The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	7735	59013	4906999	transposase,protease	Ralstonia_phage(40.0%)	42	NA	NA
WP_011407164.1|7735_8572_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8758_9565_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9841_11035_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11188_11860_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11944_12706_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12752_13175_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13178_13592_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13887_14655_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14665_14935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|15009_16470_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17116_18127_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18398_19601_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19742_21881_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22091_22385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22416_22914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23160_24141_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24188_25355_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25501_26068_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27542_28751_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29378_30401_-	sugar kinase	NA	NA	NA	NA	NA
WP_011407175.1|31223_32192_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407489.1|33200_34520_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_129215536.1|35289_35997_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_012443646.1|36598_37975_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|40987_41230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|41171_41495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|41960_42941_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_069959662.1|43559_44849_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.0e-39
WP_011407185.1|45288_45624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|45898_46330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296471.1|46491_46644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|46678_48088_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_041181902.1|48365_48581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|49405_49666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|49682_50015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|50014_50473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|50880_51849_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011407913.1|51992_53207_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|53727_54525_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|56240_57206_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|57202_57481_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182054.1|57624_59013_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	80731	137239	4906999	transposase	Ralstonia_phage(42.86%)	52	NA	NA
WP_109181945.1|80731_81495_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407204.1|81554_81815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182843.1|81833_84392_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011257097.1|84576_84918_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_011257094.1|87132_88686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257093.1|89149_89713_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	4.4e-11
WP_011257092.1|90088_90508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257091.1|91246_93064_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_011257090.1|93146_93977_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011257089.1|93973_94483_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_011257088.1|94475_95804_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_011257087.1|95793_96495_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_044756180.1|96479_97109_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_011257085.1|97116_97878_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_011407211.1|97879_98272_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_011257083.1|98305_98761_-	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_012443605.1|98975_100055_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_033013638.1|100063_101986_+	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_042464327.1|101985_102627_+	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_027704248.1|102719_103673_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_011407215.1|103659_104304_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011257077.1|104308_104569_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011257076.1|104565_105393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257075.1|105389_106328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257074.1|106337_106580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257073.1|106660_106942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257072.1|106996_107467_+	protein HpaB	NA	NA	NA	NA	NA
WP_011257071.1|107881_109867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407217.1|109863_110310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407220.1|112440_114813_+	HPr kinase	NA	NA	NA	NA	NA
WP_080493960.1|115688_117317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|117874_118258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|118254_118740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|118743_119106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257055.1|119222_120659_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|120900_121752_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|122211_122529_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|122834_123722_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_069959667.1|124428_125379_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	4.4e-96
WP_143699970.1|125492_125702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|125769_126042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|126082_126364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959669.1|126502_127561_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.5	4.9e-72
WP_011407232.1|127701_128649_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|128903_129215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|130681_131152_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|131321_132014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|132105_132504_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|133305_134262_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044756192.1|134236_134707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756194.1|134898_136152_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258802.1|136270_137239_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 3
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	220032	362380	4906999	tRNA,holin,transposase	Bacillus_phage(21.43%)	92	NA	NA
WP_012443704.1|220032_221937_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|222197_222377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|222510_222978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|223135_224095_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|224079_224697_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|224739_225159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443706.1|225411_226317_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|226565_227450_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|227513_228296_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|228340_229102_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|229265_229595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|229913_231005_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|231073_232672_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|232836_234081_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|234532_235162_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|235368_237345_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|238731_239397_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_011257214.1|239683_240694_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|240690_241422_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|241775_243305_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|243414_246447_-	membrane protein	NA	NA	NA	NA	NA
WP_011257218.1|246745_249784_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|249948_251001_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|251169_251415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|251413_252379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|252378_255039_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_011257222.1|256857_257076_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257225.1|259635_260121_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_109182060.1|260152_260479_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257226.1|260700_261345_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|261485_262376_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|262503_262986_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|266021_266555_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|269370_270429_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|270736_271810_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|272572_273625_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|274272_275403_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|276733_277123_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|277330_277537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|277768_278737_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|278990_281153_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|281700_283005_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_069963817.1|283064_283667_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|283663_285568_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|294887_295703_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|296049_297012_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|297116_297879_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|299678_300737_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|300747_301038_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|301027_301690_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|301686_302238_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|302249_302999_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|302998_303793_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|304177_304465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|304483_305041_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|305058_306024_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069963818.1|306868_307825_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.6e-40
WP_109182012.1|307896_308659_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|308698_309497_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|309628_310843_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|310902_311733_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|311895_313131_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|314529_314958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|314977_315418_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011407345.1|315320_315626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|315933_317688_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|318606_319369_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|319422_320007_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|320164_321547_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|321549_323949_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|324052_326695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|327442_330892_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|331084_331669_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|332145_332922_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|333102_334404_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_094187863.1|334400_334766_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_069963819.1|335202_336684_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.6	1.0e-99
WP_109182027.1|336876_337842_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|338668_340831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959687.1|340957_343126_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|343763_344393_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|344395_344827_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_094187815.1|344919_345462_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|345557_346310_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|346534_346924_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|347037_348711_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|348707_349352_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|353036_353321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801865.1|353672_354471_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187710.1|354530_355294_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|359247_360213_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|361273_362380_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	772633	808952	4906999	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|772633_773953_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|774268_775453_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|775982_777296_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|777285_778104_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|778326_779268_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|779267_780014_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|780239_781295_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|781350_782238_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|782234_782792_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|782788_783697_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|783813_785217_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|785263_786610_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|786743_787475_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|787474_788104_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|788161_790249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|790245_791895_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|792010_792619_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|793169_793814_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|793810_794737_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|794739_795582_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|795667_796780_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|796949_798209_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|798270_798732_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|798874_800569_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|800680_801085_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|801216_801990_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|802000_802468_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011257697.1|802473_802947_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|803505_804825_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|804982_806302_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|806514_807483_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|807632_808952_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	874678	918574	4906999	protease,transposase	Ralstonia_phage(25.0%)	39	NA	NA
WP_069963827.1|874678_875644_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|876034_876610_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|876722_877232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|877330_877525_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|877614_878592_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|878821_879262_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|879539_880484_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|880566_881310_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|881514_881754_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|881895_883131_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|883301_884657_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|884717_885791_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|885787_886747_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|886743_887097_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_112998597.1|887787_888582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128415345.1|888675_888861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|888943_889270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|889505_891104_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|891249_892146_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|892221_893376_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069963828.1|893563_896155_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|896477_896615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959733.1|896887_898093_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011409545.1|898542_899511_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407672.1|899752_901969_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|902047_903046_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|903155_903338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257772.1|904317_907305_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|907479_908427_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|908926_909463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265185.1|909533_910853_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182785.1|911197_912160_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
