The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	7736	50019	5039763	transposase,protease	Ralstonia_phage(33.33%)	38	NA	NA
WP_011407164.1|7736_8573_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044756151.1|8759_9566_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9842_11036_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044756154.1|11189_11858_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11942_12704_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12750_13173_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13176_13590_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13885_14653_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14663_14933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|15007_16468_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17114_18125_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18396_19599_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19740_21879_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22089_22383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22414_22912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23158_24139_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24186_25353_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25499_26066_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011257028.1|27540_28758_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29385_30408_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30988_32242_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094187708.1|32315_33113_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157724563.1|33100_34075_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443571.1|34959_35622_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_044756160.1|35775_36570_-	peptidase	NA	NA	NA	NA	NA
WP_027704023.1|36737_37211_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|39541_40498_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756163.1|40545_41457_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257041.1|41943_42342_-	host attachment protein	NA	NA	NA	NA	NA
WP_044756164.1|42433_43126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|43295_43766_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011407233.1|45232_45544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756166.1|45798_46746_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	4.3e-43
WP_044756167.1|46886_47945_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|48083_48365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|48405_48678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|48745_48955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445831.1|49038_50019_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
>prophage 2
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	85751	143097	5039763	transposase	Acidithiobacillus_phage(25.0%)	41	NA	NA
WP_044749647.1|85751_87128_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182539.1|87293_88847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|91060_91402_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_041182843.1|91586_94145_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|94163_94424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187710.1|94483_95246_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|95253_96978_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_011257102.1|97218_98160_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|98352_99717_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|99713_101342_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_027703733.1|101815_103399_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044756187.1|103395_105630_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|105632_107390_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|107446_109336_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_027703731.1|109332_111942_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|111964_112150_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|112264_114427_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|114443_115076_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|115239_115737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|115877_116924_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_041182545.1|118319_119276_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862254.1|119603_120569_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_080256641.1|120666_121677_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_148648650.1|121657_124060_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_080256644.1|124175_124634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|124633_124966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|124982_125243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|126566_127976_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011407187.1|128324_128756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|129030_129366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|129805_131095_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443641.1|131713_132694_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|133159_133483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443643.1|133424_133667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157724565.1|134042_135008_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756190.1|136679_138056_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_129215536.1|138657_139365_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_070344074.1|139361_140633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128415443.1|140747_141653_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_133264932.1|141656_142073_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_044756191.1|142140_143097_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	6.2e-42
>prophage 3
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	177793	323349	5039763	tRNA,transposase,tail	Arthrobacter_phage(15.0%)	96	NA	NA
WP_115862255.1|177793_178759_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187711.1|183158_184226_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257175.1|184360_184489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181912.1|184431_184959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|185781_187965_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|187976_191327_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|191323_194440_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|196367_197402_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_094187821.1|200099_200279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494036.1|200281_200608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443686.1|200677_200791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756212.1|200873_202349_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	1.4e-101
WP_012443690.1|203957_205478_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|205494_205773_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|205962_206301_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|206913_208899_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_041182297.1|209530_210493_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|210898_211711_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|211903_212515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|212931_213789_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|214026_215913_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_044756216.1|223183_224875_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_012443704.1|225410_227315_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|227575_227755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|227888_228356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|228513_229473_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|229457_230075_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|230117_230537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443706.1|230789_231695_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|231943_232828_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|232891_233674_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|233718_234480_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|234643_234973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|235291_236383_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|236451_238050_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|238214_239459_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_044756226.1|239910_240540_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	2.6e-52
WP_011257211.1|240746_242723_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|244110_244776_-	YceH family protein	NA	NA	NA	NA	NA
WP_044756232.1|245062_246073_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|246069_246801_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_044756234.1|247154_248684_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.3e-46
WP_011407300.1|248793_251826_-	membrane protein	NA	NA	NA	NA	NA
WP_044756235.1|252124_255163_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|255327_256380_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239519.1|256548_256794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|256792_257758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756236.1|257757_260421_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_044756238.1|260617_261598_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_011257222.1|262238_262457_-	YdcH family protein	NA	NA	NA	NA	NA
WP_082322966.1|263902_265087_-|transposase	IS256-like element IS1113 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_082322873.1|265137_265815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756239.1|265811_266354_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756241.1|266350_267169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|267454_268411_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_044756245.1|268674_268854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052658672.1|268850_269069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|269240_270197_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011409779.1|272296_273334_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409777.1|275027_275873_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|276032_277238_+	aminotransferase	NA	NA	NA	NA	NA
WP_011409775.1|277290_277623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409774.1|277671_278409_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_027704185.1|278405_279878_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044756247.1|280164_281346_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|281417_282701_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_012443732.1|282697_283684_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|283728_285006_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|285002_285623_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|285765_289473_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|289667_290030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|290126_290303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260776.1|290564_291482_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|291834_292467_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_027704183.1|292482_292959_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|292962_293535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260772.1|293531_295547_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|295838_296267_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|296386_297190_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|297249_298239_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756250.1|298652_300725_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|300919_301531_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|302684_303491_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|303627_304425_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|304646_306056_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|306333_306672_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_094187712.1|306661_308137_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|308407_309463_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|309455_310883_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_011409759.1|311504_311984_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	6.1e-14
WP_027704180.1|312054_312687_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_115862256.1|312969_313935_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|314022_314559_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|314617_315145_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|315213_315759_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_044756255.1|322113_323349_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	348398	447620	5039763	tRNA,transposase	Staphylococcus_prophage(12.5%)	60	NA	NA
WP_041182856.1|348398_349355_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
WP_109182069.1|349457_350777_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187713.1|350905_351703_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|351736_352417_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_094187714.1|352491_353586_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|353595_354717_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_113090107.1|354782_355772_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|355900_356664_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|357583_357721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187716.1|358596_359395_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|359811_360846_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409728.1|360877_362365_-	MFS transporter	NA	NA	NA	NA	NA
WP_094187822.1|362463_365337_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187717.1|365678_367160_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756273.1|368576_369554_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_044756275.1|369594_371013_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|371239_372295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|373272_374745_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260708.1|374967_377682_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|377684_379385_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|379384_380644_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_041182560.1|380655_382620_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409722.1|382616_384812_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|384987_386055_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011259480.1|386280_387618_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012443789.1|388221_389139_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011260701.1|389202_390108_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|390734_391520_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|391790_392249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240508.1|392329_393085_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|393182_394148_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|394302_395205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|395277_395505_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_044756277.1|395520_396162_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|396158_396914_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|397065_397965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|398024_398777_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_094187718.1|399320_400119_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756280.1|400259_409043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|409436_411251_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012443796.1|411340_412249_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260687.1|412538_414776_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_044756282.1|414775_416377_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011260685.1|416629_419389_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	1.2e-146
WP_011409702.1|420893_421988_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409701.1|422066_422729_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_070344077.1|422945_423671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260681.1|423769_425083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260680.1|425197_426523_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260679.1|426584_426971_+	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_044756287.1|427061_428780_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011409699.1|429051_429570_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_075239745.1|430688_431000_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_044756291.1|432624_432966_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_011409694.1|433527_434148_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260670.1|434276_435440_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011260669.1|435450_437061_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260668.1|437303_439331_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260667.1|439430_441515_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_115862257.1|446300_447620_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	533900	593544	5039763	transposase,integrase	Acidithiobacillus_phage(33.33%)	36	557414:557435	592144:592165
WP_113114264.1|533900_534458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_042465296.1|535407_536028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260592.1|536124_536316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756325.1|536325_536949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|537380_538301_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260589.1|538300_538819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260588.1|538980_541806_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011409640.1|541901_542462_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_027703830.1|545549_546050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757299.1|546945_547893_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011260581.1|548026_548617_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409632.1|548827_549574_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|550059_550479_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_012443890.1|550475_550907_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260578.1|550903_552910_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_076659533.1|553028_553475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182069.1|555948_557268_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
557414:557435	attL	GGGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_044756331.1|557669_562100_-	avirulence protein	NA	NA	NA	NA	NA
WP_014504812.1|565421_568109_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_044756332.1|568233_569688_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_143678630.1|569966_570404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756333.1|571961_572261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409617.1|573140_573431_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_044756337.1|573507_576309_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011260560.1|577256_578156_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011409614.1|579282_580425_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_103057293.1|580456_580720_+	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
WP_044756339.1|582542_583418_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.2	1.2e-55
WP_044756340.1|583648_585487_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|585661_585928_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|585953_586499_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|586970_588278_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409609.1|588416_589676_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|589917_591294_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_027703952.1|591623_592157_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756341.1|592167_593544_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	8.6e-77
592144:592165	attR	ATAGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
>prophage 6
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	606411	666238	5039763	tRNA,transposase	Vibrio_phage(20.0%)	43	NA	NA
