The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	183924	242020	2053066	bacteriocin,transposase	Bacillus_phage(20.0%)	52	NA	NA
WP_065866762.1|183924_185103_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_035514011.1|185509_185728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212307.1|187003_187915_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.7	2.8e-60
WP_003627923.1|187936_189121_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_065866763.1|189086_189644_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_079227888.1|189951_190305_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023190550.1|190568_191576_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
WP_020828951.1|191559_191982_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_052541598.1|191974_194143_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.1e-171
WP_065866764.1|194144_195848_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
WP_065866765.1|196014_197187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866766.1|197305_198268_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_065866767.1|198297_198612_-	helveticin	NA	NA	NA	NA	NA
WP_023061231.1|198928_199282_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	39.8	2.9e-13
WP_023192344.1|199265_199700_+	phage repressor	NA	F8J1D9	Lactobacillus_phage	33.3	5.6e-14
WP_065866768.1|201306_202575_-	MFS transporter	NA	NA	NA	NA	NA
WP_025284014.1|202674_203535_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023190700.1|205166_206414_-	MFS transporter	NA	NA	NA	NA	NA
WP_020828954.1|206564_207545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627391.1|207608_207968_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_065866769.1|208193_210728_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.3	5.8e-71
WP_065866770.1|211932_212472_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_023190694.1|212503_213148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191578.1|213206_213968_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_020828959.1|214861_215461_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003630236.1|215571_216099_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814510.1|216099_217161_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003630234.1|217162_217837_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
WP_012212290.1|217881_219294_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003630233.1|219395_219638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866771.1|219815_220424_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	2.0e-33
WP_012212288.1|220453_221779_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_023190785.1|222063_222687_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023190786.1|222769_223309_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003627370.1|223322_223871_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
WP_012212286.1|223963_224755_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003627368.1|224763_225693_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_012212285.1|225734_226271_-	CvpA family protein	NA	NA	NA	NA	NA
WP_012212284.1|226432_227155_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_012212283.1|227169_228009_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	44.0	2.7e-17
WP_003627364.1|228024_228804_+	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
WP_065866772.1|228781_229666_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.7	1.4e-16
WP_003627362.1|229658_229922_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003627361.1|229971_231072_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_012212281.1|231080_231863_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_023190789.1|231976_233701_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	7.6e-38
WP_035513775.1|233710_235570_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.6e-46
WP_012212277.1|235748_236435_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
WP_012212276.1|236438_237587_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
WP_003627351.1|237637_239209_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_012212275.1|239217_239967_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_025283944.1|241696_242020_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	255039	308679	2053066	transposase,bacteriocin	Bacillus_phage(20.0%)	46	NA	NA
WP_003631064.1|255039_255312_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_065866780.1|256209_258006_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_025283934.1|258167_259409_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041810751.1|260163_260688_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003630153.1|260852_261230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866781.1|261238_262780_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	1.7e-44
WP_065866782.1|262790_263561_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_020828971.1|263563_264049_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_025283928.1|264252_264966_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_065866783.1|265116_266358_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	56.8	7.4e-120
WP_003627306.1|266597_267134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190806.1|267246_267591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866784.1|267863_269063_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.0	2.9e-121
WP_065866785.1|269335_269977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866786.1|269991_271497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190300.1|271589_271889_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_065866787.1|271983_272529_+	AAA family ATPase	NA	A0A218KC48	Bacillus_phage	31.7	1.2e-10
WP_065866788.1|272718_273270_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	45.2	8.6e-20
WP_065866925.1|273676_274060_+	ATPase	NA	NA	NA	NA	NA
WP_052541579.1|274232_274976_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	3.4e-19
WP_025283920.1|275130_276063_+	hydrolase	NA	M9MUG9	Rhodococcus_phage	37.6	1.6e-13
WP_065866789.1|276200_276656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866790.1|276772_277951_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_147628253.1|278096_278384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866792.1|279776_280634_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866793.1|281044_281869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866794.1|282956_284222_-	GTPase HflX	NA	NA	NA	NA	NA
WP_065866795.1|284698_285760_+	transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	31.1	5.0e-16
WP_065866796.1|285771_286659_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065866797.1|286669_287464_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_065866798.1|287463_288234_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_154021783.1|288350_289004_+	sugar transferase	NA	NA	NA	NA	NA
