956_4012651_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_011257897.1|4012647_4014852_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_044757078.1|4015171_4016869_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_059317525.1|4016865_4019016_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757079.1|4019083_4021807_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
WP_012445927.1|4022202_4022403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407730.1|4023295_4023925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445930.1|4024751_4025456_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011257889.1|4025891_4026626_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257888.1|4026634_4027087_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257887.1|4027114_4027771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257886.1|4027783_4028551_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_044757080.1|4028547_4029726_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011407728.1|4030424_4032395_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|4033226_4033499_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_012445937.1|4033712_4036184_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_011257881.1|4036327_4037614_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|4037738_4038365_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|4038457_4039750_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|4043067_4043829_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|4043972_4044980_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_115862290.1|4045243_4046209_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
4045086:4045150	attR	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACTGCAAG	NA	NA	NA	NA
WP_094187737.1|4046209_4046963_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	4091301	4200863	5033346	protease,transposase	Staphylococcus_prophage(12.5%)	75	NA	NA
WP_094187715.1|4091301_4092064_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409312.1|4093683_4094325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057581.1|4095557_4096286_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.4e-06
WP_011409560.1|4096331_4097294_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4097398_4098161_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|4098155_4098398_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|4098946_4099408_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011258802.1|4099668_4100637_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187763.1|4102033_4102832_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257834.1|4103073_4103688_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|4103770_4104757_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4104872_4105367_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4105611_4107441_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|4107459_4107930_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4108852_4109980_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4110080_4111463_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_044757084.1|4111710_4113834_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|4114362_4114881_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011257570.1|4117204_4118440_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757085.1|4119053_4119944_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_115862291.1|4122543_4123863_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187858.1|4124607_4125531_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	5.8e-37
WP_094187763.1|4125718_4126516_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|4127426_4128189_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4128278_4129244_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|4129545_4131123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|4131190_4131954_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757086.1|4132020_4133235_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187798.1|4134605_4135403_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257831.1|4136375_4137260_-	membrane protein	NA	NA	NA	NA	NA
WP_027703752.1|4137406_4138003_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_044757531.1|4138002_4139361_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011257828.1|4139727_4140291_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257827.1|4140450_4141707_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_012446005.1|4143387_4143879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182120.1|4144163_4144337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182780.1|4144333_4145299_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|4147540_4148023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|4148219_4148756_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_094187799.1|4148902_4150018_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|4150544_4151501_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187800.1|4151690_4154660_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|4154705_4155599_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407693.1|4158486_4160364_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|4161628_4162630_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|4162673_4164395_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|4164378_4164636_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_044757088.1|4164711_4165836_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|4165832_4167395_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|4167725_4168799_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011257807.1|4169615_4170263_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|4170330_4171779_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|4171899_4172784_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115862292.1|4173775_4174741_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|4174909_4175371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|4175640_4176294_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407686.1|4176422_4177079_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257798.1|4177099_4178479_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|4178751_4180068_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257796.1|4180144_4181065_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|4181298_4182633_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011407685.1|4182613_4183726_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|4183735_4183933_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|4184058_4184592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257791.1|4185218_4185854_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044757089.1|4188560_4191233_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	7.5e-77
WP_044757090.1|4191559_4192852_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	4.9e-74
WP_011257785.1|4193189_4193375_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_027703756.1|4193668_4194532_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|4194531_4195659_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|4196288_4196675_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|4196914_4197814_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|4198224_4198701_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|4198863_4199346_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_094187801.1|4200064_4200863_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	4233095	4302845	5033346	tRNA,transposase	Enterobacteria_phage(12.5%)	46	NA	NA
WP_059317495.1|4233095_4234061_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069960353.1|4234172_4236464_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4236591_4237266_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_044757099.1|4237262_4239107_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4239103_4239970_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4239989_4240622_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|4240624_4241659_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|4241673_4241964_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4249451_4250291_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|4250901_4252059_+	phosphotransferase	NA	NA	NA	NA	NA
WP_044757100.1|4252094_4254257_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|4254632_4255208_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|4255313_4256042_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|4256472_4257312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|4257308_4259621_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011407647.1|4259617_4260427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|4260416_4261070_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407645.1|4261053_4262175_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|4262171_4263023_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011257726.1|4263019_4263655_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_012446066.1|4263651_4264068_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|4264064_4264574_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|4264583_4265015_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_044757101.1|4265282_4266500_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_041181968.1|4266499_4266679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407640.1|4266675_4268415_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_011407636.1|4270635_4274433_-	membrane protein	NA	NA	NA	NA	NA
WP_044757102.1|4275410_4279463_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	3.4e-121
WP_011257718.1|4279861_4280659_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|4281110_4282082_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|4282508_4282976_+	RDD family protein	NA	NA	NA	NA	NA
WP_011407635.1|4283390_4284497_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011407634.1|4284493_4285576_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011257713.1|4285683_4287156_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257712.1|4287155_4287461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257711.1|4287501_4287927_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_044757104.1|4288134_4291077_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	8.4e-130