WP_044756347.1|606411_606888_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|607229_608453_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|608557_609169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409603.1|609270_610020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756348.1|610210_611557_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756350.1|611541_612984_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_044756351.1|613033_614761_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_044756353.1|615119_615716_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_044756355.1|616038_617064_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_044756356.1|617079_617595_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|617704_618139_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_044756357.1|618214_618637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|618665_619136_-	thioesterase	NA	NA	NA	NA	NA
WP_075240018.1|621088_621298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703859.1|621307_622675_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|622964_626105_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011260521.1|626238_629487_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_012443931.1|629579_630824_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409596.1|631083_632400_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|633158_633974_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_044756360.1|635766_637002_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|637070_637460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|637848_638805_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181928.1|638840_639806_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|641044_641767_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_027703875.1|641777_643214_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012443983.1|643213_644482_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|644571_646713_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407520.1|646797_647463_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|647459_648134_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027703874.1|648130_650788_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_011257533.1|650798_651548_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|651874_652087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|652528_652750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239431.1|652759_653074_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_115862259.1|653534_654854_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260472.1|655105_656854_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|656943_657906_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_094187724.1|658668_659431_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|659571_660540_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408020.1|660602_661415_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075242217.1|662917_663649_+	nitrilase	NA	NA	NA	NA	NA
WP_011258289.1|664834_666238_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	672455	741477	5039763	tRNA,transposase	Bacillus_virus(13.33%)	47	NA	NA
WP_011258297.1|672455_673286_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011258298.1|673347_674115_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|674114_674330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|674475_675267_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_033013599.1|675424_676588_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027704133.1|678821_679460_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|679635_681576_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|681792_682347_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|682568_683999_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258308.1|684065_685520_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011258309.1|685936_686662_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_094187725.1|686760_687171_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_059317479.1|687222_688194_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.5	1.2e-32
WP_044756988.1|688420_690802_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258314.1|693430_693841_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|694140_694323_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_044756986.1|694455_695496_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|695568_697014_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_044756984.1|697140_698439_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011258319.1|698695_699241_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_044756983.1|702164_702419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704130.1|702821_703355_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|703380_703782_+	membrane protein	NA	NA	NA	NA	NA
WP_041183663.1|704125_704368_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_044757481.1|704404_705052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|705727_707632_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_012444418.1|707895_710292_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_070344083.1|710441_711164_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|714083_714584_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|714525_716202_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|716348_717614_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|717672_718866_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|718862_719552_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_033013597.1|719657_721127_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|721146_721983_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_044756981.1|722008_723112_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|723108_726165_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|726230_726821_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|726952_728785_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|729029_729793_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862283.1|729835_731155_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|732670_733627_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756978.1|733650_736413_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_128415435.1|736412_736901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|736952_737921_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_082322932.1|739426_739597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862282.1|740157_741477_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	791965	842776	5039763	tRNA,transposase	Ralstonia_phage(36.36%)	26	NA	NA
WP_011258399.1|791965_794797_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|795111_795612_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|795699_796650_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|797163_798099_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|798098_800099_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_033013172.1|800101_800728_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|800727_801063_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_033013173.1|801412_803110_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012444470.1|803334_805581_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_044756973.1|805604_807224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756972.1|807367_812062_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.6	1.5e-24
WP_041182622.1|812065_812641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157724567.1|814219_814492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|819688_820645_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862281.1|823264_824584_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|824720_825687_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|825887_827207_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082322930.1|827273_827636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|827764_828733_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082322985.1|828784_829483_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.8	8.6e-25
WP_044756968.1|829397_830366_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.1e-99
WP_041182545.1|830441_831398_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_052658715.1|832010_833834_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_094187728.1|834877_835675_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408105.1|837562_840118_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
WP_041182545.1|841819_842776_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 9
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	870288	946737	5039763	tRNA,transposase	Bacillus_phage(18.18%)	48	NA	NA
WP_012443979.1|870288_871524_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|871574_872338_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756955.1|872404_873781_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.4e-58
WP_008578058.1|874159_874834_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_027703393.1|875464_875869_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|875947_876445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258487.1|876583_878380_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408166.1|878932_879478_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_044756954.1|879579_883701_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_044756953.1|883921_886576_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703396.1|888017_889532_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_011408171.1|889960_890473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445335.1|890535_891654_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_012445334.1|891650_891929_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|891925_892678_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_044756952.1|892674_893574_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|893657_893738_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_044756951.1|894027_896214_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_044757459.1|896531_897974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|898306_900409_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_044756947.1|900650_903095_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756946.1|903107_903632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756945.1|903833_905861_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	2.7e-95
WP_012445327.1|905874_906594_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044757457.1|906556_907507_+	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	48.8	1.4e-65
WP_011258506.1|907800_908676_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|908672_909623_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|909872_910274_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|910291_910654_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|910653_911184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|911223_913260_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_044756942.1|913373_920300_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|920307_921510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756941.1|921543_922020_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_044756940.1|922270_922894_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044757453.1|922905_923988_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_115862280.1|924120_925440_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027703766.1|930088_931153_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_027703765.1|931149_931881_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_080493519.1|931990_933949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|934091_935195_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_012445314.1|935574_935895_+	RebB family R body protein	NA	NA	NA	NA	NA
WP_011408193.1|935952_936153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703763.1|936770_939302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408196.1|939351_941193_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_011408197.1|941472_943815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258527.1|943950_945414_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_041182545.1|945780_946737_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 10
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1055705	1150297	5039763	tRNA,protease,transposase	Acidithiobacillus_phage(29.41%)	79	NA	NA
WP_012445230.1|1055705_1056941_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044756425.1|1057169_1058546_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_041182545.1|1058640_1059597_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109182069.1|1059697_1061017_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182416.1|1061200_1061884_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_012445246.1|1061900_1062935_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012445245.1|1063115_1064693_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_044757445.1|1064809_1065814_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1065813_1066368_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044756923.1|1066453_1067206_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1067292_1067499_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_012445240.1|1069009_1069654_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_044756922.1|1069643_1072145_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_044756921.1|1072141_1073746_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	6.4e-15
WP_044756920.1|1073742_1073976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445237.1|1073972_1074995_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1075331_1075697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1075693_1076284_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1076381_1078091_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1078199_1078526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1078755_1079100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1079222_1080398_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1080553_1083382_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1083442_1084543_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_012445235.1|1085011_1085539_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1085940_1086114_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1086274_1086529_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1086703_1086970_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011259046.1|1087226_1088195_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_115862279.1|1088407_1089727_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|1089843_1090641_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1091619_1091805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1091994_1093371_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_012445231.1|1093510_1093984_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1095655_1096705_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1096819_1097155_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1097443_1097734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1098624_1099743_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|1099963_1101175_+	MFS transporter	NA	NA	NA	NA	NA
WP_094187732.1|1101345_1101522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258643.1|1101737_1102193_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1102466_1103069_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1103104_1103713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1103772_1103967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258647.1|1104036_1105407_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258648.1|1106030_1108595_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|1109574_1109922_+	RidA family protein	NA	NA	NA	NA	NA
WP_011258652.1|1110084_1111155_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044756918.1|1111172_1111955_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011258654.1|1111951_1112497_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|1112493_1113789_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_094187733.1|1113785_1114745_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_027704227.1|1114669_1115920_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408297.1|1115916_1116915_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_011258658.1|1117140_1117986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|1117970_1118534_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|1118592_1118961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258660.1|1119046_1119829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445213.1|1120447_1120876_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_041182084.1|1120877_1121474_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258663.1|1121702_1123787_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|1124011_1124461_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_044756915.1|1125224_1126283_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756914.1|1126554_1127952_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011258667.1|1127948_1128926_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258668.1|1129107_1131045_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1132317_1133094_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1133098_1133773_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_044756913.1|1135408_1136785_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011408311.1|1136824_1137220_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_044756912.1|1137262_1138738_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.8	3.7e-102
WP_011408313.1|1139536_1139953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1139966_1140137_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258677.1|1144222_1145539_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|1145706_1146309_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044757443.1|1146382_1146829_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|1146906_1147173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749647.1|1147401_1148778_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044749647.1|1148920_1150297_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 11
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1179323	1259840	5039763	coat,transposase	Streptococcus_phage(15.38%)	58	NA	NA
WP_011258703.1|1179323_1180358_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756903.1|1180354_1182706_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_044756902.1|1182722_1183493_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033003618.1|1183501_1184026_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011258707.1|1184345_1185122_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011408332.1|1185118_1187728_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_012445174.1|1187744_1188941_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_011408334.1|1189403_1189760_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_011408335.1|1189756_1190257_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_044756901.1|1190261_1191392_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011258712.1|1191686_1193381_+	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_094187734.1|1193449_1194556_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011258714.1|1194932_1197059_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012445169.1|1198438_1200856_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_033013399.1|1200951_1201488_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011258717.1|1201943_1204187_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.1e-81
WP_011258718.1|1204247_1205099_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012445167.1|1205220_1205661_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703877.1|1207184_1208378_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258722.1|1208384_1209965_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703878.1|1210015_1210750_+	serine hydrolase	NA	NA	NA	NA	NA
WP_094187735.1|1210746_1211510_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258724.1|1211704_1211953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862278.1|1213398_1214364_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258728.1|1215464_1215728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258729.1|1215970_1216963_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_011258730.1|1216999_1218916_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_011258731.1|1219313_1220003_-	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.2	5.4e-11