WP_012446027.1|912293_912854_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|912896_913379_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|913541_914018_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|914428_915328_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|915567_915954_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|916583_917711_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|917710_918574_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	923874	1084185	4906999	integrase,protease,transposase	Ralstonia_phage(22.22%)	115	1016570:1016588	1081296:1081314
WP_011257788.1|923874_924657_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069963916.1|924767_926144_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_011257791.1|926387_927023_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|927649_928183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|928366_929335_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257793.1|929468_929666_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|929675_930788_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|930768_932103_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|932336_933257_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|933333_934650_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|934922_936302_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|936322_936979_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|937107_937761_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|938031_938493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069963917.1|939552_940437_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|940557_942006_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|942073_942721_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|943537_944611_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|944941_946504_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|946500_947625_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|947700_947958_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|947941_949663_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|949706_950708_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|951984_953862_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|954287_956639_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|956749_957643_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187800.1|957688_960658_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_094187799.1|961272_962388_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|962534_963071_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|963267_963750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|966025_966991_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|966987_967161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|967445_967937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|969616_970873_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|971032_971596_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|971962_973321_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|973320_973917_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|974063_974948_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|976929_977544_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|977626_978613_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|978728_979223_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|979467_981297_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|981315_981786_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|982708_983836_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|983936_985319_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|985566_987690_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|988218_988737_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|989443_990545_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|991060_992296_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|992909_993800_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|993889_994030_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|997589_998825_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|999807_1001127_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|1001872_1002796_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|1003858_1004824_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1005125_1006703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1006770_1007534_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1010202_1011171_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1011431_1011893_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1012441_1012684_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1012677_1013441_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1013473_1014205_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1016024_1016777_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1016570:1016588	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1016778_1017744_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1018007_1019015_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1019158_1019920_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1023237_1024530_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1024622_1025249_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1025373_1026660_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1026803_1029275_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1029488_1029761_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1030592_1032563_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1033268_1034447_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1034443_1035211_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1035223_1035880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1035907_1036360_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1036368_1037103_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1037538_1038243_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1039068_1039698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1040589_1040790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069963830.1|1041185_1043909_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	1.1e-70
WP_069960070.1|1043976_1046127_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1046123_1047821_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_011257897.1|1048140_1050345_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257898.1|1050341_1052036_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_075239641.1|1052032_1052296_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1052357_1052915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1052997_1053963_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1054061_1054748_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1054858_1055263_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1055473_1056523_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1056543_1057293_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1057292_1058042_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1058041_1059073_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1059090_1059450_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1059474_1059972_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1059968_1060214_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1060210_1060657_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1061218_1063315_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1063321_1063642_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1063739_1064333_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1064434_1064785_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1064904_1065438_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1065434_1067387_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1067379_1068336_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1068341_1069295_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1069333_1071202_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1072717_1073233_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1073749_1074508_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1074980_1075727_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1076343_1077945_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1078933_1080169_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|1080997_1081966_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
1081296:1081314	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1082433_1082784_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_155297121.1|1082865_1084185_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	1122914	1238084	4906999	transposase	Leptospira_phage(14.29%)	96	NA	NA
WP_109182097.1|1122914_1124016_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1125446_1126070_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1126093_1126333_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1126382_1127264_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1127413_1127863_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1128013_1128661_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1128752_1129223_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1129219_1129810_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1130418_1130718_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1130714_1130936_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1131171_1131714_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1131724_1133065_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_094187736.1|1133772_1134536_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1134768_1136094_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1136292_1136640_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1136636_1139045_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1139223_1140381_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1140396_1140996_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1140992_1141388_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1141384_1142110_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1142219_1143080_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1143196_1143808_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1143988_1144786_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1144934_1145234_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1145362_1147534_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1147613_1147994_+	RidA family protein	NA	NA	NA	NA	NA
WP_069960167.1|1148014_1150168_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_069959742.1|1150293_1151232_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1151303_1151546_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1151759_1153049_+	citrate synthase	NA	NA	NA	NA	NA
WP_115801874.1|1153217_1154537_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407794.1|1154901_1155552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187795.1|1155861_1158384_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1158506_1159565_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1159564_1160323_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1160319_1160985_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1160981_1161515_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1161534_1163484_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1163554_1164353_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1164495_1165731_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082323365.1|1165801_1166836_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	1.1e-65
WP_069963832.1|1167458_1168478_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_069959745.1|1168498_1169461_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1169463_1169925_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1169921_1170929_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_069959746.1|1170925_1172728_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1172724_1174482_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1174777_1175095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057328.1|1175292_1176573_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1176792_1178793_+	transketolase	NA	NA	NA	NA	NA
WP_069959747.1|1179611_1180319_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.6e-05
WP_011407808.1|1180321_1181314_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1181633_1184348_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1184467_1185643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464577.1|1185777_1187736_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1187911_1188559_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1188555_1190055_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1190051_1190726_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_069959748.1|1190725_1191565_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1192231_1192930_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1192947_1194309_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1194408_1194774_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959749.1|1194763_1196080_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1196076_1196661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1197003_1197618_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1197617_1198310_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069959750.1|1198320_1199097_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1199167_1199998_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069959751.1|1200011_1200785_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_153296750.1|1203858_1203999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1204655_1205657_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109181945.1|1206044_1206807_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1206896_1207862_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1207971_1209291_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1209753_1210431_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_069960073.1|1210528_1210900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1211113_1212001_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1212434_1213419_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1213591_1215679_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1215830_1216490_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1216570_1217368_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1217390_1217570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1217588_1217993_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1218026_1218386_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1218629_1219502_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1219574_1220801_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1221046_1221664_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011407845.1|1223224_1224808_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1224804_1225230_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1225254_1225758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1227200_1227650_+	azurin	NA	NA	NA	NA	NA
WP_027703881.1|1231052_1232342_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_129215576.1|1234355_1235807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445822.1|1236303_1237173_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_012445821.1|1237194_1237866_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_011258057.1|1237862_1238084_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	1458558	1596264	4906999	tRNA,transposase	Ralstonia_phage(16.67%)	106	NA	NA
WP_109181897.1|1458558_1459524_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155297124.1|1459903_1460581_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1461118_1461343_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_012445687.1|1461342_1463415_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_024712563.1|1463646_1464504_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323430.1|1465527_1467927_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_011258248.1|1467923_1468871_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1469864_1470413_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1470807_1471365_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1471414_1473523_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069959782.1|1473544_1475446_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
