The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017075	Novosphingobium resinovorum strain SA1, complete genome	3778345	1230306	1238949	3778345		Bordetella_phage(14.29%)	15	NA	NA
WP_069707761.1|1230306_1231425_-	AAA family ATPase	NA	A0A291LA07	Bordetella_phage	56.1	8.4e-115
WP_083274586.1|1231421_1231790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707762.1|1231792_1232200_-	hypothetical protein	NA	A0A076GCY8	Sinorhizobium_phage	41.2	3.1e-19
WP_083274587.1|1232192_1232579_-	DUF968 domain-containing protein	NA	R9TF58	Synechococcus_phage	43.7	5.6e-18
WP_083274588.1|1232582_1233074_-	HNH endonuclease	NA	A0A0B4N249	Escherichia_phage	37.6	8.8e-16
WP_069707764.1|1233082_1233679_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	66.7	4.6e-43
WP_069707765.1|1233680_1234043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707766.1|1234045_1235008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707767.1|1235019_1235829_-	hypothetical protein	NA	A0A1J0MBW0	Streptomyces_phage	40.5	9.1e-18
WP_069707768.1|1235825_1236056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707769.1|1236052_1236445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156799770.1|1236448_1236778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707772.1|1237450_1237930_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069707773.1|1238014_1238209_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069707774.1|1238205_1238949_+	hypothetical protein	NA	A0A1X9HWI4	Ruegeria_phage	40.0	9.1e-41
>prophage 2
NZ_CP017075	Novosphingobium resinovorum strain SA1, complete genome	3778345	1243811	1266138	3778345	terminase	Aeromonas_phage(30.0%)	28	NA	NA
WP_069707784.1|1243811_1244393_+	hypothetical protein	NA	A0A059VJU8	Pseudomonas_phage	49.7	4.3e-46
WP_069707785.1|1244394_1244892_+	DUF2280 domain-containing protein	NA	A0A0S2SY97	Pseudomonas_phage	54.2	1.4e-29
WP_069707786.1|1244997_1245630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799914.1|1245847_1246000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707787.1|1245996_1246266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799915.1|1246331_1247771_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2R3UAK7	Myoviridae_environmental_samples	53.5	1.4e-141
WP_069707788.1|1247920_1249819_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.7	9.0e-101
WP_083274590.1|1249821_1250622_+	hypothetical protein	NA	A0A077KGU5	Edwardsiella_phage	44.7	1.7e-40
WP_069707789.1|1250662_1251940_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	39.6	2.7e-64
WP_069707790.1|1251943_1252441_+	hypothetical protein	NA	A0A2R3UAX9	Myoviridae_environmental_samples	46.1	3.1e-21
WP_069707791.1|1252442_1253477_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.6	1.1e-79
WP_069707792.1|1253480_1253861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707793.1|1253870_1254308_+	DUF4054 domain-containing protein	NA	Q8HAQ1	Burkholderia_phage	43.7	1.5e-14
WP_156799776.1|1254295_1254823_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	33.6	8.5e-09
WP_083274592.1|1254822_1255230_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	34.6	2.2e-12
WP_083274593.1|1255226_1255790_+	hypothetical protein	NA	H9C0W4	Aeromonas_phage	35.4	9.7e-19
WP_069707794.1|1255791_1257279_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	34.6	1.5e-66
WP_069707795.1|1257291_1257738_+	hypothetical protein	NA	H9C0W6	Aeromonas_phage	39.2	4.4e-22
WP_156799777.1|1258451_1259219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707797.1|1259264_1260758_+	hypothetical protein	NA	A0A0A0PL45	Bacillus_phage	35.2	1.0e-14
WP_069707798.1|1260757_1261375_+	hypothetical protein	NA	H9C0X3	Aeromonas_phage	27.8	3.7e-11
WP_069707799.1|1261371_1261665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707800.1|1261664_1262534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707801.1|1262530_1263217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707802.1|1263228_1263564_+	hypothetical protein	NA	B7X9X8	uncultured_phage	44.8	1.5e-11
WP_069707803.1|1263560_1264769_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	40.5	8.1e-71
WP_083274594.1|1264765_1265398_+	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	41.5	1.5e-28
WP_069707804.1|1265397_1266138_+	hypothetical protein	NA	A0A219YBC2	Aeromonas_phage	37.3	3.1e-17
>prophage 3
NZ_CP017075	Novosphingobium resinovorum strain SA1, complete genome	3778345	1529973	1539237	3778345		Escherichia_phage(16.67%)	9	NA	NA