WP_011258732.1|1220268_1222062_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258733.1|1222099_1222576_-	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_011258734.1|1223288_1223792_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.6	3.4e-23
WP_011258735.1|1223852_1224284_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_011258736.1|1224297_1224573_+	RnfH family protein	NA	NA	NA	NA	NA
WP_011258737.1|1224919_1225315_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011408351.1|1225419_1225830_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_012445154.1|1226272_1227937_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011258740.1|1228053_1229106_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_011258741.1|1229206_1229725_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011258742.1|1229866_1231792_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	7.6e-148
WP_011258743.1|1231951_1233082_+	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_011408355.1|1233610_1234519_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_011408356.1|1234515_1235637_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_044756897.1|1237659_1238586_-	TolC family protein	NA	NA	NA	NA	NA
WP_044756896.1|1238715_1239321_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|1239659_1241429_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_082352960.1|1241425_1242019_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	1.4e-15
WP_044756895.1|1242286_1242880_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_011258752.1|1243078_1244515_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_044756893.1|1244756_1245959_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|1246001_1248830_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011258755.1|1249010_1249943_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012445147.1|1249939_1251436_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|1251774_1252038_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|1252317_1252818_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|1253064_1254432_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_094187736.1|1257455_1258218_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296746.1|1258178_1258322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1258883_1259840_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 12
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1290511	1402400	5039763	tRNA,transposase	uncultured_Mediterranean_phage(27.27%)	67	NA	NA
WP_011258442.1|1290511_1291747_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012445118.1|1291931_1292900_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_094187737.1|1293731_1294484_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181957.1|1294485_1295451_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|1297646_1298603_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258799.1|1300616_1300799_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_044756879.1|1300947_1302147_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_041182545.1|1302271_1303228_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756878.1|1303551_1304766_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	6.2e-55
WP_094187738.1|1308551_1309654_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_027704061.1|1309840_1310308_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|1311438_1312788_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_011259046.1|1313341_1314310_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258824.1|1314373_1314958_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|1315057_1316071_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|1316761_1317028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182103.1|1317271_1317367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756872.1|1320865_1321165_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	2.5e-45
WP_041182100.1|1321168_1321363_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_082356333.1|1321631_1325234_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_144408326.1|1328426_1331825_-	avirulence protein	NA	NA	NA	NA	NA
WP_115862276.1|1332029_1333349_-|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_011408651.1|1334593_1336498_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_011259148.1|1336738_1337359_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011259147.1|1337355_1337862_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011408650.1|1337920_1338406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444765.1|1338637_1338922_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408648.1|1338918_1340712_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_011259143.1|1340718_1341750_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187735.1|1342029_1342793_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259142.1|1343189_1343822_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_103057211.1|1344014_1344440_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408645.1|1346706_1347828_+	phytase	NA	NA	NA	NA	NA
WP_041182545.1|1349290_1350247_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011408814.1|1351761_1352076_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_157724569.1|1352008_1352962_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082341208.1|1353550_1356142_+	avirulence protein	NA	NA	NA	NA	NA
WP_011259405.1|1360479_1361409_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756864.1|1361405_1364240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|1364268_1364997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756862.1|1365021_1367364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1367977_1368934_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044749647.1|1369093_1370470_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_011258529.1|1371073_1372042_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011259129.1|1374208_1374916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259128.1|1375260_1376757_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259127.1|1376880_1377312_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703908.1|1377477_1378548_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259125.1|1378617_1379763_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_011259124.1|1379894_1380248_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259123.1|1380444_1382289_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259122.1|1382383_1383352_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011408636.1|1383432_1383795_-	recombinase	NA	NA	NA	NA	NA
WP_115862275.1|1386412_1387801_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082341214.1|1388050_1389235_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_044756859.1|1389285_1390347_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862274.1|1390583_1391903_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187739.1|1391973_1392615_-	ribonuclease T	NA	NA	NA	NA	NA
WP_012444782.1|1392892_1393288_-	RcnB family protein	NA	NA	NA	NA	NA
WP_011408630.1|1393420_1394131_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259114.1|1394259_1395090_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011259113.1|1395112_1395982_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259112.1|1395981_1396956_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_012444785.1|1397068_1398160_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_094187823.1|1398345_1399419_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_012444787.1|1399553_1400804_-	porin	NA	NA	NA	NA	NA
WP_094187715.1|1401637_1402400_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1471759	1559379	5039763	protease,transposase	Acidithiobacillus_phage(25.0%)	49	NA	NA
WP_044749647.1|1471759_1473136_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044756851.1|1473491_1481630_+	outer membrane protein	NA	NA	NA	NA	NA
WP_011259043.1|1481906_1482518_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027703759.1|1482514_1483537_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408577.1|1483655_1485140_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408576.1|1485136_1488229_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011408575.1|1488221_1489337_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444836.1|1489835_1492571_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_011259038.1|1493402_1494779_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.6e-62
WP_011408569.1|1497338_1498517_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
WP_044756849.1|1498554_1499475_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011259033.1|1501462_1501948_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011259032.1|1501983_1502799_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	2.1e-30
WP_011408566.1|1502795_1503638_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011259030.1|1503816_1504197_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_011259028.1|1505865_1506210_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011408564.1|1506213_1506837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408563.1|1507071_1509027_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259025.1|1509460_1512073_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_075240030.1|1512065_1512323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408561.1|1512332_1513895_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
WP_027703349.1|1514139_1515996_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041182436.1|1517322_1519512_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_044756846.1|1519640_1521419_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_011408557.1|1522620_1523229_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044756845.1|1523559_1523748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|1523931_1524246_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756844.1|1524296_1525130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756843.1|1525196_1525697_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044757420.1|1525788_1526367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|1526528_1527029_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_070344118.1|1527340_1528441_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_011259011.1|1528543_1529257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703343.1|1529508_1529748_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259009.1|1532204_1532690_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_011408551.1|1532840_1533620_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012444869.1|1533808_1535689_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_044756840.1|1536022_1537540_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_044756839.1|1537676_1538312_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_044756838.1|1538740_1539874_-	phospholipase A	NA	NA	NA	NA	NA
WP_011259000.1|1543217_1544192_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_027704049.1|1544358_1544592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704112.1|1548407_1548926_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.7	6.8e-27
WP_115862273.1|1550659_1551979_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444880.1|1552029_1552434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256634.1|1553007_1554132_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.6e-15
WP_012444882.1|1554128_1556357_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_044756833.1|1556438_1557653_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_070344088.1|1557903_1559379_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.7	4.3e-98
>prophage 14
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1573798	1640566	5039763	transposase	uncultured_Caudovirales_phage(26.67%)	54	NA	NA
WP_115862273.1|1573798_1575118_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444880.1|1575168_1575573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444882.1|1577266_1579495_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_044756833.1|1579576_1580791_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_044756832.1|1581041_1582517_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.7	4.3e-98
WP_012444885.1|1582567_1583587_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027703901.1|1583870_1585451_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_027703900.1|1586661_1587009_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012444889.1|1587005_1587536_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_012444890.1|1587546_1587960_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_012444891.1|1587956_1588682_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	3.1e-86
WP_044756831.1|1588700_1590005_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	58.9	2.0e-128
WP_026144156.1|1590268_1590625_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012444894.1|1591620_1594581_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_044756830.1|1595575_1598971_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_011258994.1|1599185_1599566_-	response regulator	NA	NA	NA	NA	NA
WP_012444899.1|1599833_1600010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703995.1|1600581_1600785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|1600827_1601590_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756829.1|1601624_1603001_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_011408535.1|1603221_1603881_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011258990.1|1603936_1605853_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011258989.1|1605955_1606675_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258988.1|1606671_1607679_-	glucokinase	NA	NA	NA	NA	NA
WP_011408534.1|1607675_1609106_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258986.1|1609535_1610633_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408533.1|1610761_1611634_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_012444907.1|1611577_1611844_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011258985.1|1611903_1612299_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011258984.1|1612295_1612682_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_012444909.1|1612716_1614507_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_012444910.1|1614510_1614720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408532.1|1614736_1615519_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_044756828.1|1615629_1615878_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_014503500.1|1615828_1616281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010378794.1|1616304_1617546_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011258980.1|1617538_1618273_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_115862272.1|1619666_1620632_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408527.1|1620885_1623294_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_011408526.1|1623322_1623985_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011258975.1|1623988_1624453_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011258974.1|1624449_1626219_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258973.1|1626215_1627256_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_069960087.1|1627525_1628326_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258971.1|1628322_1628787_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_094187740.1|1628729_1630229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258969.1|1630225_1632082_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258968.1|1632081_1632714_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444921.1|1633188_1633695_-	glyoxalase	NA	NA	NA	NA	NA
WP_044756826.1|1633861_1634761_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	9.7e-37
WP_041182545.1|1635812_1636769_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011409560.1|1637581_1638544_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187741.1|1639722_1640370_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	6.5e-27
WP_012444927.1|1640389_1640566_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1645756	1713112	5039763	tRNA,transposase	Xanthomonas_phage(57.14%)	50	NA	NA
WP_094187715.1|1645756_1646520_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408491.1|1650587_1650887_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_012444931.1|1650890_1651085_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_044756822.1|1651352_1654649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756821.1|1655177_1655957_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|1655998_1656097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|1656720_1656903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|1657024_1657336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187742.1|1657369_1658115_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|1658115_1659072_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012444939.1|1659178_1659904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013458.1|1659893_1661759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057499.1|1662036_1662789_+	Type II secretory pathway, component ExeA	NA	NA	NA	NA	NA
WP_113022320.1|1663325_1664252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144408324.1|1667585_1671080_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_012444931.1|1671348_1671543_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408491.1|1671546_1671846_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_044756818.1|1672069_1675924_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258948.1|1676509_1677130_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_011258947.1|1677119_1677896_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258946.1|1677889_1678624_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258945.1|1678620_1679223_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258944.1|1679219_1680347_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_027703958.1|1680343_1681435_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258942.1|1681431_1682727_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011258941.1|1682723_1683638_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258940.1|1683647_1683974_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_094187743.1|1684287_1685085_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444952.1|1685591_1687004_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_113224536.1|1687045_1687270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182115.1|1688268_1689012_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_011258935.1|1689114_1690419_-	threonine synthase	NA	NA	NA	NA	NA
WP_024710669.1|1690580_1690895_+	EthD family reductase	NA	NA	NA	NA	NA
WP_011258933.1|1693841_1694810_-	homoserine kinase	NA	NA	NA	NA	NA
WP_011408482.1|1694806_1697314_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_153296743.1|1697407_1697575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756815.1|1698616_1700149_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408481.1|1700737_1701022_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_027703856.1|1701018_1701792_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011258927.1|1701797_1702853_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011408479.1|1702849_1703902_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_094187825.1|1703937_1704807_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012444969.1|1704997_1705132_+	aspartate racemase	NA	NA	NA	NA	NA
WP_082322979.1|1705691_1706648_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.1	3.7e-42
WP_094187744.1|1706810_1707974_+	MFS transporter	NA	NA	NA	NA	NA
WP_011408475.1|1708114_1708846_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011408474.1|1708826_1710092_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_094187745.1|1710209_1711439_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011258919.1|1711435_1712002_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011258918.1|1712053_1713112_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1809817	1857067	5039763	tRNA,protease,transposase	Ralstonia_phage(11.11%)	32	NA	NA