WP_065866799.1|289135_290251_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065866800.1|290253_291336_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065866801.1|291349_292468_+	EpsG family protein	NA	NA	NA	NA	NA
WP_065866802.1|292475_293492_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_065866803.1|293488_294346_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866804.1|295226_296216_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065866805.1|296212_297262_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_065866806.1|299075_300539_+	flippase	NA	NA	NA	NA	NA
WP_065866807.1|301709_302105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866808.1|302359_303811_-	APC family permease	NA	NA	NA	NA	NA
WP_065866809.1|304036_306142_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_065866810.1|306306_307182_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	7.1e-77
WP_012212228.1|307404_307911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866811.1|308133_308679_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	317460	470814	2053066	transposase,protease,tRNA	Bacillus_virus(14.71%)	108	NA	NA
WP_147628255.1|317460_318690_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	2.0e-125
WP_003627817.1|318782_319433_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_020829017.1|319493_320180_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_065866816.1|320329_322636_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012212220.1|324175_324736_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023192120.1|324794_325709_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.6	9.5e-32
WP_003629975.1|325743_326316_+	elongation factor P	NA	NA	NA	NA	NA
WP_065866817.1|326368_327670_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003627831.1|328672_329176_-	nucleoside deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	5.4e-13
WP_065866818.1|329223_330225_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_003627833.1|330314_331229_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_065866819.1|331349_332954_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	3.8e-15
WP_065866820.1|333357_334098_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	83.1	2.3e-121
WP_154021784.1|336024_336183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866821.1|336197_337019_+	Sir2 family NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
WP_052541527.1|337027_337981_+	DNA polymerase III subunit epsilon	NA	A0A0K2SUJ2	Clostridium_phage	33.1	1.5e-11
WP_003627841.1|338071_338926_+	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_003629948.1|338967_340395_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_065866822.1|340648_341734_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
WP_003627844.1|341733_342600_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003629944.1|342603_343428_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_052541525.1|343411_344707_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_025283877.1|344758_346060_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012212201.1|346198_347116_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_065866823.1|347128_348079_+	serine hydrolase	NA	NA	NA	NA	NA
WP_052541520.1|348214_348787_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866824.1|348791_352160_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_012212197.1|352318_353353_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_065866825.1|353398_354781_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041809680.1|355616_355724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212194.1|356647_357256_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.5	4.7e-35
WP_065866826.1|357255_357807_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065866827.1|358029_359337_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	1.8e-92
WP_079227744.1|361470_361656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211477.1|365893_366295_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_065866828.1|368489_369500_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_065866829.1|369518_370331_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_065866830.1|370359_371280_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_012211481.1|371283_371652_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_147628285.1|372704_373196_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_065866832.1|373233_374607_-	amino acid permease	NA	NA	NA	NA	NA
WP_065866833.1|374920_377545_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_065866834.1|377739_379551_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.2	1.4e-90
WP_003626988.1|379624_379918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866835.1|380276_381602_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.5	4.3e-57
WP_003627960.1|381631_382240_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_065866836.1|383311_383779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866837.1|383732_384290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866926.1|384373_384853_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_065866838.1|385184_386369_+	acetate kinase	NA	NA	NA	NA	NA
WP_003632732.1|387290_387518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866927.1|387663_388080_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_065866839.1|389979_391164_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.1	1.1e-123
WP_025283334.1|391432_391804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023191358.1|391821_392571_-	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_065866842.1|396216_397407_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.0	7.8e-127
WP_065866843.1|398018_399173_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_065866844.1|399447_400689_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	2.8e-119
WP_065866845.1|400895_402647_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.7	2.3e-90
WP_003632976.1|402800_403199_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_014564083.1|403297_403507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211496.1|403609_404002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147628259.1|405187_405304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211497.1|405686_406382_+	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	50.0	3.2e-11
WP_065866928.1|406519_407578_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_023190837.1|407647_408226_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	2.5e-22
WP_079227751.1|408226_409444_+	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.9	8.3e-15
WP_065866846.1|409494_410190_+	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	31.5	1.5e-13