WP_027704078.1|1475500_1476361_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080493959.1|1476321_1477008_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959783.1|1477471_1477705_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1477925_1478492_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1478694_1479282_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_109182101.1|1479589_1480069_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1480065_1482474_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1482818_1483280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1483526_1484417_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1484594_1485113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1485184_1485898_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1486001_1486751_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1487111_1487363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069963838.1|1487695_1489753_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.6	1.5e-80
WP_044757485.1|1491700_1492822_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011258263.1|1492836_1493664_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1493647_1494931_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_069963839.1|1494957_1495473_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1495483_1497640_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_044756997.1|1497707_1499705_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1499723_1500053_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1500092_1500311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1500542_1504007_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1504409_1504952_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1505363_1506272_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1506617_1507416_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1507559_1508279_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1508434_1509469_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1509489_1510302_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1511037_1511421_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1511534_1512704_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1512698_1513757_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1513817_1514630_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1515145_1515529_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1515660_1516824_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011258802.1|1516913_1517882_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408020.1|1518014_1518827_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1519057_1519645_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1519821_1520778_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1520851_1521583_+	nitrilase	NA	NA	NA	NA	NA
WP_011258289.1|1522780_1524184_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1524197_1524704_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1525109_1525568_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1526345_1526549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1528110_1528596_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1528823_1529039_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1529289_1529769_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1529900_1530329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258297.1|1530401_1531232_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1531293_1532061_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1532060_1532276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1532421_1533213_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_033013599.1|1533370_1534534_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027704133.1|1536767_1537406_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1537581_1539522_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1539738_1540293_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1540514_1541945_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258308.1|1542011_1543466_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011258309.1|1543882_1544608_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_103073471.1|1544706_1545117_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155297125.1|1545168_1546140_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.8	1.0e-31
WP_012444404.1|1546366_1548748_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258314.1|1551376_1551787_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1552086_1552269_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1552401_1553442_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1553514_1554960_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_027704131.1|1555086_1556385_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_012444410.1|1556641_1557187_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_069959787.1|1557183_1558647_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1560109_1560364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704130.1|1560766_1561300_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1561325_1561727_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1561695_1562076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1562072_1562315_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_069960077.1|1562343_1563003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|1563678_1565583_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_012444418.1|1565846_1568243_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_059317478.1|1568392_1569115_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_069959788.1|1569302_1570250_-	DMT family transporter	NA	NA	NA	NA	NA
WP_059317476.1|1572065_1572566_+	RraA family protein	NA	NA	NA	NA	NA
WP_059317475.1|1572507_1574184_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1574330_1575596_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1575654_1576848_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1576844_1577534_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_069960078.1|1577639_1579109_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1579128_1579965_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1579990_1581094_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|1581090_1584147_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069960188.1|1584212_1584803_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069959790.1|1584934_1586767_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1586842_1587606_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1587648_1588968_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1590265_1594756_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|1594752_1595244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|1595295_1596264_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 10
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	1724934	1790795	4906999	tRNA,transposase	Bacillus_phage(20.0%)	41	NA	NA
WP_011257310.1|1724934_1726170_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1726220_1726984_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1727050_1728427_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1728805_1729480_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408165.1|1730592_1731090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1731228_1733025_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1733581_1734127_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1734228_1738350_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1738570_1741213_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069963842.1|1742654_1744169_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187782.1|1744339_1745102_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1745413_1745926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1745988_1747107_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1747103_1747382_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1747378_1748131_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1748127_1749027_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1749110_1749191_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1749480_1751667_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1751963_1753406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1753738_1755841_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1756082_1758527_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1758540_1759065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1759264_1761292_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1761305_1762025_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|1762021_1762936_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|1763230_1764106_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|1764102_1765053_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1765302_1765704_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|1765721_1766084_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|1766083_1766614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|1766653_1768690_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_069963843.1|1768803_1775730_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|1775737_1776940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|1776973_1777450_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258513.1|1777700_1778324_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|1778335_1779418_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|1784039_1785104_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|1785100_1785832_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011408189.1|1785856_1787815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|1787956_1789060_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|1789559_1790795_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	1898933	1958310	4906999	transposase,protease	Tupanvirus(18.18%)	53	NA	NA
WP_011408249.1|1898933_1900520_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_011258599.1|1900685_1902491_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	6.1e-22
WP_011258600.1|1902597_1903398_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1903428_1903806_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1903795_1904476_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1904472_1905372_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1905595_1906318_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1906466_1907189_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1907347_1908682_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1908856_1909354_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1909449_1910685_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1910913_1912290_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1912409_1913093_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1913109_1914144_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1914324_1915902_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1916019_1917024_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1917023_1917578_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1917663_1918416_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1918502_1918709_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1920198_1920843_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1920832_1923334_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1923330_1924935_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1924931_1925165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1925161_1926184_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1926520_1926886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1926882_1927473_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1927570_1929280_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1929388_1929715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1929944_1930289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1930411_1931587_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1931742_1934571_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1934631_1935732_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1936200_1936728_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1937129_1937303_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1937463_1937718_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1937892_1938159_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1938349_1938916_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109182117.1|1940403_1941723_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1942115_1942301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1942490_1943867_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1944006_1944480_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1946151_1947201_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1947315_1947651_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1947939_1948230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1949120_1950239_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|1950459_1951671_+	MFS transporter	NA	NA	NA	NA	NA
WP_103057306.1|1951841_1952003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258643.1|1953593_1954049_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1954322_1954925_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1954960_1955569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1955628_1955823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1955892_1957263_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1957547_1958310_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	1974352	2033456	4906999	coat,tRNA,protease,transposase	Acidithiobacillus_phage(25.0%)	45	NA	NA
WP_011258663.1|1974352_1976437_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|1976661_1977111_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|1977874_1978933_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|1979203_1980601_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|1980597_1981575_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|1981756_1983694_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1984114_1984891_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1984895_1985570_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|1987200_1988577_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|1988616_1989012_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|1989054_1990530_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|1991328_1991745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1991758_1991929_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|1995623_1996187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258677.1|1996659_1997976_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|1998143_1998746_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|1998819_1999266_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|1999343_1999610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258680.1|2000431_2001775_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044756910.1|2001711_2003124_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|2003120_2003858_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_069959819.1|2003857_2006038_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2006877_2007837_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2008012_2011603_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2012060_2012801_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2012797_2014054_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2014092_2014884_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2014907_2015369_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2015365_2016379_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258692.1|2016778_2019232_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2019228_2020575_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2020601_2021792_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2021794_2022622_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2022618_2023380_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2023397_2023955_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2024135_2024858_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2024914_2025292_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2025419_2026298_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2026467_2027271_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2027646_2028372_-	molecular chaperone	NA	NA	NA	NA	NA
WP_044756904.1|2028374_2028707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2028753_2029788_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756903.1|2029784_2032136_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_044756902.1|2032152_2032923_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2032931_2033456_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 13