WP_027704099.1|4291084_4291387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187802.1|4292013_4293114_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	2.1e-41
WP_075244150.1|4293301_4293616_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_115862293.1|4293682_4295002_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|4295138_4296107_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862294.1|4296306_4297626_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757108.1|4297945_4298986_+	pectate lyase	NA	NA	NA	NA	NA
WP_094187803.1|4299252_4301298_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
WP_115862295.1|4301525_4302845_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	4324808	4335435	5033346		Enterobacteria_phage(42.86%)	10	NA	NA
WP_011407616.1|4324808_4326155_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4326200_4327604_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011257679.1|4327720_4328629_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.4e-27
WP_011257678.1|4328625_4329183_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.0e-44
WP_011407613.1|4329179_4330067_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|4330122_4331178_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|4331403_4332150_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|4332149_4333091_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|4333313_4334132_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4334121_4335435_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
>prophage 34
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	4464622	4511883	5033346	transposase	Acinetobacter_phage(50.0%)	44	NA	NA
WP_094187763.1|4464622_4465420_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012446191.1|4467285_4467534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757130.1|4467545_4469360_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407528.1|4469480_4469861_+	response regulator	NA	NA	NA	NA	NA
WP_011257545.1|4469829_4470096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407527.1|4470095_4471376_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407526.1|4472492_4473902_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044757134.1|4473892_4474909_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_115862297.1|4476341_4477730_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012443955.1|4478000_4478969_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_115862298.1|4479118_4480438_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296753.1|4480508_4480673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4480672_4480939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4481163_4482210_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_044757138.1|4482393_4483974_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4484362_4485259_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4485261_4486425_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4486435_4487011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443950.1|4487038_4487758_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4487818_4488037_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4488136_4489012_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4489050_4489647_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4489643_4489817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4489797_4491402_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4491440_4492394_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4492410_4492887_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4493163_4496364_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4496523_4497502_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_003483093.1|4498559_4499030_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4499372_4499588_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4499668_4500286_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4500834_4501227_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4501230_4501659_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4501844_4502498_+	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_011409578.1|4502773_4503088_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4503247_4504042_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4504179_4504872_+	CRP-like protein Clp	NA	NA	NA	NA	NA
WP_011409579.1|4505192_4505909_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4505901_4506699_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4506835_4507873_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4507990_4508620_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4508771_4509353_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_075240081.1|4510058_4510733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187806.1|4510781_4511883_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 35
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	4516769	4576656	5033346	integrase,tRNA,transposase	Vibrio_phage(15.38%)	54	4520982:4520998	4569354:4569370
WP_044757142.1|4516769_4518146_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.9e-79
WP_041182574.1|4518440_4519397_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
4520982:4520998	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_011407508.1|4522702_4522948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|4522944_4523217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257520.1|4523213_4523420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|4523553_4524828_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_044757143.1|4525087_4525885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181951.1|4525881_4527156_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257516.1|4527236_4527647_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_011257515.1|4528959_4529118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181950.1|4529114_4529417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757144.1|4529423_4530509_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_044757145.1|4530510_4530771_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_044757146.1|4530767_4531247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757147.1|4531260_4531980_-	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_044757148.1|4532330_4532615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757149.1|4532611_4533451_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	40.0	8.0e-09
WP_076659458.1|4533447_4533681_-	plasmid-related protein	NA	NA	NA	NA	NA
WP_041181948.1|4533919_4535014_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_069960144.1|4535393_4535612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407506.1|4535763_4536084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4536276_4538151_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|4538259_4538700_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407504.1|4538800_4539715_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4539914_4540436_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4540678_4541812_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_042465436.1|4541921_4542425_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044757151.1|4542421_4543927_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_094187807.1|4544092_4545151_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257498.1|4545151_4545976_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_044757153.1|4546173_4547451_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257496.1|4547615_4549337_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4549387_4550701_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4550700_4551624_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011257493.1|4552017_4552530_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4552662_4553799_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4553870_4555013_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4555055_4555529_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4555569_4556292_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257488.1|4556333_4557608_+	RDD family protein	NA	NA	NA	NA	NA
WP_011257487.1|4557790_4560283_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4560293_4560857_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4561080_4561854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757155.1|4561850_4562525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|4562686_4563463_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4563569_4563785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181946.1|4563970_4565872_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_041181945.1|4565956_4567333_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011257479.1|4567841_4568687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4569017_4569620_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
4569354:4569370	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011257477.1|4569603_4570629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757158.1|4571094_4573317_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4573719_4574235_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_115862299.1|4575690_4576656_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	4754853	4908898	5033346	holin,tRNA,transposase	Tupanvirus(10.53%)	103	NA	NA
WP_011257354.1|4754853_4755858_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011407403.1|4756320_4756515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4757265_4757841_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011257350.1|4757899_4759423_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_011257349.1|4760113_4760584_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012446321.1|4760545_4760734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960355.1|4761794_4762061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4762141_4763110_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044757197.1|4763494_4765627_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4765904_4766054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407398.1|4766088_4766475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4766476_4767328_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041181934.1|4767380_4768262_+	TolB-like protein	NA	NA	NA	NA	NA