WP_012211503.1|413549_414101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866847.1|414491_415607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003633005.1|415695_416397_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003633007.1|416460_416847_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
WP_020829039.1|418184_418913_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_065866848.1|418920_420021_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065866849.1|420108_421587_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.0	7.7e-116
WP_012211508.1|421583_422414_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.4	5.7e-68
WP_065866850.1|422612_423854_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.3	1.5e-117
WP_065866851.1|426789_427944_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065866852.1|427948_429379_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046813920.1|429381_430080_+	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
WP_003626912.1|430067_430538_+	SprT family protein	NA	NA	NA	NA	NA
WP_003633047.1|430775_431423_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
WP_065866853.1|431508_433755_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	5.3e-132
WP_065866854.1|433795_435802_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.9	3.2e-104
WP_020829042.1|435814_436963_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003633051.1|436976_437285_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003626902.1|437284_438724_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_012211519.1|438728_440159_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_065866855.1|440183_441104_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.8	9.3e-19
WP_003626897.1|441170_441863_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_046813922.1|441906_442611_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003626893.1|442792_443134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813923.1|443170_444547_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003626890.1|444911_446264_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
WP_065866856.1|447750_448713_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_065866857.1|448731_449910_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_065866930.1|449930_450716_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_012211526.1|452780_452981_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	1.4e-20
WP_023190958.1|453243_453633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866858.1|454998_455499_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003627960.1|455601_456210_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_065866835.1|456239_457565_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.5	4.3e-57
WP_060471716.1|462056_462293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079227754.1|462458_462995_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211430.1|463183_464461_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211358.1|466499_467678_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_065866861.1|468320_469397_+	cell surface protein	NA	NA	NA	NA	NA
WP_012211358.1|469635_470814_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	490685	555606	2053066	bacteriocin,transposase	Bacillus_phage(23.08%)	53	NA	NA
WP_065866866.1|490685_491915_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	36.6	1.4e-49
WP_012211542.1|492669_493410_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	7.2e-38
WP_012211543.1|493420_494239_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211544.1|494238_494880_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012211545.1|494894_495548_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_065866867.1|497553_498855_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003626829.1|499004_500348_-	PFL family protein	NA	NA	NA	NA	NA
WP_014919426.1|500360_500630_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_065866868.1|500784_502191_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_065866869.1|502411_503215_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_012211551.1|503328_504255_+	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_012211552.1|504254_504947_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_012211553.1|505007_507023_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.4	1.3e-65
WP_012211554.1|507140_508067_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_023190338.1|508865_509060_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_147628261.1|509115_510339_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.0	2.4e-115
WP_012211556.1|510458_510752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211557.1|510841_511660_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003626810.1|512712_513507_+	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
WP_012211559.1|513518_514796_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_012211560.1|514770_516009_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	4.7e-98
WP_012211561.1|515995_516457_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012211562.1|516449_517853_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012211563.1|517852_518176_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_012211564.1|518262_518628_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_065866871.1|518633_519398_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_065866872.1|519694_522094_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012211567.1|522167_523016_+	patatin family protein	NA	NA	NA	NA	NA
WP_065866873.1|527708_528194_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_079227881.1|528286_529552_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_012211571.1|529732_531094_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012211570.1|531936_532209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190478.1|533841_534411_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	4.9e-10
WP_012211573.1|535744_536449_+	lysozyme	NA	NA	NA	NA	NA
WP_065866874.1|536448_537681_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	2.1e-34
WP_023190482.1|537677_539006_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014919182.1|539173_539362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211575.1|539469_540612_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.6	4.2e-29
WP_012211576.1|540635_541175_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003626773.1|541167_541614_-	flavodoxin	NA	NA	NA	NA	NA
WP_065866875.1|541757_542585_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_065866876.1|542593_543517_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003626768.1|543578_544478_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
WP_079227881.1|544675_545941_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_065866877.1|547444_548605_+	thiolase family protein	NA	NA	NA	NA	NA