WP_011258802.1|1809817_1810786_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075239722.1|1811659_1812817_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181928.1|1813093_1814059_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115862270.1|1815629_1816949_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_157724571.1|1820323_1820620_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756800.1|1821216_1822275_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011259163.1|1822471_1823692_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|1824006_1825404_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|1825414_1826635_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_044756799.1|1826631_1827270_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|1827340_1828201_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|1828197_1828986_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|1828996_1830202_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|1830220_1830646_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|1830865_1831498_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|1831522_1833895_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|1834052_1835258_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|1835578_1836910_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|1836906_1837257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|1837288_1837696_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|1837692_1838019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|1838050_1839427_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_070344119.1|1839663_1843830_+	type III effector	NA	NA	NA	NA	NA
WP_011259178.1|1843942_1844572_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|1844678_1846607_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|1846769_1849130_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|1849413_1850382_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|1850439_1851561_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|1852988_1853741_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|1853821_1854040_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011408664.1|1854320_1856603_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_005914463.1|1856746_1857067_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
>prophage 17
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	1939035	2008362	5039763	tRNA,transposase	Leptospira_phage(18.18%)	44	NA	NA
WP_041182545.1|1939035_1939992_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_144408323.1|1939966_1940257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076659600.1|1942423_1946461_-	type IV secretion protein Rhs	NA	S5W9C6	Leptospira_phage	36.8	6.8e-13
WP_082322907.1|1947735_1952706_-	glutamate synthase	NA	NA	NA	NA	NA
WP_128415342.1|1955478_1955958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756786.1|1956166_1959235_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.1	9.6e-60
WP_011259260.1|1964091_1964484_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|1964492_1964954_+	cytochrome c	NA	NA	NA	NA	NA
WP_011408704.1|1965458_1965689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264955.1|1966254_1966509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749647.1|1967518_1968895_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_115801893.1|1969000_1969966_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408707.1|1969972_1971271_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|1971439_1973125_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|1973121_1974858_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_044756785.1|1975009_1976110_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259267.1|1976158_1976422_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259269.1|1976800_1976911_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_044756783.1|1977131_1978397_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756781.1|1978377_1980291_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|1980658_1981903_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_044756780.1|1982191_1983346_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.2	1.0e-46
WP_011259275.1|1983359_1983620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187751.1|1983619_1983988_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|1983984_1985280_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_044756779.1|1985403_1986354_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_044756778.1|1986966_1988310_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|1988349_1989450_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|1989455_1989908_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|1990149_1991391_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|1991462_1992488_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|1992800_1993295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259285.1|1993465_1994896_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|1995393_1995831_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|1995827_1997078_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|1997145_1998207_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075239108.1|1998349_1999378_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_027703612.1|1999468_1999750_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011259290.1|1999746_2001096_+	dihydroorotase	NA	NA	NA	NA	NA
WP_094187752.1|2001035_2001935_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_011259294.1|2002806_2003070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2003441_2003930_-	general stress protein	NA	NA	NA	NA	NA
WP_011258529.1|2005608_2006577_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_094187753.1|2007564_2008362_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2038318	2077609	5039763	tRNA,protease,transposase	Staphylococcus_prophage(22.22%)	33	NA	NA
WP_069970072.1|2038318_2039275_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_012444707.1|2039470_2041540_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2041639_2042518_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_044756773.1|2042615_2043515_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2043602_2044343_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2044502_2045078_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2045251_2046223_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_041182163.1|2046256_2047204_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2047203_2049081_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2049218_2050952_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2051004_2051505_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2051501_2052989_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011408752.1|2053013_2054081_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011408753.1|2054226_2055564_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011259340.1|2055859_2057122_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2057338_2058086_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2058402_2060238_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_011408756.1|2060509_2061601_+	ribonuclease D	NA	NA	NA	NA	NA
WP_027703935.1|2061697_2062066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408757.1|2061929_2062280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2062693_2063095_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011259346.1|2063601_2063736_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015463309.1|2063958_2064138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2064739_2065030_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2065017_2065296_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2065780_2065969_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041182719.1|2066229_2067186_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_012445118.1|2067587_2068556_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011408397.1|2068959_2070144_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181970.1|2070724_2071690_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408763.1|2076182_2076599_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2076809_2077136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2077168_2077609_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
>prophage 19
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2084820	2259819	5039763	tRNA,transposase	uncultured_Caudovirales_phage(26.67%)	109	NA	NA
WP_044756769.1|2084820_2086275_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2086698_2087685_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2088096_2088759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703624.1|2088813_2089299_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2089298_2089817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444677.1|2089911_2090790_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2090786_2092067_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2092082_2093084_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033013286.1|2093235_2094600_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041182453.1|2094854_2095265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259369.1|2095420_2096251_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2096570_2097818_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259371.1|2097963_2099475_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2099461_2101048_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2101044_2102247_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115801894.1|2102753_2104073_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2104376_2105762_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2106669_2108049_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2108048_2109365_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012444665.1|2109501_2110746_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
WP_094187755.1|2112638_2112947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2112906_2115255_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2115251_2116097_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_044756766.1|2116103_2117858_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_041182645.1|2118000_2118333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259384.1|2118387_2119740_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|2119800_2122938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2123104_2123959_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_044756765.1|2124129_2125434_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_027703773.1|2125575_2129670_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_027703772.1|2129703_2130690_+	response regulator	NA	W8CYM9	Bacillus_phage	27.6	9.7e-06
WP_044756764.1|2130814_2131798_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	1.6e-96
WP_044756763.1|2132246_2137271_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_027703873.1|2137548_2138208_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444649.1|2138222_2139527_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444648.1|2139539_2142710_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011257851.1|2143685_2144651_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2145357_2146353_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_041182172.1|2146513_2149030_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2149026_2149983_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_011259402.1|2150141_2151884_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011408800.1|2152201_2153338_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|2154004_2154973_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862268.1|2155172_2156561_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2156806_2157763_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_041182640.1|2159842_2160577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444638.1|2160601_2163439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444637.1|2163435_2164365_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041182637.1|2172018_2172408_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|2172568_2173522_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2173454_2173769_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_115862267.1|2173996_2175316_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_070344089.1|2176420_2176837_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_094187756.1|2176833_2177139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187832.1|2177080_2177458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2177716_2178673_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011407913.1|2178854_2180069_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_157724574.1|2180031_2180880_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.6	1.1e-21
WP_094187833.1|2182347_2185389_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2186438_2186891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2187145_2188951_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|2188952_2189300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|2189375_2190083_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|2190234_2190627_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075242238.1|2190649_2191165_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|2191161_2191515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|2191603_2192344_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|2192350_2193325_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|2193326_2194109_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|2194105_2195128_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|2195228_2195537_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2195533_2195899_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|2195932_2197942_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|2198109_2198364_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103073514.1|2200046_2200733_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408833.1|2201048_2201810_+	transporter	NA	NA	NA	NA	NA
WP_044756756.1|2201823_2204166_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_094187736.1|2204590_2205354_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756755.1|2206683_2208930_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_044757392.1|2209658_2211770_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	2.5e-14
WP_044757389.1|2212453_2214529_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_044756753.1|2215122_2217384_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|2217777_2220039_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_113255743.1|2220717_2220927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259433.1|2220996_2221794_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|2221929_2222412_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187758.1|2223259_2224057_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187834.1|2224277_2224622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187759.1|2224700_2227091_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.8e-09
WP_011408845.1|2227343_2228210_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011259439.1|2228206_2228803_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011259440.1|2228799_2229876_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011408846.1|2229984_2232228_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259442.1|2232883_2233699_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012444596.1|2234052_2236644_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259444.1|2236709_2237120_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003486316.1|2237116_2237365_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044756750.1|2237512_2240281_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011259449.1|2240930_2242613_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_011408848.1|2242789_2243659_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259451.1|2243670_2245848_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408849.1|2246212_2247349_-	two-component system response regulator	NA	NA	NA	NA	NA
WP_044756749.1|2247490_2249008_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	2.3e-86
WP_014503214.1|2249211_2250337_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_044756748.1|2250590_2251538_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259457.1|2254345_2255047_+|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_011408855.1|2255207_2255585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2255879_2256836_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_109182069.1|2258499_2259819_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2306897	2318672	5039763	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|2306897_2307197_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|2307239_2307470_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|2307713_2308463_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_044756743.1|2308467_2309163_-	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_157724576.1|2309098_2309311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|2309348_2309648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057523.1|2310035_2310563_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_003481884.1|2311165_2311378_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_044756742.1|2311517_2314166_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|2314267_2314756_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|2315058_2316093_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|2316265_2316907_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|2316995_2318672_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 21
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2394911	2442044	5039763	transposase,plate	Acidithiobacillus_phage(25.0%)	29	NA	NA
WP_012444515.1|2394911_2396387_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_044756728.1|2396469_2399058_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_044756726.1|2399114_2400227_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756724.1|2400351_2400930_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756721.1|2402430_2404518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756720.1|2404903_2406001_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757380.1|2406417_2409498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|2412533_2413241_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|2413237_2414230_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_044756719.1|2414226_2416686_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|2416799_2417780_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444505.1|2417788_2418817_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012444504.1|2418989_2419316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756718.1|2419312_2422216_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|2422212_2422935_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_027703481.1|2422931_2423579_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_044756717.1|2423575_2427034_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_044756716.1|2427037_2428354_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_044756715.1|2428355_2429693_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_044756713.1|2429689_2431108_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|2431104_2431644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|2431652_2433590_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|2433854_2434313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|2434701_2435196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|2435261_2435759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756710.1|2435947_2438653_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_044756708.1|2438685_2439696_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012444494.1|2439659_2441537_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|2441540_2442044_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 22
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2448351	2503285	5039763	transposase	Staphylococcus_prophage(57.14%)	42	NA	NA