WP_011257339.1|4768884_4771419_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407395.1|4771652_4772405_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4772532_4773447_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407393.1|4774719_4775712_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011257333.1|4776376_4776835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181932.1|4776934_4778725_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_027703506.1|4778933_4781171_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4781595_4782285_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_044757561.1|4782674_4785689_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4785872_4786574_+	SapC family protein	NA	NA	NA	NA	NA
WP_011257326.1|4786563_4787577_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041181930.1|4787587_4789153_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_044757199.1|4789292_4790303_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4790712_4791906_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4791902_4792649_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_027703503.1|4792680_4794282_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4794342_4794543_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069960366.1|4794539_4795127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4795330_4795492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4795612_4795885_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703501.1|4795950_4796940_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_094187813.1|4797024_4797786_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4797888_4798884_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_012446343.1|4798901_4799693_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446344.1|4799695_4800445_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.3e-54
WP_012446345.1|4800563_4801502_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011257310.1|4801928_4803164_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082322992.1|4803216_4804383_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187862.1|4807016_4808118_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_041182545.1|4808240_4809197_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187715.1|4809936_4810699_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187814.1|4810759_4811557_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407366.1|4811909_4812194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757202.1|4814540_4815650_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_044757204.1|4815884_4816529_+	sterol-binding protein	NA	NA	NA	NA	NA
WP_011257293.1|4816525_4818199_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257292.1|4818312_4818702_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|4818926_4819679_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_094187815.1|4819774_4820317_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011407360.1|4820409_4820841_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407359.1|4820843_4821473_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_044757206.1|4821502_4821703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|4822109_4824278_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257286.1|4824404_4826567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4827393_4828359_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257284.1|4828551_4830033_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_094187863.1|4830469_4830835_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4830831_4832133_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4832313_4833090_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|4833218_4833982_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407353.1|4834382_4834967_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011257279.1|4835159_4838609_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_044757210.1|4839356_4841999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757567.1|4842102_4844502_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4844504_4845887_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4846044_4846629_+	gluconokinase	NA	NA	NA	NA	NA
WP_044757212.1|4847514_4849269_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_011407345.1|4849576_4849882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4849784_4850225_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4850244_4850673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862301.1|4852167_4853487_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|4856358_4857327_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862302.1|4858609_4859929_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445230.1|4860221_4861457_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_059317507.1|4863138_4864095_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	1.0e-39
WP_115862304.1|4864939_4865905_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757224.1|4865922_4866480_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4866498_4866786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4867170_4867965_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4867964_4868714_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4868725_4869277_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4869273_4869936_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_011257254.1|4869925_4870216_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4870226_4871285_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_094187817.1|4873083_4873847_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757229.1|4873951_4874914_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407325.1|4875260_4876076_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_044757236.1|4885395_4887300_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4887296_4887899_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011407318.1|4887958_4889263_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011257243.1|4889810_4891973_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407316.1|4892266_4892473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257241.1|4892680_4893070_-	YchJ family protein	NA	NA	NA	NA	NA
WP_011257239.1|4894428_4895559_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4896206_4897259_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257237.1|4898021_4899095_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407313.1|4899402_4900461_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011407913.1|4901691_4902906_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182826.1|4904634_4905168_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_094187728.1|4908099_4908898_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP013674	Xanthomonas oryzae pv. oryzae strain PXO211, complete genome	5033346	4962265	5021512	5033346	protease,transposase	Ralstonia_virus(18.18%)	44	NA	NA
WP_115862307.1|4962265_4963231_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260840.1|4963406_4964822_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260841.1|4965312_4967637_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_044757575.1|4967994_4968405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757577.1|4968782_4969328_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_044757259.1|4969423_4970800_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.1e-76
WP_011260845.1|4971836_4972964_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4973819_4975160_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4975376_4976069_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4976192_4976513_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4976512_4977505_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4977811_4979335_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|4979439_4980675_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4980835_4981492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757261.1|4981642_4983454_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4983601_4983952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862308.1|4984130_4985450_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|4986862_4988044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4988141_4991573_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4991720_4992419_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4992402_4993875_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_044757264.1|4993871_4994459_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_044757265.1|4994458_4995655_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011409834.1|4995728_4996358_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	1.2e-46
WP_103057218.1|4997038_4997566_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4997562_4998129_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|4998404_4999766_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_153296757.1|4999879_5000044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322996.1|5000027_5000984_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.4e-41
WP_011409842.1|5003073_5003280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260869.1|5003260_5004379_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_049756351.1|5006730_5007483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|5007479_5008187_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_041182345.1|5008200_5008542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|5008522_5009032_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_069960357.1|5009028_5009430_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_074038671.1|5010775_5011033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260878.1|5011890_5012097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757270.1|5013108_5014278_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
WP_041182532.1|5014303_5015614_-	MFS transporter	NA	NA	NA	NA	NA
WP_010364861.1|5017526_5017847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704146.1|5017965_5019132_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|5019395_5020352_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|5020726_5021512_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