WP_065866878.1|548604_549816_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_023190743.1|549815_550979_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_065866879.1|551017_551302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190745.1|551383_551608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866880.1|552702_553044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035513324.1|553075_553300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866881.1|553314_553587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866883.1|554199_555606_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	771905	838776	2053066	transposase,protease,tRNA	Staphylococcus_virus(25.0%)	53	NA	NA
WP_023062061.1|771905_774689_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	8.9e-89
WP_003627651.1|774688_774892_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_012211705.1|774911_775481_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003627649.1|775483_775792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211706.1|775809_776505_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_023190853.1|776506_777664_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.6	1.8e-27
WP_065866337.1|777711_778053_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_012211708.1|778060_779188_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_012211710.1|779281_779941_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012211711.1|779940_780585_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211712.1|780584_782936_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.0	2.1e-59
WP_041810698.1|783978_785658_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003627933.1|785664_785886_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003628072.1|786236_786791_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	3.6e-10
WP_003628073.1|787043_788888_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	41.5	3.6e-22
WP_023190858.1|788983_790165_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_012211716.1|790161_790506_+	YlbG family protein	NA	NA	NA	NA	NA
WP_012211717.1|790502_791051_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003627939.1|791053_791548_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
WP_012211718.1|791531_792566_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_012211719.1|792643_793339_+	competence protein	NA	NA	NA	NA	NA
WP_023190860.1|793307_795596_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	8.2e-24
WP_003627943.1|795592_796579_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_014919008.1|796639_796897_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003628079.1|797095_797365_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_023190861.1|797521_799294_+	ribonuclease J	NA	NA	NA	NA	NA
WP_012211722.1|799296_800130_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211723.1|800319_801510_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.3	2.3e-30
WP_012211724.1|801660_803019_+	trigger factor	NA	NA	NA	NA	NA
WP_065866338.1|803149_804424_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.4	8.7e-132
WP_012211726.1|804413_805004_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_065866339.1|804968_806705_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_065866340.1|808486_809491_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_065866341.1|809483_810857_-	aspartate kinase	NA	NA	NA	NA	NA
WP_065866342.1|811328_812645_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003626729.1|812664_813375_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_065866343.1|813377_814532_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_065866344.1|814533_815469_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_065866345.1|815461_816241_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003626723.1|816261_817428_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012211734.1|817439_818498_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_147628221.1|818601_819702_+	serine hydrolase	NA	NA	NA	NA	NA
WP_079227764.1|819758_820334_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012211736.1|820378_821989_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_065866346.1|822273_823131_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_079227765.1|823393_825124_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_014564905.1|825771_826794_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_065866347.1|826953_828306_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.9	1.2e-51
WP_014564907.1|828325_830107_+	adenine deaminase	NA	NA	NA	NA	NA
WP_065866348.1|830493_832278_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.8e-88
WP_012211741.1|834944_835499_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.4	2.1e-34
WP_065866349.1|835495_836950_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.2	1.1e-95
WP_079227767.1|837072_838776_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	2.3e-87
>prophage 7
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	842212	910213	2053066	transposase,tRNA	Lactobacillus_phage(16.67%)	58	NA	NA
WP_012211430.1|842212_843490_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_065866352.1|843741_844983_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
WP_065866353.1|846081_847464_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_012211749.1|848625_849114_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012211750.1|849945_851232_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_065866902.1|851454_852285_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.6	3.0e-48
WP_065866355.1|852261_853998_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_012211752.1|854142_854718_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012211358.1|855993_857172_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211753.1|857415_857784_-	antitoxin HicB	NA	A0A0A7S1E5	Clostridium_phage	38.9	9.2e-10
WP_079227905.1|857805_857877_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012211754.1|858281_859670_+	amino acid permease	NA	NA	NA	NA	NA
WP_003626673.1|859811_860768_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
WP_012211755.1|860782_861301_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	2.2e-25
WP_023190625.1|861420_861624_+	hypothetical protein	NA	Q9AZG0	Lactococcus_phage	50.0	5.6e-09
WP_023190626.1|861636_861819_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012211430.1|861887_863165_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211756.1|863386_865804_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	20.2	1.2e-17
WP_065866356.1|866154_867015_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211758.1|867027_868089_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.1e-30
WP_012211759.1|868081_868783_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003626652.1|870285_870510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866357.1|870697_872101_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003628121.1|872112_873489_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	5.8e-57