WP_011257031.1|2448351_2449320_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_044756703.1|2449468_2450704_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2450723_2451680_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756701.1|2451732_2453724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|2453741_2454488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2454776_2455733_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044749647.1|2455827_2457204_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044756990.1|2457659_2458616_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_042465604.1|2460520_2461264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756697.1|2461294_2464129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182192.1|2464786_2466610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408965.1|2466623_2467223_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_011408966.1|2467311_2467668_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011259617.1|2467664_2468087_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|2468102_2468336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408968.1|2468362_2468623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182194.1|2468971_2470762_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011259619.1|2470794_2471781_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_044756696.1|2472191_2475893_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|2476418_2477182_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|2477285_2477933_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|2478154_2478916_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408974.1|2479015_2479381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|2479439_2479871_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|2479882_2481145_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_044756695.1|2481128_2482421_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_044757376.1|2482790_2483561_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011257310.1|2484317_2485553_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|2486851_2487109_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|2487548_2488532_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_044756692.1|2488784_2489747_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|2490186_2490366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862266.1|2490730_2491696_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259636.1|2492903_2493881_+	siroheme synthase	NA	NA	NA	NA	NA
WP_012445407.1|2494689_2494884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|2496277_2496640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|2496623_2497193_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_012445412.1|2497230_2498484_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|2498689_2499067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|2499391_2500348_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_115862265.1|2500682_2501648_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187766.1|2502487_2503285_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2647399	2707722	5039763	tRNA,protease,transposase	Burkholderia_virus(12.5%)	51	NA	NA
WP_094187736.1|2647399_2648163_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|2648995_2649241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|2649186_2651553_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|2651549_2652224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|2652433_2653372_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_044756626.1|2653494_2654844_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|2654840_2655728_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|2656045_2656852_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_044756624.1|2657297_2658515_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|2658620_2659589_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|2659966_2660635_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|2660631_2661405_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_094187839.1|2661978_2664045_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|2664611_2665637_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|2665721_2666795_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|2666787_2667891_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|2667901_2668828_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|2668908_2669559_+	SCO family protein	NA	NA	NA	NA	NA
WP_011409071.1|2669555_2670404_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|2670954_2672538_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_082322897.1|2673748_2674612_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.3	5.3e-32
WP_153296738.1|2675129_2675417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029217681.1|2675527_2676034_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|2676155_2677556_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|2677818_2678394_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|2678390_2678825_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|2678852_2679020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|2679643_2679829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|2679863_2680433_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|2680525_2681377_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|2682764_2684780_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|2685050_2685749_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|2685789_2686197_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_044756618.1|2686634_2687597_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|2688880_2690131_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|2690138_2691383_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|2691610_2692090_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|2692200_2692737_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|2692846_2693596_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|2693803_2694295_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|2695408_2696728_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_044756616.1|2696871_2698578_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_044756614.1|2698611_2699916_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|2699947_2700208_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_044756613.1|2700209_2701085_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|2702931_2703396_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|2703447_2703636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959944.1|2703608_2703929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445571.1|2703925_2705293_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_044756609.1|2705438_2706020_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|2706276_2707722_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 24
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2715658	2783653	5039763	tRNA,transposase	Ralstonia_phage(37.5%)	52	NA	NA
WP_109182069.1|2715658_2716978_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2717190_2718159_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187763.1|2718443_2719241_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445578.1|2719540_2722654_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756605.1|2724069_2724540_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445580.1|2725124_2725304_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|2725629_2726745_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|2726756_2727173_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027703805.1|2727229_2728129_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|2728125_2729154_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_044756603.1|2729176_2729812_-	lipoprotein	NA	NA	NA	NA	NA
WP_011259825.1|2730325_2732968_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|2733040_2733652_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|2733856_2734714_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|2734969_2735419_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_157724579.1|2735718_2736684_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2736808_2737571_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756598.1|2738181_2738475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|2738948_2739182_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|2739215_2740229_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|2740196_2740388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862264.1|2740478_2741798_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|2741885_2743100_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_012445397.1|2743436_2744405_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_115862263.1|2744930_2745896_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|2746020_2746783_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|2747085_2749218_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258803.1|2749768_2750737_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_157724581.1|2750881_2751847_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409560.1|2751956_2752919_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|2752973_2753306_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|2753302_2754066_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|2754937_2755735_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|2755768_2756161_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|2756251_2756644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445601.1|2761109_2762894_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|2763084_2763285_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|2763820_2764615_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|2764916_2765675_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|2765750_2767613_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|2767670_2768012_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|2768271_2768547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187763.1|2770376_2771175_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259859.1|2772452_2773166_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|2773226_2773649_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_041182545.1|2774139_2775096_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187772.1|2775129_2776752_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182545.1|2776745_2777702_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756585.1|2778261_2778567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409134.1|2780428_2781340_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_033013519.1|2781855_2781993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182116.1|2782687_2783653_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2821769	2896706	5039763	transposase,plate	Liberibacter_phage(18.18%)	48	NA	NA
WP_082323169.1|2821769_2822750_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109182069.1|2822841_2824161_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2824360_2825328_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011259891.1|2826433_2828539_+	catalase	NA	A0A2K9L572	Tupanvirus	48.1	5.1e-137
WP_042465674.1|2829363_2830602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756566.1|2830829_2832962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259894.1|2833078_2835220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259895.1|2836052_2836778_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259896.1|2836909_2837371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|2839485_2841606_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|2841872_2842718_-	transporter	NA	NA	NA	NA	NA
WP_012445636.1|2843127_2843337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259903.1|2843842_2845813_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|2846241_2847639_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|2847751_2848570_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_094187840.1|2848880_2852078_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	1.7e-80
WP_011259908.1|2852313_2853732_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_082348427.1|2853741_2854344_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259910.1|2854393_2854999_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|2855148_2855370_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044756564.1|2855379_2855805_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	47.0	1.7e-07
WP_143690655.1|2856198_2856393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409168.1|2858313_2858943_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|2859003_2859759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757351.1|2860114_2860864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756561.1|2861271_2862846_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|2863094_2863361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756559.1|2863639_2866819_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.9	1.4e-74
WP_094187841.1|2866818_2867970_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044756558.1|2868385_2868820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|2868830_2870360_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|2870662_2871655_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|2871707_2872016_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044756556.1|2872596_2876070_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_044756555.1|2876209_2877208_+	Abi family protein	NA	NA	NA	NA	NA
WP_044756553.1|2877254_2878799_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	24.1	4.0e-14
WP_094187842.1|2879277_2880132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756551.1|2880165_2880474_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|2880480_2880744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756549.1|2881465_2882221_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_044756548.1|2882514_2883534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756547.1|2883538_2886406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052658684.1|2886424_2887330_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011259938.1|2890125_2890479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|2890509_2893239_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_012445670.1|2893324_2894416_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014502420.1|2894379_2896215_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259942.1|2896217_2896706_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 26
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2901174	2975627	5039763	transposase,plate	Staphylococcus_prophage(25.0%)	49	NA	NA
WP_011409207.1|2901174_2902509_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_044756542.1|2902508_2903297_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_157724583.1|2906020_2906725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|2906772_2907729_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_141062009.1|2907970_2908606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082322889.1|2908614_2911074_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_082322887.1|2911133_2912612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756538.1|2912608_2913688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070344099.1|2914672_2915461_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_044756533.1|2918032_2921074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183127.1|2921235_2921799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187774.1|2921889_2922991_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_011259961.1|2924259_2924649_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_044757342.1|2926859_2927408_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_094187763.1|2927997_2928796_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756527.1|2929269_2929884_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044756525.1|2929876_2930701_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756524.1|2930697_2933367_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	5.1e-41
WP_011409215.1|2933552_2934515_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
WP_041182545.1|2935228_2936185_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011259969.1|2938676_2939222_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_075239710.1|2939303_2941046_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011409218.1|2941132_2941612_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075240218.1|2941635_2942100_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011409221.1|2942096_2942993_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_059317432.1|2945840_2946797_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	33.7	8.2e-18
WP_075242163.1|2946853_2947420_-	DNA repair protein	NA	NA	NA	NA	NA
WP_044756518.1|2947487_2948447_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_070344101.1|2948594_2951660_-	DNA repair protein	NA	NA	NA	NA	NA
WP_070344121.1|2951646_2954586_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.8	2.0e-54
WP_011409224.1|2955569_2956643_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_041182249.1|2956695_2957514_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011259979.1|2957510_2958494_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069964588.1|2958490_2962228_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_044756512.1|2962243_2963725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409228.1|2963784_2964045_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011259982.1|2964154_2965033_-	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	35.5	1.3e-06
WP_011409229.1|2965232_2965973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153303321.1|2966010_2966166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409230.1|2966989_2968192_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_011259987.1|2968808_2969093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259988.1|2969089_2969269_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_011259989.1|2969399_2970197_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011259990.1|2970260_2970935_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011259991.1|2970937_2971342_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259992.1|2971405_2972587_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_010371538.1|2972937_2973579_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011259994.1|2973578_2974775_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_094187731.1|2974829_2975627_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	2992927	3003754	5039763	transposase	Burkholderia_virus(28.57%)	8	NA	NA
WP_042465718.1|2992927_2993731_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_027703308.1|2994161_2994344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757335.1|2994811_2997766_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.1	8.1e-258
WP_011260010.1|2998095_2998545_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_011260011.1|2998541_2999237_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_044756504.1|2999244_3000315_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	9.7e-60
WP_011409252.1|3000311_3001397_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_082322974.1|3002797_3003754_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	3.1e-41
>prophage 28
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	3060678	3124751	5039763	tRNA,transposase	Bacillus_phage(16.67%)	58	NA	NA
WP_012444282.1|3060678_3061152_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_027703427.1|3061359_3063057_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.2	5.3e-28
WP_011260065.1|3066510_3067596_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_011260066.1|3067660_3068215_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_011409271.1|3068401_3068821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703428.1|3068935_3069160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187763.1|3069363_3070161_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260068.1|3070075_3071563_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_011409274.1|3071559_3071865_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_041182254.1|3071988_3072564_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011260071.1|3072560_3072911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703741.1|3072916_3073402_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_069964782.1|3073799_3074897_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_044756490.1|3075042_3077382_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011409277.1|3077750_3078326_+	nitroreductase	NA	NA	NA	NA	NA
WP_011260078.1|3078322_3079309_+	exodeoxyribonuclease IX	NA	A0A2H4IAS6	Erwinia_phage	27.0	2.8e-13