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	2084617	2213820	4906999	tRNA,transposase	Ralstonia_phage(19.23%)	98	NA	NA
WP_115801887.1|2084617_2085937_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2086271_2087198_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2087327_2087933_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2088271_2090041_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_103073520.1|2090037_2090631_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_011258751.1|2090898_2091492_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2091690_2093127_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2093368_2094571_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2094613_2097442_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2097622_2098555_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2098551_2100051_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2100388_2100652_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2100931_2101432_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2101673_2103041_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_094187715.1|2106063_2106826_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296175.1|2106786_2106930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963920.1|2108278_2109682_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_027703710.1|2109804_2110227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445134.1|2110859_2111690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963848.1|2111699_2112686_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|2112682_2113558_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_014502778.1|2113554_2113917_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2113919_2114168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2114303_2114861_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2114952_2115918_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2115943_2117293_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2117285_2117522_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2117522_2118275_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2118608_2119454_+	transporter	NA	NA	NA	NA	NA
WP_069960295.1|2119594_2120770_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011258781.1|2120783_2122094_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_103073473.1|2122018_2123077_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258783.1|2123073_2124279_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_012445124.1|2124665_2127419_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2127561_2128701_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2128697_2129693_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057266.1|2129814_2130963_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2130962_2131103_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2131474_2132920_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2133486_2136015_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2136225_2137024_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2138094_2138862_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2138863_2139211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2139369_2140338_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181928.1|2141690_2142656_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2143100_2144285_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2144339_2145815_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2146136_2146319_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2146467_2147667_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011257031.1|2148527_2149496_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182081.1|2149708_2151028_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2151164_2152133_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181930.1|2152412_2153211_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|2153436_2154402_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|2156631_2157597_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2158628_2159597_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181933.1|2160773_2161876_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2162062_2162530_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_099051282.1|2162890_2163655_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2163661_2165011_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187763.1|2165160_2165959_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801888.1|2166398_2167718_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2167930_2168899_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069959827.1|2168950_2169547_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2169646_2170660_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2171350_2171617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182103.1|2171860_2171956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960204.1|2172029_2175545_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2175768_2176068_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2176071_2176266_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_153296744.1|2176332_2176479_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_082323372.1|2176534_2180137_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_069959830.1|2181688_2183164_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	9.2e-101
WP_069963849.1|2183304_2187432_-	avirulence protein	NA	NA	NA	NA	NA
WP_155296480.1|2187720_2189040_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2190871_2191957_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2192283_2192982_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2192984_2193551_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2193562_2194240_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2194328_2195759_-	amino acid permease	NA	NA	NA	NA	NA
WP_011408420.1|2195835_2197317_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2197453_2198041_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2198196_2199438_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2199646_2201065_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2201099_2201399_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2201395_2203267_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011258847.1|2203556_2204576_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094187828.1|2204569_2204980_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2204997_2205600_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2205592_2207530_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2207698_2208169_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2208165_2208336_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2208332_2209085_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011258853.1|2209179_2209875_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2209871_2210516_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2210742_2211891_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2212030_2212834_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2212854_2213820_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	2314877	2449559	4906999	tRNA,protease,transposase	Xanthomonas_phage(59.52%)	118	NA	NA
WP_012444952.1|2314877_2316290_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2316795_2317594_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2317907_2318234_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2318243_2319158_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2319154_2320450_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2320446_2321538_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2321534_2322662_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2322658_2323261_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2323257_2323992_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2323985_2324762_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2324751_2325372_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_069960206.1|2325957_2329812_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2330036_2330336_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069963851.1|2330339_2330534_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	3.3e-19
WP_137455828.1|2330801_2334185_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2334636_2335416_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2335457_2335556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2336309_2336495_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2336494_2336698_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2336833_2337907_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2338011_2338311_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2338674_2338914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2339020_2340505_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2340506_2340827_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011258954.1|2340823_2342008_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	2.3e-54
WP_080493496.1|2342062_2342233_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2343341_2343602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959845.1|2344466_2344778_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	100.0	1.8e-54
WP_113085484.1|2344802_2345015_-	hypothetical protein	NA	A0A1W6DXJ1	Xanthomonas_phage	100.0	2.4e-26
WP_069959846.1|2345070_2345364_-	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	100.0	3.4e-47
WP_069959847.1|2345524_2346172_-	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	100.0	2.7e-121
WP_069959848.1|2346173_2347367_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	100.0	5.5e-221
WP_011408503.1|2347366_2347696_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_069959849.1|2347695_2349102_-	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	99.6	7.9e-235
WP_011347634.1|2349238_2349469_-	hypothetical protein	NA	A0A1W6DXZ2	Xanthomonas_phage	100.0	2.2e-30
WP_042464854.1|2349480_2349684_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_069959850.1|2349687_2349984_-	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	100.0	2.8e-49
WP_080496434.1|2349980_2351021_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	99.1	7.7e-203
WP_011408508.1|2351173_2351386_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_155296581.1|2351379_2351604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970101.1|2351698_2352328_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2352452_2352635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2352756_2353068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2353137_2353900_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|2354419_2355388_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168752.1|2355564_2355888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2356501_2357014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2357146_2357909_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082323370.1|2359130_2362928_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2363196_2363391_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2363394_2363694_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069963852.1|2363917_2367673_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2367762_2368525_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296744.1|2368544_2368691_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_042464821.1|2368756_2368951_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2368954_2369254_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069959856.1|2369478_2373495_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|2373668_2373890_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082323384.1|2373886_2374444_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.0	7.9e-21
WP_125168753.1|2375589_2375835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2375818_2376775_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258188.1|2377189_2378158_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182129.1|2378302_2379268_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2379245_2383346_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2383654_2384839_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2384889_2385789_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2385955_2386462_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2386936_2387569_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2387568_2389425_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011408525.1|2389421_2390921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2390863_2391328_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2391324_2392104_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2392395_2393436_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2393432_2395202_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2395198_2395663_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2395666_2396329_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2396357_2398766_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2399019_2399985_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2401378_2402113_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2402105_2403347_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2403370_2403823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2403773_2404022_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2404132_2404915_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2404931_2405141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2405144_2406935_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2406969_2407356_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2407352_2407748_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2407807_2408074_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2408017_2408890_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2409018_2410116_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2410549_2411980_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2411976_2412984_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2412980_2413700_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2413802_2415719_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2415774_2416434_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2418060_2418264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2419279_2419660_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2419874_2423270_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2424835_2425598_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408544.1|2427493_2427727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2427893_2428868_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_069960088.1|2429631_2430513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408549.1|2432213_2433347_+	phospholipase A	NA	NA	NA	NA	NA
WP_011408550.1|2433775_2434228_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_125168754.1|2433915_2434410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259006.1|2434546_2436064_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_012444869.1|2436397_2438278_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011408551.1|2438466_2439246_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2439396_2439882_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_027703343.1|2442338_2442578_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_069959861.1|2442829_2443543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2445067_2445568_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757420.1|2445729_2446308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259015.1|2446399_2446900_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259016.1|2446966_2447800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2447850_2448165_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|2448348_2448537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408557.1|2448950_2449559_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	2538598	2586694	4906999	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2538598_2539993_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2539994_2540252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2540248_2540554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2540550_2540877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2541603_2542266_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_069963923.1|2542354_2542885_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2545108_2546380_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2546551_2547919_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2548222_2549668_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2549664_2550351_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2550323_2551343_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2551384_2551945_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2551965_2552922_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2553089_2553866_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2554349_2556485_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2556481_2556673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2558447_2558954_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2558994_2559522_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2559518_2560010_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2560033_2560609_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2560685_2561639_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2561727_2562600_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_103057219.1|2562596_2563364_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2563554_2564253_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2564416_2565199_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2565207_2565588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2565584_2566295_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2567605_2568154_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011257031.1|2568325_2569294_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408623.1|2569898_2571134_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2571697_2572018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2572357_2573608_+	porin	NA	NA	NA	NA	NA