WP_023190712.1|873783_874104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812709.1|874094_874787_+	mucus-binding protein	NA	NA	NA	NA	NA
WP_003628125.1|874773_875076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866358.1|875123_875291_+	mucus-binding protein	NA	NA	NA	NA	NA
WP_012211763.1|875325_876162_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_023190710.1|876158_876404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866359.1|876472_876787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866360.1|876856_877141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211765.1|877818_878745_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_147628223.1|881211_881850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866362.1|881872_882352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866363.1|882451_883765_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.3	5.0e-58
WP_012211771.1|884083_885550_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_065866364.1|885628_886423_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012211774.1|886513_887566_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_003628158.1|887555_887849_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_065866365.1|887849_888764_+	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_012211776.1|888753_890295_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_065866366.1|892963_893419_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_065866367.1|893629_894463_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_065866368.1|894455_896165_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	1.3e-18
WP_065866369.1|896177_896735_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211781.1|896866_897247_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_012211782.1|897501_897834_-	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	43.6	4.4e-19
WP_012211783.1|897835_898789_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_065866370.1|898958_900305_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003628193.1|900407_900914_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_012211358.1|902594_903773_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211785.1|903991_904501_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_065866371.1|904561_905509_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_079227775.1|905477_905927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866372.1|905941_908182_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.0	1.0e-10
WP_012211788.1|908181_908619_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_012211789.1|908926_910213_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.3	1.8e-20
>prophage 8
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	949429	1014662	2053066	integrase,transposase,protease,tRNA	Staphylococcus_phage(13.33%)	56	946616:946634	973656:973674
946616:946634	attL	AAAGTGTCTGGGAAATAAC	NA	NA	NA	NA
WP_012211821.1|949429_950629_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	8.6e-49
WP_003628329.1|950667_951360_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003626512.1|951476_952307_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.9	5.3e-21
WP_003626511.1|952309_952540_+	YozE family protein	NA	NA	NA	NA	NA
WP_065866383.1|952587_954180_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_012211824.1|954203_955055_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_012211825.1|955044_955797_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.6	1.3e-26
WP_003628334.1|955857_956706_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	4.9e-30
WP_012211826.1|956777_958892_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.2	1.5e-96
WP_023191156.1|958925_960242_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_003626495.1|960241_961150_+	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
WP_003628338.1|961158_961683_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_065866384.1|961693_963097_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.1	2.6e-28
WP_065866385.1|963258_964158_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_012211833.1|965172_965988_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_003628344.1|967668_968052_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
WP_003628346.1|968053_968431_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_065866386.1|970264_972361_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_012211842.1|972377_973637_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_065866387.1|973801_975532_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	3.0e-87
973656:973674	attR	AAAGTGTCTGGGAAATAAC	NA	NA	NA	NA
WP_023190807.1|976500_978273_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	2.9e-77
WP_003628456.1|978381_978831_+	Trp operon repressor	NA	NA	NA	NA	NA
WP_065866388.1|979059_979692_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012211845.1|979792_980407_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_012211846.1|980531_981629_+	serine hydrolase	NA	NA	NA	NA	NA
WP_079227777.1|981635_982523_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_012211848.1|982522_983080_+	membrane protein	NA	NA	NA	NA	NA
WP_012211849.1|983162_984368_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_065866389.1|984416_985751_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_023191009.1|985910_987197_+	peptidase T	NA	NA	NA	NA	NA
WP_023191010.1|987202_987415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628488.1|987956_988307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866390.1|988398_989031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563664.1|988943_989489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052541195.1|990458_991040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211857.1|992375_993086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866392.1|993196_994375_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.0	5.4e-120
WP_065866393.1|994557_994995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866394.1|995083_995560_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003628508.1|995824_996244_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_020829165.1|996259_997021_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_003626474.1|997023_997647_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014563645.1|998037_998397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023191285.1|998506_998998_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_065866395.1|999502_1000738_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.1	1.6e-53