WP_011260079.1|3079305_3079857_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011260080.1|3079837_3080635_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_011260081.1|3080835_3081777_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_041182255.1|3081865_3082171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703739.1|3082284_3082662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260082.1|3082672_3082999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260083.1|3083042_3083441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260084.1|3083678_3084524_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010381556.1|3084725_3085289_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011409282.1|3085484_3087077_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
WP_011260086.1|3087168_3088110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409284.1|3088536_3088968_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_012444266.1|3089030_3089999_+	transaldolase	NA	NA	NA	NA	NA
WP_109182002.1|3090662_3091628_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260092.1|3093061_3093640_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011409288.1|3094055_3094706_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_044756485.1|3096800_3097508_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_094187801.1|3098627_3099425_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187708.1|3099479_3100277_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260134.1|3100274_3101105_+	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_011409313.1|3101101_3101566_+	response regulator	NA	NA	NA	NA	NA
WP_012444257.1|3101680_3101917_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_012444256.1|3101918_3102560_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011260138.1|3102963_3104703_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_094187715.1|3105792_3106556_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157724585.1|3106760_3106964_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042465204.1|3108088_3108289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057260.1|3108423_3109125_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011409317.1|3109481_3109892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409318.1|3109891_3110452_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011409319.1|3110488_3111532_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_012444247.1|3111853_3112963_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011409321.1|3113157_3114063_+	gluconolactonase	NA	NA	NA	NA	NA
WP_027703838.1|3114145_3114868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409323.1|3115067_3115475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260149.1|3115602_3116076_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409324.1|3116121_3116949_+	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_011260151.1|3117032_3118502_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_044756484.1|3118704_3120183_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.4e-40
WP_011409327.1|3120367_3121369_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070344102.1|3121805_3122702_-	gallate dioxygenase	NA	NA	NA	NA	NA
WP_109182116.1|3123785_3124751_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	3256553	3378362	5039763	transposase	Acidithiobacillus_phage(14.29%)	83	NA	NA
WP_044749647.1|3256553_3257930_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_011260269.1|3258181_3259012_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011409400.1|3259713_3260823_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	8.6e-35
WP_011260271.1|3260887_3261163_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011260272.1|3262284_3263385_-	glycosyltransferase	NA	A0A142BZU7	Faustovirus	27.6	2.8e-14
WP_042465749.1|3263523_3264243_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012444157.1|3264239_3265739_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	3.3e-13
WP_024712625.1|3265771_3266698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409406.1|3266697_3267264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409407.1|3267665_3268151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187846.1|3269066_3270674_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239943.1|3270835_3271099_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075239687.1|3271103_3271742_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	1.9e-10
WP_012444151.1|3271928_3273293_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_012444150.1|3273508_3274204_+	VIT family protein	NA	NA	NA	NA	NA
WP_024712536.1|3274298_3274922_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_094187847.1|3275123_3275864_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|3275957_3276608_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|3276699_3277515_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|3277564_3278302_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|3280230_3281220_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_044756446.1|3281342_3283916_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_041182545.1|3284128_3285085_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012444143.1|3285728_3285995_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_044749647.1|3287104_3288481_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_094187776.1|3288490_3289244_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187777.1|3289297_3290096_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_144408318.1|3290833_3291178_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011260292.1|3291742_3292975_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_094187715.1|3293807_3294571_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182013.1|3298579_3299545_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|3300006_3300237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|3300861_3302904_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|3302905_3304804_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|3304805_3306059_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_044756435.1|3306055_3306661_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_044756434.1|3307080_3308235_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|3308237_3309266_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_012444129.1|3309272_3310340_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703724.1|3310380_3311658_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_044756432.1|3311702_3312470_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|3312684_3313851_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260307.1|3319466_3322157_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260311.1|3325558_3326743_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011260312.1|3326810_3327548_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|3327716_3328232_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|3328323_3329826_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|3329829_3330270_-	response regulator	NA	NA	NA	NA	NA
WP_012444117.1|3330266_3332078_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|3332363_3332726_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|3332885_3333938_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|3334276_3335218_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_027703464.1|3335238_3336576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|3336747_3337128_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|3337252_3338014_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|3340271_3341675_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|3341797_3342853_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_094187848.1|3343025_3343880_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|3344171_3346355_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_044756429.1|3346754_3347768_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_027703467.1|3347782_3348481_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|3348468_3348747_-	YbeD family protein	NA	NA	NA	NA	NA
WP_044756427.1|3349813_3351019_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.6	6.0e-66
WP_011260335.1|3351519_3352935_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|3352931_3354071_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011258529.1|3355277_3356246_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_143690657.1|3356456_3356753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756425.1|3356924_3358301_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_011409552.1|3359007_3359970_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115862310.1|3359849_3361985_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_012444102.1|3361981_3363061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242513.1|3363057_3363543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756423.1|3364496_3365576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322882.1|3365572_3367057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444101.1|3367116_3368103_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011260340.1|3368864_3369983_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_012444099.1|3369979_3372040_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_044756419.1|3372043_3372529_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_044756417.1|3372525_3373872_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012444096.1|3374044_3375091_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_044756415.1|3375367_3376300_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_011258802.1|3376540_3377509_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187721.1|3377564_3378362_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	3492395	3586329	5039763	tRNA,transposase	Ralstonia_phage(33.33%)	82	NA	NA
WP_157724587.1|3492395_3493361_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|3493893_3494274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187783.1|3494476_3495382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703939.1|3495450_3496746_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_094187850.1|3496836_3497400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|3497825_3499091_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_027703938.1|3499087_3500065_-	uroporphyrin-III methyltransferase	NA	NA	NA	NA	NA
WP_012444011.1|3500168_3500972_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|3501147_3501957_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_094187728.1|3501964_3502763_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187851.1|3502805_3503453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|3503547_3504123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258188.1|3504326_3505295_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260446.1|3505420_3506173_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_044756370.1|3506210_3506651_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|3506846_3507803_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011409547.1|3507915_3508257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|3508482_3508860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|3509070_3509268_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_012444006.1|3509574_3510321_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258802.1|3510542_3511511_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756368.1|3511573_3512380_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|3512603_3514016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703925.1|3514012_3515110_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187728.1|3515264_3516063_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182294.1|3516282_3517245_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|3517921_3518698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704068.1|3518694_3520011_+	amino acid permease	NA	NA	NA	NA	NA
WP_094187784.1|3520069_3520833_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|3521036_3521318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|3521878_3522313_-	membrane protein	NA	NA	NA	NA	NA
WP_041182719.1|3522422_3523379_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_041182296.1|3523545_3524724_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_041182297.1|3525719_3526682_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_044756364.1|3527461_3528424_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|3528839_3530075_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|3530590_3531556_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|3532218_3534390_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|3534617_3534974_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|3535052_3536117_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_002808376.1|3536396_3536612_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|3536919_3537366_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_094187715.1|3539100_3539864_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408018.1|3540214_3540598_-	membrane protein	NA	NA	NA	NA	NA
WP_011258280.1|3541113_3541926_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_044756991.1|3541986_3543045_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	7.6e-73
WP_044756992.1|3543039_3544209_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	8.3e-97
WP_155297137.1|3544251_3544389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408014.1|3544376_3544760_-	membrane protein	NA	NA	NA	NA	NA
WP_012444370.1|3545494_3546307_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_157724589.1|3546377_3547766_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187785.1|3547817_3548875_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756994.1|3549002_3549722_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_094187852.1|3549751_3549979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408011.1|3550157_3551066_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_014502625.1|3551477_3552020_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756996.1|3552422_3555887_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_125168745.1|3556118_3556337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258268.1|3556376_3556706_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_044756997.1|3556724_3558722_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_044756998.1|3558789_3560946_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_044756999.1|3560956_3561472_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_041182609.1|3561498_3562782_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011258263.1|3562765_3563593_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_044757485.1|3563607_3564729_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_044757000.1|3566676_3568734_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.6	1.2e-79
WP_042465485.1|3569066_3569318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757001.1|3569669_3570419_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012444354.1|3570522_3571236_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_129215637.1|3571307_3571820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757002.1|3571997_3572888_+	pirin family protein	NA	NA	NA	NA	NA
WP_024712501.1|3573134_3573596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757003.1|3573940_3576349_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_094187853.1|3576345_3576825_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757004.1|3577132_3577717_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757487.1|3577919_3578486_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|3578706_3578940_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075240165.1|3579403_3579982_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757005.1|3580050_3580911_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044757006.1|3580965_3582867_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.7	1.1e-29
WP_044757007.1|3582888_3584997_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|3585360_3586329_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 31
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	3603457	3672008	5039763	transposase	Bacillus_phage(12.5%)	52	NA	NA
WP_115862286.1|3603457_3604423_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757015.1|3606932_3608417_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.1e-13
WP_011258239.1|3608699_3609236_-	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_044757016.1|3609511_3610510_+	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_044757017.1|3610694_3611489_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258236.1|3611805_3613212_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258235.1|3613192_3614548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258234.1|3614544_3615003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757019.1|3614986_3617596_-	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012445697.1|3618695_3619577_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_027703692.1|3620675_3621275_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258228.1|3621427_3621862_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011258227.1|3622343_3623291_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_011407969.1|3623304_3623772_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_011258225.1|3623764_3624331_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_011407966.1|3625595_3626168_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_041182545.1|3626235_3627192_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044757021.1|3627865_3628996_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011258220.1|3629109_3630147_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407962.1|3630510_3631203_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011407961.1|3631246_3632107_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011258216.1|3634141_3634567_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_044757022.1|3634672_3635314_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_027703896.1|3635371_3635713_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_011258213.1|3635770_3636313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|3636368_3636965_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_099051294.1|3637082_3637463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407955.1|3637569_3637788_-	peptidase	NA	NA	NA	NA	NA
WP_003487757.1|3637892_3638360_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407954.1|3638531_3638990_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_044757023.1|3639005_3640463_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407952.1|3640720_3641485_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
WP_011258208.1|3641484_3642747_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011258207.1|3642743_3643988_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_011258206.1|3644175_3644715_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258205.1|3644711_3645041_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_109181895.1|3646976_3647942_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168743.1|3648662_3648929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239693.1|3649206_3650361_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_011258200.1|3650360_3651683_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011407948.1|3651709_3652750_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011407947.1|3652767_3653628_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407946.1|3653662_3654262_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082322940.1|3654328_3655264_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_075239694.1|3655329_3656682_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_082322987.1|3656773_3657958_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	6.5e-41
WP_011257310.1|3659646_3660882_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757028.1|3662067_3664392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757029.1|3664416_3666285_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	4.4e-15
WP_011258190.1|3666497_3667928_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407938.1|3668689_3669481_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044757030.1|3670532_3672008_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	2.9e-99
>prophage 32
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	3775500	3930152	5039763	transposase	Xanthomonas_phage(31.82%)	112	NA	NA
WP_011257570.1|3775500_3776736_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3777157_3778546_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3779301_3780243_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3780556_3781321_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3781513_3782896_+	APC family permease	NA	NA	NA	NA	NA