WP_103057309.1|2573742_2574816_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_011408626.1|2575003_2576095_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2576207_2577182_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2577181_2578051_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2578073_2578904_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2579032_2579743_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2579875_2580283_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2580560_2581202_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2581272_2582592_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2582828_2583890_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2583940_2585125_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2585374_2586694_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	2593413	2664545	4906999	tRNA,protease,transposase	uncultured_Mediterranean_phage(35.71%)	52	NA	NA
WP_011259125.1|2593413_2594559_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2594628_2595699_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2595864_2596296_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2596419_2597916_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2598260_2598968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2602329_2603451_-	phytase	NA	NA	NA	NA	NA
WP_103057211.1|2605723_2606149_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2606341_2606974_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2607370_2608133_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2608413_2609445_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2609451_2611245_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2611241_2611526_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408650.1|2611757_2612243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2612301_2612808_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2612804_2613425_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2613665_2615570_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2615657_2616715_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2616812_2618132_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2618365_2619523_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2619799_2620765_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2620742_2622218_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011257031.1|2624757_2625726_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075243670.1|2625993_2626233_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2628107_2629328_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2629642_2631040_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|2631050_2632271_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2632267_2632906_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2632976_2633837_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2633833_2634622_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2634632_2635838_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2635856_2636282_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2636501_2637134_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2637158_2639531_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2639688_2640894_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_069959870.1|2641214_2642546_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.1e-41
WP_011408659.1|2642542_2642893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2642924_2643332_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2643328_2643655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2643686_2645063_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2645299_2649466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103073501.1|2649578_2650208_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_069960218.1|2650314_2652243_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2652405_2654766_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_069959872.1|2655049_2656018_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2656075_2657197_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2658624_2659377_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2659457_2659676_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2659956_2662239_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2662382_2662703_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_153296742.1|2662789_2662957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408665.1|2662953_2663412_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2663408_2664545_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	2746291	2868281	4906999	tRNA,protease,transposase	Ralstonia_phage(15.0%)	99	NA	NA
WP_011407175.1|2746291_2747260_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_128415342.1|2748884_2749364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2757503_2757896_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2757904_2758366_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2758786_2759185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264955.1|2759661_2759916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2760888_2761854_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323388.1|2761860_2763006_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2763130_2764099_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069959882.1|2764487_2766173_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2766169_2767906_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_069959883.1|2768057_2769158_+	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259267.1|2769206_2769470_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259269.1|2769848_2769959_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012444741.1|2770179_2771445_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|2771425_2773339_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2773706_2774951_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2775157_2776312_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2776325_2776586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187751.1|2776585_2776954_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2776950_2778246_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|2778369_2779320_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011259279.1|2779932_2781276_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2781315_2782416_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2782421_2782874_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259282.1|2783115_2784357_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2784428_2785454_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2785766_2786261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259285.1|2786431_2787862_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2788359_2788797_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2788793_2790044_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2790111_2791173_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2791315_2792356_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_024710406.1|2792446_2792728_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2792724_2794074_+	dihydroorotase	NA	NA	NA	NA	NA
WP_094187752.1|2794013_2794913_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_094187715.1|2795811_2796574_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2796600_2796864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2797235_2797724_-	general stress protein	NA	NA	NA	NA	NA
WP_011408734.1|2797947_2799267_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2799403_2800372_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|2800571_2801888_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2802247_2803429_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2805017_2806688_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2806904_2807594_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2807622_2808327_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2808400_2809120_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_011408737.1|2809150_2810500_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_099051322.1|2810507_2811344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2811502_2812069_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2812170_2813199_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2813417_2815535_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187831.1|2815531_2816452_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2816512_2817277_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2817395_2818229_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2818481_2819093_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2819347_2819788_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2819784_2820210_+	barstar family protein	NA	NA	NA	NA	NA
WP_027703271.1|2820658_2822554_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.8e-48
WP_069959885.1|2822643_2824020_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_011259319.1|2824122_2824683_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2824780_2826337_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2826620_2827496_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012444709.1|2827696_2828395_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2828565_2828775_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2829044_2829530_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2829600_2830149_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2830145_2831327_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2831550_2833620_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2833719_2834598_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2834695_2835595_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2835682_2836423_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2836582_2837158_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2837331_2838303_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2838336_2839278_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2839277_2841155_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2841292_2843026_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_012444701.1|2843078_2843579_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2843575_2845063_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2845087_2846155_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2846269_2847033_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182164.1|2847116_2848454_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_069959887.1|2848749_2850012_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2850228_2850976_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2851292_2853128_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2853399_2854491_+	ribonuclease D	NA	NA	NA	NA	NA
WP_080493491.1|2854566_2854956_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_011408757.1|2854819_2855170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2855583_2855985_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011259346.1|2856491_2856626_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015463309.1|2856848_2857028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2857629_2857920_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2857907_2858186_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2858670_2858859_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408397.1|2859631_2860816_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|2861396_2862362_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408763.1|2866854_2867271_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2867481_2867808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2867840_2868281_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
>prophage 18
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	2875499	2974256	4906999	tRNA,transposase	Bacillus_phage(22.22%)	59	NA	NA
WP_011408766.1|2875499_2876954_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2877377_2878364_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2878775_2879438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2879492_2879978_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2879977_2880496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2880590_2881469_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2881465_2882746_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2882761_2883763_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2883914_2885279_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2885533_2885944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2886099_2886930_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2887243_2888491_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259371.1|2888636_2890148_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2890134_2891721_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2891717_2892920_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115840172.1|2893426_2894815_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2895048_2896434_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2897341_2898721_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2898720_2900037_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012444665.1|2900173_2901418_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
WP_011408784.1|2901725_2903006_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_094187755.1|2903311_2903620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2903579_2905928_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2905924_2906770_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011408786.1|2906776_2908501_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_041182645.1|2908643_2908976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259384.1|2909030_2910383_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|2910443_2913581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2913747_2914602_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408789.1|2914772_2916077_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_069959889.1|2916218_2920313_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_011259389.1|2920346_2921333_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_069959890.1|2921457_2922441_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_011408792.1|2922889_2927914_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2928191_2928851_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2928865_2930170_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2930182_2933353_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2934328_2935294_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2936000_2936996_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059317461.1|2937156_2939673_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2939669_2940626_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_069963855.1|2940784_2942527_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011408800.1|2942845_2943982_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258188.1|2944648_2945617_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296181.1|2945731_2945887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959892.1|2945911_2948257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|2948274_2949006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959893.1|2949037_2951380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2951404_2952133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|2952161_2954504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2954528_2955272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963856.1|2955302_2958137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444637.1|2958133_2959063_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041182637.1|2966513_2966903_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_082325566.1|2968429_2970919_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|2970958_2971348_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408813.1|2971502_2972462_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2972394_2972709_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_155297126.1|2972936_2974256_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	2977597	3063751	4906999	tRNA,transposase	uncultured_Caudovirales_phage(42.11%)	59	NA	NA