WP_065866396.1|1001016_1001295_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_065866397.1|1001294_1001642_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_065866398.1|1002026_1002530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866399.1|1003033_1003333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866400.1|1003362_1003998_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866402.1|1004794_1007299_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.0	1.2e-137
WP_065866403.1|1007887_1008505_+	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_003628533.1|1008659_1009094_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626445.1|1009090_1009519_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_065866404.1|1009842_1011357_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.6	1.1e-24
WP_065866407.1|1013459_1014662_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	30.2	6.9e-38
>prophage 9
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	1044020	1113414	2053066	integrase,transposase	Bacillus_phage(20.0%)	43	1086096:1086121	1118889:1118914
WP_065866421.1|1044020_1044950_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	51.3	3.6e-87
WP_079227785.1|1045015_1046074_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065866423.1|1046179_1049203_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.3	1.9e-15
WP_014564904.1|1050471_1051737_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_012211885.1|1051739_1052558_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_023191117.1|1052550_1053042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866424.1|1054390_1055296_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_079227788.1|1059719_1065005_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.9	1.5e-07
WP_065866427.1|1066262_1068209_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	1.8e-59
WP_003619518.1|1068406_1068772_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_147628227.1|1069057_1070389_+	amino acid permease	NA	NA	NA	NA	NA
WP_065866429.1|1071084_1072272_+	amidohydrolase	NA	NA	NA	NA	NA
WP_065866906.1|1074972_1076220_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_012211895.1|1078102_1078636_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_079227881.1|1078837_1080103_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_023190467.1|1080269_1080500_+	Replication-associated protein RepA	NA	NA	NA	NA	NA
WP_101812669.1|1080544_1081186_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003626373.1|1082717_1082957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190890.1|1083985_1084321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628653.1|1084703_1086083_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
1086096:1086121	attL	ATACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
WP_065866431.1|1086194_1086935_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065866432.1|1088318_1089722_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_065866433.1|1089923_1090937_+	serine hydrolase	NA	NA	NA	NA	NA
WP_012211903.1|1091898_1094637_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_035513343.1|1094672_1094885_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014918760.1|1096360_1096858_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_052541144.1|1096893_1097307_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_012211907.1|1097308_1097746_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626351.1|1098275_1098929_-	endonuclease III	NA	NA	NA	NA	NA
WP_065866435.1|1099066_1099276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614991.1|1099355_1099706_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_065866436.1|1099702_1100776_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	42.3	8.0e-38
WP_065866437.1|1100759_1102097_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003614994.1|1102086_1103178_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_003622249.1|1103189_1103726_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003615004.1|1104947_1105607_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003626333.1|1105587_1106262_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_065866907.1|1106271_1107012_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	2.0e-32
WP_003613446.1|1107023_1107884_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014563535.1|1108702_1109734_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
WP_003626323.1|1109847_1110348_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	45.4	1.6e-33
WP_012211358.1|1111295_1112474_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003626321.1|1112793_1113414_+|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	36.4	4.3e-20
1118889:1118914	attR	AACGATTTAACTAGCACCACGCGTAT	NA	NA	NA	NA
>prophage 10
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	1207856	1275849	2053066	transposase,protease,tRNA	Lactobacillus_virus(10.0%)	53	NA	NA
WP_065866467.1|1207856_1208885_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.7	2.6e-46
WP_003627474.1|1209051_1209657_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_012211984.1|1209836_1211003_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014918653.1|1211123_1211660_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_065866468.1|1214118_1215309_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.2	6.0e-127
WP_012211987.1|1216383_1217238_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065866469.1|1217366_1219640_+	HAD-IC family P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	25.5	7.1e-44
WP_079227799.1|1219707_1220208_-	lactocepin S-layer protein	NA	NA	NA	NA	NA
WP_012211992.1|1222773_1223703_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.5	2.2e-100
WP_003628968.1|1223846_1224374_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012211993.1|1224478_1226752_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	3.7e-77
WP_003627502.1|1226872_1227562_-	class A sortase	NA	NA	NA	NA	NA
WP_065866471.1|1227564_1229403_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	4.0e-21
WP_012211995.1|1229877_1231032_-	molecular chaperone DnaJ	NA	A0A167RAM8	Powai_lake_megavirus	29.0	1.4e-19
WP_065866472.1|1231113_1232940_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	9.2e-143
WP_023190314.1|1232957_1233557_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_065866473.1|1233572_1234622_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_147628229.1|1234791_1235739_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	6.0e-05
WP_065866475.1|1235759_1236653_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012211999.1|1236704_1237070_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_065866476.1|1237089_1239702_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
WP_065866477.1|1239706_1240018_-	50S ribosomal protein L7	NA	NA	NA	NA	NA
WP_012212001.1|1240020_1240317_-	YlxR family protein	NA	NA	NA	NA	NA