WP_011258087.1|3783335_3784733_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012445797.1|3785295_3785694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3785838_3786843_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3786880_3788398_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_044757048.1|3788438_3789485_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|3789495_3790248_-	SapC family protein	NA	NA	NA	NA	NA
WP_094187791.1|3790579_3793726_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044757049.1|3794784_3796791_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3797010_3797457_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3799473_3800640_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3800641_3801214_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3801226_3801631_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_094187792.1|3801668_3802340_-	YjfK family protein	NA	NA	NA	NA	NA
WP_027703610.1|3802342_3803425_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3803450_3804224_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3804236_3804653_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3804833_3805433_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3805599_3806142_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011258068.1|3806138_3807251_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3807552_3807804_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|3807818_3808883_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_044757050.1|3810354_3814071_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|3814339_3814534_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408408.1|3814537_3814837_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_070344110.1|3815060_3819509_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3819777_3819972_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_082322945.1|3820410_3823905_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182763.1|3824173_3824368_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3824371_3824671_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_011407855.1|3824894_3827903_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182763.1|3828171_3828366_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3828369_3828669_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_012444927.1|3833237_3833414_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012445821.1|3833410_3834082_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012445822.1|3834103_3834973_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_027703881.1|3838934_3840224_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3843614_3844064_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3845506_3846010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258050.1|3846034_3846460_-	cytochrome c	NA	NA	NA	NA	NA
WP_094187794.1|3846456_3848040_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011407842.1|3849600_3850218_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258048.1|3850463_3851690_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011258047.1|3851762_3852635_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3853895_3854694_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407839.1|3854774_3855434_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011407838.1|3855585_3857673_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012445831.1|3857847_3858828_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_011407835.1|3859261_3860149_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_094187728.1|3860191_3860989_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704066.1|3861214_3861604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407833.1|3861683_3862361_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704076.1|3862823_3864143_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_115801876.1|3864252_3865218_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3865306_3866070_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3866457_3867459_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3868115_3868256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445035.1|3869333_3870569_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_153296751.1|3870749_3870899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445839.1|3872649_3873423_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011258028.1|3873436_3874267_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3874337_3875114_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258026.1|3875124_3875817_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3875816_3876431_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3876773_3877358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703579.1|3877354_3878677_-	TonB family protein	NA	NA	NA	NA	NA
WP_011407820.1|3878666_3879032_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703580.1|3879131_3880493_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_044757056.1|3880510_3881209_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_044757057.1|3881231_3881894_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407815.1|3881874_3882714_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3882713_3883388_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_044757058.1|3883384_3884884_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069960293.1|3884880_3885528_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011258012.1|3887815_3888991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703583.1|3889120_3891835_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_133264561.1|3891895_3892135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407808.1|3892154_3893147_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011258009.1|3893149_3893866_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011258007.1|3894684_3896685_-	transketolase	NA	NA	NA	NA	NA
WP_027703585.1|3896911_3898192_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3898389_3898707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3899002_3900760_-	membrane protein	NA	NA	NA	NA	NA
WP_027703586.1|3900756_3902574_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258003.1|3902570_3903578_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|3903574_3904036_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3904038_3905001_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012445859.1|3905021_3906041_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115862288.1|3906663_3907698_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3907837_3908794_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258092.1|3908826_3910062_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|3910204_3911002_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3911073_3913023_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3913042_3913576_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3913572_3914238_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_044757059.1|3914234_3914993_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407795.1|3914992_3916051_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_094187795.1|3916173_3918696_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_041182719.1|3918763_3919720_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011407794.1|3920064_3920715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407793.1|3921091_3922381_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3922594_3922837_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_044757060.1|3922908_3923847_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257988.1|3923972_3926126_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257987.1|3926146_3926527_-	RidA family protein	NA	NA	NA	NA	NA
WP_011257986.1|3926606_3928778_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011407791.1|3928906_3929206_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_094187796.1|3929353_3930152_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	3989331	4057688	5039763	protease,transposase,integrase	Ralstonia_phage(25.0%)	54	3988769:3988828	4055811:4055875
3988769:3988828	attL	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACT	NA	NA	NA	NA
WP_044757070.1|3989331_3990567_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044757071.1|3991555_3993157_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|3993773_3994520_-	cellulase	NA	NA	NA	NA	NA
WP_113195645.1|3994992_3995751_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|3996267_3996783_-	peptide deformylase	NA	NA	NA	NA	NA
WP_044757517.1|3997104_3997527_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.9	5.2e-41
WP_012445908.1|3998298_4000167_-	membrane protein	NA	NA	NA	NA	NA
WP_011407746.1|4000205_4001159_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|4001164_4002121_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011257916.1|4002113_4004066_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|4004062_4004596_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|4004715_4005066_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|4005167_4005761_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|4005858_4006179_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_070344111.1|4006185_4006869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070344112.1|4007051_4008281_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	2.4e-46
WP_044757073.1|4008842_4009289_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|4009285_4009531_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|4009527_4010025_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|4010049_4010409_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044757074.1|4010426_4011458_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|4011457_4012207_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|4012206_4012956_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257903.1|4012976_4014026_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|4014236_4014641_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407739.1|4014751_4015438_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_115862289.1|4015536_4016502_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257899.1|4016584_4017142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239641.1|4017203_4017467_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757075.1|4017463_4019158_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_044757076.1|4019154_4021362_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_075239641.1|4021423_4021687_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757077.1|4021683_4023378_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_011257897.1|4023374_4025579_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_044757078.1|4025898_4027596_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_059317525.1|4027592_4029743_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_012445927.1|4032927_4033128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407730.1|4034020_4034650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445930.1|4035476_4036181_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011257889.1|4036616_4037351_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257888.1|4037359_4037812_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257887.1|4037839_4038496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257886.1|4038508_4039276_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_044757080.1|4039272_4040451_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011407728.1|4041149_4043120_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|4043951_4044224_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_012445937.1|4044437_4046909_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_011257881.1|4047052_4048339_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|4048463_4049090_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|4049182_4050475_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|4053792_4054554_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|4054697_4055705_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_115862290.1|4055968_4056934_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
4055811:4055875	attR	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACTGCAAG	NA	NA	NA	NA
WP_094187737.1|4056934_4057688_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	4102025	4211597	5039763	protease,transposase	Staphylococcus_prophage(12.5%)	74	NA	NA
WP_094187715.1|4102025_4102788_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409312.1|4104407_4105049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057581.1|4106281_4107010_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.4e-06
WP_011409560.1|4107055_4108018_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4108122_4108885_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|4108879_4109122_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|4109670_4110132_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011258802.1|4110392_4111361_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187763.1|4112757_4113556_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257834.1|4113797_4114412_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|4114494_4115481_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4115596_4116091_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4116335_4118165_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|4118183_4118654_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4119576_4120704_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4120804_4122187_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_044757084.1|4122434_4124558_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|4125086_4125605_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011257570.1|4127928_4129164_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757085.1|4129777_4130668_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_115862291.1|4133267_4134587_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187858.1|4135331_4136255_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	5.8e-37
WP_094187763.1|4136442_4137240_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4139001_4139967_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|4140268_4141846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|4141913_4142677_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757086.1|4142743_4143958_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187798.1|4145328_4146126_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257831.1|4147098_4147983_-	membrane protein	NA	NA	NA	NA	NA
WP_044757531.1|4148724_4150083_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011257828.1|4150449_4151013_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257827.1|4151172_4152429_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_012446005.1|4154109_4154601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182120.1|4154885_4155059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182780.1|4155055_4156021_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|4158262_4158745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|4158941_4159478_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_094187799.1|4159624_4160740_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|4161266_4162223_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187800.1|4162412_4165382_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|4165427_4166321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407693.1|4169208_4171086_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|4172362_4173364_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|4173407_4175129_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|4175112_4175370_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_044757088.1|4175445_4176570_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|4176566_4178129_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|4178459_4179533_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011257807.1|4180349_4180997_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|4181064_4182513_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|4182633_4183518_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115862292.1|4184509_4185475_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|4185643_4186105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|4186374_4187028_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407686.1|4187156_4187813_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257798.1|4187833_4189213_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|4189485_4190802_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257796.1|4190878_4191799_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|4192032_4193367_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011407685.1|4193347_4194460_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|4194469_4194667_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|4194792_4195326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257791.1|4195952_4196588_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011257788.1|4198318_4199101_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757089.1|4199294_4201967_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	7.5e-77
WP_044757090.1|4202293_4203586_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	4.9e-74
WP_011257785.1|4203923_4204109_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_027703756.1|4204402_4205266_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|4205265_4206393_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|4207022_4207409_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|4207648_4208548_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|4208958_4209435_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|4209597_4210080_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_094187801.1|4210798_4211597_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	4243829	4313256	5039763	tRNA,transposase	Enterobacteria_phage(12.5%)	45	NA	NA
WP_059317495.1|4243829_4244795_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757098.1|4244906_4247198_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4247325_4248000_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_044757099.1|4247996_4249841_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4249837_4250704_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4250723_4251356_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|4251358_4252393_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|4252407_4252698_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4259856_4260696_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|4261306_4262464_+	phosphotransferase	NA	NA	NA	NA	NA
WP_044757100.1|4262499_4264662_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|4265037_4265613_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|4265718_4266447_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|4266884_4267724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|4267720_4270033_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011407647.1|4270029_4270839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|4270828_4271482_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407645.1|4271465_4272587_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|4272583_4273435_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011257726.1|4273431_4274067_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_012446066.1|4274063_4274480_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|4274476_4274986_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|4274995_4275427_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_044757101.1|4275694_4276912_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011407640.1|4277087_4278827_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_011407636.1|4281047_4284845_-	membrane protein	NA	NA	NA	NA	NA
WP_044757102.1|4285822_4289875_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	3.4e-121
WP_011257718.1|4290273_4291071_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|4291522_4292494_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|4292920_4293388_+	RDD family protein	NA	NA	NA	NA	NA
WP_011407635.1|4293802_4294909_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011407634.1|4294905_4295988_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011257713.1|4296095_4297568_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257712.1|4297567_4297873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257711.1|4297913_4298339_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_044757104.1|4298546_4301489_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	8.4e-130