WP_011258802.1|2977597_2978566_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|2979222_2979723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187833.1|2980031_2983073_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959900.1|2984122_2984575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959901.1|2984829_2986635_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|2986636_2986984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|2987059_2987767_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011259416.1|2987918_2988311_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075251701.1|2988333_2988849_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959903.1|2988845_2989199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|2989287_2990028_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|2990034_2991009_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_069959904.1|2991010_2991793_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|2991789_2992812_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|2992912_2993221_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2993217_2993583_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_069963858.1|2993616_2995626_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_069960094.1|2995800_2996055_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103073514.1|2997737_2998424_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408833.1|2998739_2999501_+	transporter	NA	NA	NA	NA	NA
WP_044756756.1|2999514_3001857_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_115840174.1|3002353_3003319_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069959906.1|3003558_3005805_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_042465628.1|3006533_3008645_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_069959907.1|3009329_3011405_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|3011997_3014259_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|3014652_3016914_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011259433.1|3017871_3018669_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3018804_3019287_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3020135_3020933_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187834.1|3021153_3021498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408844.1|3021576_3023976_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.9e-09
WP_011408845.1|3024237_3025104_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011259439.1|3025100_3025697_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011259440.1|3025693_3026770_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011408846.1|3026878_3029122_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259442.1|3029777_3030593_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011259443.1|3030946_3033538_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_069963859.1|3033603_3034014_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003486316.1|3034010_3034259_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259446.1|3034406_3037175_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011259449.1|3037824_3039507_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_011408848.1|3039683_3040553_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259451.1|3040564_3042742_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408849.1|3043106_3044243_-	two-component system response regulator	NA	NA	NA	NA	NA
WP_011408850.1|3044384_3045902_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	3.8e-86
WP_014503214.1|3046105_3047231_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_041182178.1|3047484_3048432_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959908.1|3051238_3051940_+|transposase	transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_011408855.1|3052100_3052478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960095.1|3052659_3052878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959909.1|3053657_3055397_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_011259461.1|3055393_3056314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408858.1|3056330_3056807_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259463.1|3056803_3060046_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012444585.1|3060054_3060498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259464.1|3060497_3061622_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_011408860.1|3061861_3062578_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_094187715.1|3062987_3063751_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	3100114	3111889	4906999	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3100114_3100414_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3100456_3100687_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3100930_3101680_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3101684_3102380_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_109181974.1|3102315_3102543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3102565_3102865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3103252_3103657_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3104382_3104595_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3104734_3107383_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3107484_3107973_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3108275_3109310_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3109482_3110124_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3110212_3111889_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 21
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	3202078	3313214	4906999	plate,transposase	Ralstonia_phage(60.0%)	78	NA	NA
WP_069963865.1|3202078_3203560_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.6	3.9e-99
WP_011408934.1|3203642_3206231_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069963866.1|3206287_3207400_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3207524_3208103_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069963867.1|3209589_3211677_+	type III effector	NA	NA	NA	NA	NA
WP_069963868.1|3212063_3213161_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069963869.1|3213577_3216658_+	histidine kinase	NA	NA	NA	NA	NA
WP_033013236.1|3219693_3220401_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3220397_3221390_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_069963870.1|3221386_3223846_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3223959_3224940_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3224948_3225977_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3226143_3226941_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3227003_3227801_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|3227861_3228188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959922.1|3228184_3231088_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3231084_3231807_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3231803_3232451_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069959923.1|3232447_3235906_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3235909_3237226_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3237227_3238565_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|3238561_3239953_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3239949_3240489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3240497_3242435_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3242699_3243158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3243544_3244039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3244104_3244602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3244790_3247496_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3247528_3248539_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3248502_3250380_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3250383_3250887_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3250874_3251708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3251743_3252247_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3252346_3253861_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3253853_3254360_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3255718_3256687_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_155296489.1|3256822_3258142_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3258312_3259548_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3259733_3260702_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3260753_3262670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3262694_3263432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3263462_3265805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3265822_3266569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3266597_3269432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3270089_3271919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3271932_3272532_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3272619_3272976_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3272972_3273395_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3273410_3273644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960235.1|3273670_3273931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704269.1|3276095_3277082_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3277492_3281206_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3281731_3282495_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3282598_3283246_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3283467_3284229_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3284386_3285355_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3285488_3285854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3285912_3286344_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3286355_3287618_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3287601_3288894_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3289263_3290034_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3290790_3292026_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3293325_3293583_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3294022_3295006_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3295321_3296290_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407489.1|3296426_3297746_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408981.1|3297895_3298858_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3299107_3299266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3299297_3299477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3299841_3300807_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3302014_3302992_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3303800_3303995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3305388_3305751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3305734_3306304_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3306341_3307595_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3307800_3308178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3310106_3311342_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3312179_3313214_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 22
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	3454332	3583530	4906999	integrase,tRNA,protease,transposase	Ralstonia_phage(14.29%)	101	3560517:3560536	3573611:3573630
WP_094187736.1|3454332_3455096_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|3455928_3456174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|3456119_3458486_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3458482_3459157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3459366_3460305_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3460427_3461777_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3461773_3462661_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3462978_3463785_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3464230_3465448_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3465553_3466522_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3466871_3467540_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3467536_3468310_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_094187839.1|3468883_3470950_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3471516_3472542_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3472626_3473700_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3473692_3474796_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3474806_3475733_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_069959940.1|3475813_3476464_+	SCO family protein	NA	NA	NA	NA	NA
WP_069959941.1|3476460_3477309_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_069959942.1|3477859_3479443_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103073413.1|3479629_3480085_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	5.4e-12
WP_011409074.1|3480153_3480621_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_103057205.1|3480865_3482083_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3482043_3482331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960098.1|3482441_3482948_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|3483069_3484470_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|3484732_3485308_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3485304_3485739_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3485766_3485934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3486570_3486756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3486790_3487360_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3487452_3488304_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3489691_3491707_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3491977_3492676_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3492716_3493124_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3493561_3494524_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3495807_3497058_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3497065_3498310_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3498537_3499017_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3499127_3499664_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3499773_3500523_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3500730_3501222_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3502335_3503655_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3503798_3505505_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3505538_3506843_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3506874_3507135_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3507136_3508012_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3509846_3510311_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3510362_3510551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963878.1|3510523_3510844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3510840_3512208_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3512353_3512935_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3513191_3514637_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011409097.1|3515483_3519404_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011259814.1|3519537_3521037_-	ribonuclease G	NA	NA	NA	NA	NA
WP_011409098.1|3521036_3521609_-	Maf-like protein	NA	NA	NA	NA	NA
WP_011409099.1|3521747_3522482_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409100.1|3522953_3526067_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3527485_3527956_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_011259820.1|3528510_3528720_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3529045_3530161_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3530172_3530589_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011409104.1|3530645_3531545_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3531541_3532570_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3532592_3533228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259825.1|3533741_3536384_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3536456_3537068_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3537272_3538130_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3538385_3538835_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_155297128.1|3539134_3540100_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3540224_3540987_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3541597_3541891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3542364_3542598_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3542631_3543645_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3543612_3543804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3543894_3545214_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3545301_3546516_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3546661_3547189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182722.1|3547185_3548151_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3548391_3549154_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069963880.1|3549456_3551589_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258351.1|3552139_3553108_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.9e-99