WP_012212002.1|1240325_1241507_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_065866478.1|1241526_1242003_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_065866479.1|1242112_1246423_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.1	1.2e-18
WP_065866480.1|1246428_1248126_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_020829285.1|1248168_1249425_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003629019.1|1249435_1250251_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014918626.1|1250252_1250987_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.7	5.0e-23
WP_023190307.1|1250989_1251547_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_014563421.1|1251546_1252272_-	UMP kinase	NA	NA	NA	NA	NA
WP_065866481.1|1252410_1253436_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_023190305.1|1253469_1254243_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_023190304.1|1254404_1255436_-	methyltransferase	NA	NA	NA	NA	NA
WP_003627532.1|1255501_1256116_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_012212008.1|1256175_1257357_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
WP_023190303.1|1257414_1259358_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.2	3.6e-60
WP_147628266.1|1259452_1261129_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	23.0	2.9e-18
WP_147628231.1|1262297_1263521_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.1	1.9e-112
WP_079227804.1|1264600_1265866_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.3e-10
WP_012212011.1|1267631_1267850_-	YneF family protein	NA	NA	NA	NA	NA
WP_003627541.1|1267912_1268176_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003627542.1|1268326_1268953_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_012212014.1|1268981_1269767_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012212015.1|1269759_1270419_-	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	30.9	2.8e-09
WP_003629071.1|1270807_1271155_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003627547.1|1271267_1271987_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003629074.1|1271976_1272492_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003627549.1|1272560_1272833_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_065866484.1|1272923_1274354_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003627552.1|1274358_1274700_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_065866485.1|1274814_1275849_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.2e-32
>prophage 12
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	1481475	1549190	2053066	transposase,bacteriocin,tRNA	Bacillus_phage(23.08%)	54	NA	NA
WP_065866559.1|1481475_1483410_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.2	2.8e-97
WP_012212130.1|1483700_1484609_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
WP_065866560.1|1484641_1485973_-	chromosome replication initiation protein	NA	NA	NA	NA	NA
WP_003627138.1|1485975_1486443_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_065866561.1|1486445_1487048_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003627142.1|1487044_1487875_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
WP_065866562.1|1487883_1490547_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.4	2.0e-61
WP_023192833.1|1493734_1494016_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_065866563.1|1494021_1495011_-	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_065866564.1|1495020_1495512_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_065866565.1|1495527_1497957_-	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	23.5	4.8e-30
WP_065866566.1|1498099_1498813_-	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_023192831.1|1498799_1499702_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_065866567.1|1499720_1501478_-	type I-B CRISPR-associated protein Cas8b1/Cst1	NA	NA	NA	NA	NA
WP_003627162.1|1501495_1502251_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_003629695.1|1504740_1505394_-	flavodoxin	NA	NA	NA	NA	NA
WP_003629702.1|1505538_1506420_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_012212140.1|1506437_1506752_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003627169.1|1506906_1507044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866568.1|1507158_1508136_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_065866569.1|1508273_1509788_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_065866570.1|1509876_1510854_+	cell surface protein	NA	NA	NA	NA	NA
WP_012212142.1|1510908_1512222_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_012212143.1|1512376_1512829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629717.1|1513047_1513224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866571.1|1513401_1514034_+	aggregation promoting protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	7.1e-18
WP_003629734.1|1514068_1514713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866573.1|1516631_1521602_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.8	3.1e-15
WP_065866574.1|1522256_1523114_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866575.1|1523664_1524990_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.8	2.8e-56
WP_012212126.1|1525019_1525628_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_025283820.1|1525735_1525933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191293.1|1527651_1528959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866577.1|1529010_1529658_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_023191989.1|1529677_1529998_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012212149.1|1530067_1530721_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_065866578.1|1530732_1531920_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003627193.1|1531912_1532656_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.7e-18
WP_014918422.1|1532670_1533006_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_003627195.1|1533035_1533290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212153.1|1533501_1533939_+	HIT family protein	NA	NA	NA	NA	NA
WP_003627197.1|1533948_1534284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212154.1|1534402_1535305_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_065866579.1|1535443_1535866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065866580.1|1535811_1537569_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.6e-88
WP_003627200.1|1537716_1538694_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_065866581.1|1538686_1541188_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003627202.1|1541168_1542389_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_003627204.1|1542397_1542748_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_065866582.1|1542768_1544826_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_012212158.1|1544914_1545772_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003627210.1|1545811_1545958_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012212159.1|1547014_1547767_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	30.7	1.4e-25