WP_027704099.1|4301496_4301799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187802.1|4302425_4303526_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	2.1e-41
WP_075244150.1|4303713_4304028_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_115862293.1|4304094_4305414_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|4305550_4306517_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862294.1|4306717_4308037_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757108.1|4308356_4309397_+	pectate lyase	NA	NA	NA	NA	NA
WP_094187803.1|4309663_4311709_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
WP_157724592.1|4311936_4313256_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	4335219	4345846	5039763		Enterobacteria_phage(42.86%)	10	NA	NA
WP_011407616.1|4335219_4336566_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4336611_4338015_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011257679.1|4338131_4339040_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.4e-27
WP_011257678.1|4339036_4339594_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.0e-44
WP_011407613.1|4339590_4340478_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|4340533_4341589_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|4341814_4342561_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|4342560_4343502_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|4343724_4344543_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4344532_4345846_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
>prophage 37
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	4473849	4521112	5039763	transposase	Acinetobacter_phage(50.0%)	44	NA	NA
WP_094187763.1|4473849_4474647_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703947.1|4476512_4476785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757130.1|4476772_4478587_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407528.1|4478707_4479088_+	response regulator	NA	NA	NA	NA	NA
WP_011257545.1|4479056_4479323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407527.1|4479322_4480603_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407526.1|4481719_4483129_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044757134.1|4483119_4484136_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_115862297.1|4485568_4486957_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012443955.1|4487227_4488196_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_115862298.1|4488345_4489665_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296753.1|4489735_4489900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703827.1|4489899_4490133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4490390_4491437_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_044757138.1|4491620_4493201_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4493589_4494486_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4494488_4495652_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4495662_4496238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443950.1|4496265_4496985_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4497045_4497264_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4497363_4498239_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4498277_4498874_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4498870_4499044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4499024_4500629_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4500667_4501621_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4501637_4502114_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4502390_4505591_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4505750_4506729_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_003483093.1|4507786_4508257_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4508599_4508815_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4508895_4509513_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4510061_4510454_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4510457_4510886_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4511071_4511725_+	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_011409578.1|4512001_4512316_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4512475_4513270_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4513407_4514100_+	CRP-like protein Clp	NA	NA	NA	NA	NA
WP_011409579.1|4514420_4515137_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4515129_4515927_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4516063_4517101_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4517218_4517848_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4517999_4518581_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_080493584.1|4519286_4520111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187806.1|4520010_4521112_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 38
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	4525998	4585884	5039763	tRNA,transposase,integrase	Vibrio_phage(15.38%)	53	4530210:4530226	4578582:4578598
WP_044757142.1|4525998_4527375_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.9e-79
WP_041182574.1|4527669_4528626_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
4530210:4530226	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_011407508.1|4531930_4532176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|4532172_4532445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257520.1|4532441_4532648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|4532781_4534056_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_044757143.1|4534315_4535113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181951.1|4535109_4536384_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257516.1|4536464_4536875_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_011257515.1|4538187_4538346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181950.1|4538342_4538645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757144.1|4538651_4539737_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_044757145.1|4539738_4539999_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_044757146.1|4539995_4540475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757147.1|4540488_4541208_-	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_044757148.1|4541558_4541843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757149.1|4541839_4542679_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	40.0	8.0e-09
WP_076659458.1|4542675_4542909_-	plasmid-related protein	NA	NA	NA	NA	NA
WP_041181948.1|4543147_4544242_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_011407506.1|4544991_4545312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4545504_4547379_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|4547487_4547928_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407504.1|4548028_4548943_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4549142_4549664_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4549906_4551040_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_042465436.1|4551149_4551653_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044757151.1|4551649_4553155_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_094187807.1|4553320_4554379_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257498.1|4554379_4555204_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_044757153.1|4555401_4556679_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257496.1|4556843_4558565_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4558615_4559929_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4559928_4560852_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011257493.1|4561245_4561758_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4561890_4563027_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4563098_4564241_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4564283_4564757_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4564797_4565520_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257488.1|4565561_4566836_+	RDD family protein	NA	NA	NA	NA	NA
WP_011257487.1|4567018_4569511_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4569521_4570085_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4570308_4571082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757155.1|4571078_4571753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|4571914_4572691_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4572797_4573013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181946.1|4573198_4575100_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_041181945.1|4575184_4576561_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011257479.1|4577069_4577915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4578245_4578848_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
4578582:4578598	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011257477.1|4578831_4579857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757158.1|4580322_4582545_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4582947_4583463_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_115862299.1|4584918_4585884_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	4764050	4915306	5039763	holin,tRNA,transposase	Tupanvirus(10.53%)	102	NA	NA
WP_011257354.1|4764050_4765055_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011407403.1|4765517_4765712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4766462_4767038_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011257350.1|4767096_4768620_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_011257349.1|4769310_4769781_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012446321.1|4769742_4769931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407399.1|4770991_4771258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4771338_4772307_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044757197.1|4772691_4774824_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4775101_4775251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407398.1|4775285_4775672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4775673_4776525_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041181934.1|4776577_4777459_+	TolB-like protein	NA	NA	NA	NA	NA
WP_011257339.1|4778081_4780616_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407395.1|4780849_4781602_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4781729_4782644_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407393.1|4783916_4784909_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011257333.1|4785573_4786032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181932.1|4786131_4787922_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_027703506.1|4788130_4790368_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4790792_4791482_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_044757561.1|4791871_4794886_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4795069_4795771_+	SapC family protein	NA	NA	NA	NA	NA
WP_011257326.1|4795760_4796774_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041181930.1|4796784_4798350_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_044757199.1|4798489_4799500_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4799909_4801103_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4801099_4801846_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_027703503.1|4801877_4803479_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4803539_4803740_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703502.1|4803736_4804324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4804527_4804689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4804809_4805082_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703501.1|4805147_4806137_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_094187813.1|4806221_4806983_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4807085_4808081_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_012446343.1|4808098_4808890_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446344.1|4808892_4809642_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.3e-54
WP_012446345.1|4809760_4810699_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011257310.1|4811125_4812361_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082322992.1|4812413_4813580_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187862.1|4816212_4817314_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_041182545.1|4817436_4818393_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187782.1|4819132_4819895_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187814.1|4819955_4820753_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407366.1|4821105_4821390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757202.1|4823736_4824846_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_044757204.1|4825080_4825725_+	sterol-binding protein	NA	NA	NA	NA	NA
WP_011257293.1|4825721_4827395_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257292.1|4827508_4827898_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|4828122_4828875_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_094187815.1|4828970_4829513_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011407360.1|4829605_4830037_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407359.1|4830039_4830669_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_044757206.1|4830698_4830899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|4831305_4833474_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257286.1|4833600_4835763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4836589_4837555_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257284.1|4837747_4839229_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_094187863.1|4839665_4840031_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4840027_4841329_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4841509_4842286_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|4842414_4843178_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407353.1|4843578_4844163_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011257279.1|4844355_4847805_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_044757210.1|4848552_4851195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757567.1|4851298_4853698_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4853700_4855083_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4855240_4855825_+	gluconokinase	NA	NA	NA	NA	NA
WP_044757212.1|4856710_4858465_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_011407345.1|4858772_4859078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4858980_4859421_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4859440_4859869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862301.1|4861362_4862682_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|4865553_4866522_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_157724595.1|4867804_4869130_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_059317507.1|4869536_4870493_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	1.0e-39
WP_115862304.1|4871337_4872303_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757224.1|4872320_4872878_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4872896_4873184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4873568_4874363_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4874362_4875112_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4875123_4875675_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4875671_4876334_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_011257254.1|4876323_4876614_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4876624_4877683_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_094187817.1|4879481_4880245_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757229.1|4880349_4881312_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407325.1|4881658_4882474_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_044757236.1|4891817_4893722_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4893718_4894321_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011407318.1|4894380_4895685_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011257243.1|4896232_4898395_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407316.1|4898688_4898895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257241.1|4899102_4899492_-	YchJ family protein	NA	NA	NA	NA	NA
WP_011257239.1|4900836_4901967_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4902614_4903667_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257237.1|4904429_4905503_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407313.1|4905810_4906869_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011407913.1|4908099_4909314_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182826.1|4911042_4911576_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_094187818.1|4914507_4915306_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 40
NZ_CP013961	Xanthomonas oryzae pv. oryzae strain PXO145, complete genome	5039763	4968672	5027919	5039763	protease,transposase	Ralstonia_virus(18.18%)	44	NA	NA
WP_115862307.1|4968672_4969638_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260840.1|4969813_4971229_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260841.1|4971719_4974044_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_044757575.1|4974401_4974812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757577.1|4975189_4975735_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_044757259.1|4975830_4977207_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.1e-76
WP_011260845.1|4978243_4979371_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4980226_4981567_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4981783_4982476_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4982599_4982920_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4982919_4983912_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4984218_4985742_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|4985846_4987082_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4987242_4987899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757261.1|4988049_4989861_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4990008_4990359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862308.1|4990537_4991857_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|4993269_4994451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4994548_4997980_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4998127_4998826_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4998809_5000282_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_044757264.1|5000278_5000866_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_044757265.1|5000865_5002062_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011409834.1|5002135_5002765_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	1.2e-46
WP_103057218.1|5003445_5003973_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|5003969_5004536_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|5004811_5006173_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_153296757.1|5006286_5006451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322996.1|5006434_5007391_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.4e-41
WP_011409842.1|5009480_5009687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260869.1|5009667_5010786_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_049756351.1|5013137_5013890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|5013886_5014594_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_041182345.1|5014607_5014949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|5014929_5015439_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_069960357.1|5015435_5015837_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_074038671.1|5017182_5017440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260878.1|5018297_5018504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757270.1|5019515_5020685_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
WP_041182532.1|5020710_5022021_-	MFS transporter	NA	NA	NA	NA	NA
WP_010364861.1|5023933_5024254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704146.1|5024372_5025539_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|5025802_5026759_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|5027133_5027919_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