WP_011258803.1|3553268_3554237_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_082323400.1|3556430_3556844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3556840_3557604_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3558475_3559273_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3559306_3559699_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3559789_3560182_-	hypothetical protein	NA	NA	NA	NA	NA
3560517:3560536	attL	TAGTCGCCCCTGAAAAACCC	NA	NA	NA	NA
WP_075239728.1|3562520_3562940_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3564656_3566441_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3566631_3566832_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3567367_3568162_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3568463_3569222_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3569297_3571160_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3571217_3571559_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3571818_3572094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3575140_3575854_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3573611:3573630	attR	GGGTTTTTCAGGGGCGACTA	NA	NA	NA	NA
WP_012445603.1|3575914_3576337_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187804.1|3576468_3577232_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3580305_3581217_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_115801902.1|3582564_3583530_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	3630979	3704807	4906999	plate,transposase	Ralstonia_phage(15.38%)	50	NA	NA
WP_011407175.1|3630979_3631948_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3632968_3634003_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3634386_3635112_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3635243_3635705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3639140_3641261_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3641527_3642373_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3643364_3644333_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3644657_3646628_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3647056_3648454_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3648566_3649385_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011409162.1|3649695_3652893_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
WP_011259908.1|3653128_3654547_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_082348427.1|3654556_3655159_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259910.1|3655208_3655814_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3655963_3656185_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3656194_3656620_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_143690655.1|3657013_3657208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409167.1|3658134_3658914_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3659128_3659758_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3659818_3660574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963882.1|3660902_3661679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963884.1|3662086_3663661_+	protein kinase	NA	NA	NA	NA	NA
WP_039440923.1|3663909_3664176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959954.1|3664453_3667633_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	4.6e-73
WP_069963885.1|3667632_3668307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959956.1|3668306_3669053_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075242182.1|3669049_3670561_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011409179.1|3670553_3670988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|3670998_3672528_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3672830_3673823_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|3673875_3674184_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069963886.1|3674764_3678238_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	22.4	1.5e-08
WP_069963887.1|3678377_3679376_+	Abi family protein	NA	NA	NA	NA	NA
WP_069959958.1|3679422_3680967_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	2.6e-13
WP_069959959.1|3680947_3682444_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_047340450.1|3682791_3683055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|3683777_3684533_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069959960.1|3684826_3685858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325568.1|3685866_3687801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155297132.1|3687712_3688675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325569.1|3688752_3690693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963889.1|3690604_3691630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963890.1|3691632_3694497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465165.1|3694515_3695361_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069963891.1|3695362_3698134_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	5.1e-44
WP_011259938.1|3698226_3698580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3698610_3701340_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3701425_3702517_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3702480_3704316_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3704318_3704807_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 24
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	3730601	3800818	4906999	transposase	Ralstonia_phage(15.38%)	56	NA	NA
WP_011409439.1|3730601_3731837_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011409218.1|3732372_3732852_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075240218.1|3732875_3733340_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_048485619.1|3733336_3733660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963893.1|3733656_3734136_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082325571.1|3734159_3734624_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011409221.1|3734620_3735517_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011257031.1|3739094_3740063_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011258802.1|3740254_3741223_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075242163.1|3741698_3742265_-	DNA repair protein	NA	NA	NA	NA	NA
WP_044756518.1|3742332_3743292_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_069959975.1|3743439_3746505_-	DNA repair protein	NA	NA	NA	NA	NA
WP_059317517.1|3746491_3749431_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.7	7.5e-54
WP_011409224.1|3750416_3751490_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069959976.1|3751542_3752361_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011259979.1|3752357_3753341_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069960257.1|3753337_3757075_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_059317431.1|3757090_3758572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409228.1|3758631_3758892_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011259982.1|3759001_3759880_-	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	35.5	1.3e-06
WP_011409229.1|3760079_3760820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153303321.1|3760857_3761013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483117.1|3761836_3763039_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_011259987.1|3763655_3763940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259988.1|3763936_3764116_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_069959977.1|3764246_3765044_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011259990.1|3765107_3765782_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011259991.1|3765784_3766189_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259991.1|3766693_3767098_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259992.1|3767161_3768343_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_010371538.1|3768693_3769335_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011259994.1|3769334_3770531_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011259995.1|3770775_3771372_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011409235.1|3771376_3772117_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_012444318.1|3772152_3772962_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003484370.1|3772964_3773222_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_027703304.1|3773290_3773782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409238.1|3773933_3775226_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011409239.1|3775218_3775935_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	1.4e-22
WP_041182250.1|3776153_3777887_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011409241.1|3777986_3778751_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011409242.1|3778747_3780418_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_011409243.1|3780529_3782548_+	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260005.1|3782629_3783034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409245.1|3784375_3786535_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	5.7e-35
WP_033013179.1|3786531_3787743_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042465718.1|3787831_3788635_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_027703308.1|3789065_3789248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960107.1|3789715_3792670_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	9.0e-257
WP_011260010.1|3792999_3793449_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_011409250.1|3793445_3794141_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
WP_011409251.1|3794148_3795219_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_011409252.1|3795215_3796301_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_069960108.1|3797701_3798658_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_094187715.1|3798814_3799577_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409255.1|3799759_3800818_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	4106047	4196038	4906999	transposase	Ralstonia_phage(18.75%)	59	NA	NA
WP_115801919.1|4106047_4107655_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4107816_4108080_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4108084_4108744_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4108930_4110295_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4110510_4111206_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4112152_4112776_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409414.1|4112977_4113718_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4113811_4114462_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4114553_4115369_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4115418_4116156_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4118084_4119074_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4119196_4121770_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4121962_4122725_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4122798_4123767_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409421.1|4124500_4124767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4125698_4126497_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4128143_4129376_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4129415_4130378_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4130553_4131510_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011409545.1|4131721_4132690_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4133025_4133788_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4138625_4138856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959761.1|4139017_4140253_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_155297129.1|4140542_4140770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4140799_4142842_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4142843_4144742_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4144743_4145997_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_044756435.1|4145993_4146599_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_044756434.1|4147018_4148173_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4148175_4149204_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_012444129.1|4149210_4150278_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4150318_4151596_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4151640_4152408_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959999.1|4152622_4153789_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4156361_4159259_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011260307.1|4159409_4162100_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260311.1|4164179_4165364_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4165431_4166169_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4166337_4166853_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4166944_4168447_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4168450_4168891_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4168887_4170699_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|4170984_4171347_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4171506_4172559_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4172898_4173840_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4173860_4175198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4175369_4175750_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_069963897.1|4175874_4176636_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4178893_4180297_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4180419_4181475_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_155297133.1|4181647_4182502_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4182793_4184977_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_044756429.1|4185376_4186390_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_027703467.1|4186404_4187103_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4187090_4187369_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4188434_4189640_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4190140_4191556_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4191552_4192692_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_069963899.1|4195081_4196038_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	8.1e-42
>prophage 26
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	4261071	4403813	4906999	tRNA,transposase	Acinetobacter_phage(30.77%)	116	NA	NA
WP_094187715.1|4261071_4261835_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4262882_4263668_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4263921_4265595_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4266138_4266585_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4266915_4267200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4267794_4268706_-	magnesium transporter	NA	NA	NA	NA	NA
WP_027703842.1|4268951_4269947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757313.1|4270040_4271417_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_011260393.1|4272583_4274284_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011409499.1|4274692_4276465_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_099051318.1|4276740_4277625_-	DMT family transporter	NA	NA	NA	NA	NA
WP_027703846.1|4277813_4278692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493954.1|4278891_4279287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4280731_4281823_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011409507.1|4283725_4286050_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069960011.1|4286245_4288192_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4288566_4288758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4289148_4290732_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4291079_4291676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960267.1|4293024_4293873_-	threonine aldolase	NA	NA	NA	NA	NA
WP_011409514.1|4293907_4295383_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4296015_4296945_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4297179_4297671_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4297667_4298339_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4298733_4299063_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_044757306.1|4300670_4301348_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.3	8.8e-75