WP_012211430.1|1547912_1549190_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
>prophage 13
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	1615774	1676371	2053066	holin,transposase,tRNA	uncultured_virus(14.29%)	48	NA	NA
WP_079227881.1|1615774_1617040_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_147628234.1|1624293_1625223_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2K9L162	Tupanvirus	25.5	8.2e-15
WP_065866594.1|1625231_1625882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211469.1|1625896_1626505_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_003632178.1|1626501_1627281_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_012211468.1|1627280_1627904_-	YutD family protein	NA	NA	NA	NA	NA
WP_065866595.1|1627887_1629279_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4W5J5	Pandoravirus	22.4	1.0e-05
WP_003627737.1|1629293_1629614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211466.1|1629707_1631078_+	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.5	1.6e-11
WP_012211465.1|1631158_1632160_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	1.1e-20
WP_023191004.1|1632306_1633413_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012211463.1|1633478_1633850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211462.1|1633867_1634293_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_012211461.1|1634426_1635278_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_065866596.1|1635445_1636690_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.3	3.1e-09
WP_065866597.1|1638436_1639057_-	XTP/dITP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	34.0	5.1e-13
WP_065866598.1|1639056_1639860_-	glutamate racemase	NA	NA	NA	NA	NA
WP_065866599.1|1639936_1640350_+	YslB family protein	NA	NA	NA	NA	NA
WP_065866600.1|1640484_1641342_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065866601.1|1641412_1641784_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003627748.1|1641828_1642140_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.8	1.3e-17
WP_065866602.1|1642240_1644598_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
WP_003627751.1|1644661_1644973_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_014563089.1|1644974_1645403_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003627753.1|1645402_1645660_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_065866603.1|1645720_1648360_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	6.1e-63
WP_065866604.1|1648629_1649115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211447.1|1649702_1651064_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	4.4e-49
WP_065866605.1|1651056_1652013_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003631554.1|1652072_1653194_-	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	24.5	2.4e-16
WP_065866606.1|1653186_1654638_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.4	3.3e-63
WP_003627763.1|1654773_1655208_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003627765.1|1655269_1656286_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
WP_003627766.1|1656334_1656925_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_025283302.1|1656925_1658836_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	4.4e-55
WP_147628276.1|1658835_1661412_-	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	1.6e-39
WP_012211438.1|1661592_1663215_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.0	4.4e-157
WP_003627770.1|1663268_1663553_-	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
WP_065866608.1|1663768_1664299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061469.1|1664596_1664689_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_079227838.1|1664832_1665126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812609.1|1667081_1667612_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_065866609.1|1669142_1670876_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_012211434.1|1670840_1671587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866610.1|1671583_1672042_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625963.1|1672181_1672829_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003625961.1|1673003_1674917_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	3.5e-60
WP_065866611.1|1675093_1676371_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	4.0e-12
>prophage 14
NZ_CP020029	Lactobacillus helveticus strain D75, complete genome	2053066	1762744	1799930	2053066	bacteriocin,transposase,protease,tRNA	Lactobacillus_virus(25.0%)	27	NA	NA
WP_065866629.1|1762744_1765225_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.3	4.8e-118
WP_003625767.1|1765329_1765785_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_065866630.1|1766150_1766633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190458.1|1766945_1768496_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.5e-82
WP_012211369.1|1768511_1769540_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_065866631.1|1769614_1770505_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_065866632.1|1770557_1772723_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	48.0	6.0e-109
WP_003625756.1|1772817_1774074_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_003625754.1|1774115_1774478_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211366.1|1774477_1774855_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003625749.1|1774920_1775163_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_065866633.1|1775174_1778672_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012211364.1|1778673_1779231_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012211363.1|1779365_1780337_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003631233.1|1780524_1781232_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_023190465.1|1782015_1783146_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	7.2e-29
WP_003625735.1|1783148_1783505_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_012211361.1|1783587_1785099_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	3.8e-70
WP_003625729.1|1785111_1786479_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003625728.1|1786604_1786850_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_065866634.1|1787034_1787865_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_079227848.1|1788051_1789281_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.2	9.9e-125
WP_014562970.1|1789581_1790658_-	surface layer protein	NA	NA	NA	NA	NA
WP_065866636.1|1790747_1791497_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_012211358.1|1791860_1793039_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003625618.1|1796682_1797918_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.2e-101
WP_079227850.1|1798700_1799930_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.4	2.9e-116