WP_011409520.1|4303865_4304351_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4304889_4307718_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4307717_4308092_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069960013.1|4308088_4309633_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_044756383.1|4309629_4310136_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4310132_4310417_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4310413_4310767_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|4311214_4311553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4311736_4312705_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409528.1|4313136_4314462_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011409529.1|4314826_4315897_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4316067_4316556_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4316912_4317503_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_044756377.1|4317514_4319023_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.8	1.3e-62
WP_011260428.1|4319465_4320359_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075242274.1|4321735_4322401_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_115801908.1|4323033_4323999_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4324531_4324912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4325072_4325836_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103073472.1|4325930_4326836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260437.1|4326904_4328200_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_069960017.1|4328315_4328840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4329265_4330531_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4330527_4331505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4331608_4332412_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4332587_4333397_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4333404_4334203_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187851.1|4334245_4334893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4334987_4335563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4335774_4337094_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4337243_4338212_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260446.1|4338337_4339090_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4339127_4339568_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4339774_4340116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4340341_4340719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4340929_4341127_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_069963901.1|4341433_4342180_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260452.1|4342272_4343079_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4343299_4344712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4344708_4345806_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4345960_4346759_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4346812_4347611_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4347830_4348793_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4349240_4350004_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4350285_4351062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4351058_4352375_+	amino acid permease	NA	NA	NA	NA	NA
WP_069963902.1|4352891_4354127_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4354720_4355002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4355562_4355997_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4356171_4357350_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069963903.1|4358345_4359308_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069963904.1|4361629_4363801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409563.1|4364028_4364385_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4364463_4365528_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_002808376.1|4365808_4366024_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069960024.1|4366331_4366778_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	4.7e-24
WP_069960025.1|4368255_4369218_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4369307_4371056_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_041182298.1|4372383_4372629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4372628_4372895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4373119_4374166_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011409569.1|4374352_4375933_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4376321_4377218_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4377220_4378384_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4378394_4378970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4378997_4379717_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4379777_4379996_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4380088_4380964_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_024743269.1|4381002_4381599_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4381595_4381769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4381749_4383354_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_069963906.1|4383392_4384346_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011409574.1|4384362_4384839_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4385115_4388316_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_109182027.1|4389531_4390497_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960028.1|4390509_4390980_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4391322_4391538_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4391618_4392236_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4392784_4393177_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4393180_4393609_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_069960112.1|4393794_4394448_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4394704_4395019_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4395178_4395973_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4396110_4396803_+	CRP-like protein Clp	NA	NA	NA	NA	NA
WP_011409579.1|4397123_4397840_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4397832_4398630_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4398766_4399804_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4399921_4400551_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4400702_4401284_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4402711_4403813_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 27
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	4408699	4485780	4906999	integrase,tRNA,transposase	Acidithiobacillus_phage(15.38%)	56	4464273:4464292	4475334:4475353
WP_069960029.1|4408699_4410076_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_115801910.1|4412283_4413082_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143699981.1|4414180_4414564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240159.1|4415182_4415413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4415670_4416639_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182079.1|4416775_4418095_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|4418252_4419572_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069960033.1|4419759_4420731_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4420923_4422108_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4422575_4423391_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_069960034.1|4424149_4425466_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4425725_4426970_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4427062_4430311_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4430444_4433585_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4433874_4435242_-	VOC family protein	NA	NA	NA	NA	NA
WP_012443929.1|4435251_4435461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4435986_4436952_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4438798_4439269_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4439297_4439720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4439795_4440230_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4440339_4440855_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4440870_4441896_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4442218_4442815_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_069960036.1|4443172_4444900_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4444949_4446392_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4446376_4447723_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4447913_4448663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4448764_4449376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4449480_4450704_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4451045_4451522_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4451548_4452010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4452395_4452716_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4452817_4453834_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4453905_4455069_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4455065_4456697_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_042465275.1|4456698_4459200_+	helicase SNF2	NA	NA	NA	NA	NA
WP_011260544.1|4459196_4460099_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4460320_4460704_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4461022_4462693_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4462921_4463932_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4463996_4464155_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
4464273:4464292	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260549.1|4464389_4465766_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4465776_4466310_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4466738_4467998_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_012443910.1|4468136_4469444_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409611.1|4469915_4470461_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4470486_4470753_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4470927_4472766_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4472996_4473872_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011407237.1|4475368_4476325_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
4475334:4475353	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_103057293.1|4476752_4477016_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
WP_069963907.1|4477209_4478190_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.6e-96
WP_011260560.1|4479304_4480204_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_027703980.1|4481151_4483953_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4484029_4484320_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_113101711.1|4484677_4485780_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
>prophage 28
NZ_CP013670	Xanthomonas oryzae pv. oryzae strain PXO71, complete genome	4906999	4597865	4740214	4906999	tRNA,tail,transposase	Arthrobacter_phage(18.75%)	92	NA	NA
WP_109182036.1|4597865_4598831_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4598931_4599357_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4599399_4600162_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4600224_4601256_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4602616_4603873_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4603869_4604760_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4604756_4605152_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4605171_4605750_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_143698279.1|4605635_4606499_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_155297131.1|4606495_4607815_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4612600_4614685_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4614784_4616812_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4617054_4618665_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4618675_4619839_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4619967_4620588_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260672.1|4621149_4621485_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4623109_4623421_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4624539_4625058_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_012443806.1|4625329_4627048_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4627138_4627525_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4627586_4628912_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_050580196.1|4629026_4630340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4630438_4631164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4631380_4632043_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4632121_4633216_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4634720_4637480_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4637732_4639322_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4639321_4641559_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4641847_4642756_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4642845_4644660_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4645045_4653871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801913.1|4653969_4654767_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4655311_4656064_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4656123_4657023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4657174_4657930_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4657926_4658562_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4658577_4658805_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4658877_4659780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4659934_4660900_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|4660997_4661753_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|4661833_4662292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4662562_4663348_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4663974_4664880_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4664943_4665861_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4666464_4667802_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4668027_4669095_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011409722.1|4669270_4671466_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4671462_4673427_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4673438_4674698_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4674697_4676398_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_080493943.1|4676400_4679115_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4679337_4680810_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4681787_4682843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4683070_4684489_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4684529_4685507_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_011409726.1|4686923_4688405_-	MFS transporter	NA	NA	NA	NA	NA
WP_099051314.1|4688746_4691620_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4691718_4693206_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4693237_4694272_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_094187716.1|4694688_4695486_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|4696362_4696500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|4696792_4697749_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4698476_4699239_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4699256_4700357_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4700422_4701544_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011260726.1|4701553_4702648_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4702722_4703403_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4703435_4704234_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4704362_4705682_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4705784_4706741_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4708207_4708666_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4708767_4709196_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4709442_4710306_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4713482_4713749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4713910_4714159_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4714367_4715126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4715122_4715818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4715916_4716249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4716720_4717155_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4717270_4717516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4717851_4718184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260744.1|4718432_4718531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4718633_4720028_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4720956_4721247_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_012443754.1|4721264_4721546_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_069960050.1|4721640_4723893_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.9	1.8e-10
WP_069963913.1|4724080_4728154_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_044756261.1|4728150_4731564_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_125168771.1|4731611_4731902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4738477_4739023_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4739091_4739619_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4739677_4740214_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