WP_069707920.1|1529973_1531500_-	DEAD/DEAH box helicase	NA	A0A088FRR6	Escherichia_phage	41.7	7.3e-77
WP_069707921.1|1531496_1532231_-	hypothetical protein	NA	A0A2H5BFW5	Vibrio_phage	65.9	7.3e-91
WP_069707922.1|1532227_1532482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707923.1|1532478_1532790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707924.1|1532835_1534905_-	hypothetical protein	NA	M4QRH3	Loktanella_phage	39.8	8.8e-126
WP_083274744.1|1534901_1535708_-	hypothetical protein	NA	Q6V7R9	Burkholderia_virus	49.6	8.7e-21
WP_069707926.1|1536649_1536841_-	hypothetical protein	NA	M4QP85	Synechococcus_phage	44.8	3.4e-08
WP_069707927.1|1537112_1537832_-	DUF2815 family protein	NA	NA	NA	NA	NA
WP_083274616.1|1537869_1539237_-	DUF2800 domain-containing protein	NA	A0A097EW45	Ruegeria_phage	36.2	1.7e-64
>prophage 4
NZ_CP017075	Novosphingobium resinovorum strain SA1, complete genome	3778345	1549915	1592422	3778345	portal,integrase	Klebsiella_phage(16.13%)	56	1560992:1561007	1599949:1599964
WP_069707945.1|1549915_1550485_+	hypothetical protein	NA	B4UTT6	Rhizobium_phage	50.6	2.0e-40
WP_083274745.1|1550781_1551855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799801.1|1551851_1552694_+	thymidylate synthase	NA	L7TM66	Rhizobium_phage	66.8	1.6e-110
WP_069707948.1|1552690_1552966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799802.1|1552934_1553339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707950.1|1553335_1554001_+	3'-5' exoribonuclease	NA	W6E9Q9	Rhizobium_phage	39.5	9.1e-32
WP_156799803.1|1553997_1554678_+	hypothetical protein	NA	L7TJ75	Rhizobium_phage	39.4	2.5e-29
WP_069707952.1|1554705_1555188_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_069707953.1|1555200_1556220_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	63.4	1.0e-119
WP_069707954.1|1556390_1556648_+	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	59.7	1.4e-17
WP_069707955.1|1556650_1557034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707956.1|1557030_1557693_+	hypothetical protein	NA	A0A1V0DX34	Synechococcus_virus	53.8	9.6e-58
WP_083274618.1|1557780_1558161_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069707958.1|1558212_1558479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799804.1|1558742_1559348_-	hypothetical protein	NA	D7NW86	Streptomyces_phage	28.3	2.7e-06
WP_069707959.1|1559344_1560589_-	hypothetical protein	NA	A0A2I7S6I0	Vibrio_phage	51.5	4.8e-103
WP_069707960.1|1560575_1560914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707961.1|1560910_1561186_-	hypothetical protein	NA	NA	NA	NA	NA
1560992:1561007	attL	CCGCGCGGCCGCATCG	NA	NA	NA	NA
WP_156799805.1|1561182_1561611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707963.1|1561610_1561943_-	ammonia monooxygenase	NA	A0A291AUV3	Sinorhizobium_phage	57.9	1.5e-35
WP_069707964.1|1561942_1562539_-	N-acetylmuramidase	NA	A0A191ZCU8	Erwinia_phage	50.8	3.8e-45
WP_069707965.1|1562525_1562786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707966.1|1562790_1563159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156799806.1|1563310_1564360_+	hypothetical protein	NA	E1A2I4	Aeromonas_phage	42.4	2.9e-69
WP_069707968.1|1564356_1564920_+	hypothetical protein	NA	A0A060AD14	Cronobacter_phage	34.3	1.6e-21
WP_069707969.1|1564982_1565222_+	hypothetical protein	NA	K4F774	Cronobacter_phage	55.6	6.8e-14
WP_069707970.1|1565280_1565583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799807.1|1565579_1565951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799808.1|1565947_1566205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069707972.1|1566283_1566955_-	DUF2793 domain-containing protein	NA	NA	NA	NA	NA
WP_069707973.1|1566967_1569694_-	hypothetical protein	NA	A0A0K2FI44	Achromobacter_phage	33.0	3.6e-119
WP_069707974.1|1569695_1569887_-	hypothetical protein	NA	A0A248XCS8	Klebsiella_phage	52.5	1.2e-10
WP_069707975.1|1569883_1570117_-	hypothetical protein	NA	G8DCS0	Silicibacter_phage	42.9	5.2e-11
WP_069707976.1|1570233_1570716_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_083274621.1|1570874_1571843_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_069707979.1|1573056_1577253_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A248XD76	Klebsiella_phage	29.7	6.8e-24
WP_069707980.1|1577257_1577476_-	hypothetical protein	NA	H6WYH8	Enterobacter_phage	44.4	2.1e-09
WP_069707981.1|1577499_1577976_-	hypothetical protein	NA	I6NLJ1	Burkholderia_phage	34.0	1.5e-12
WP_069707982.1|1577989_1578760_-	hypothetical protein	NA	A0A1V0DX22	Synechococcus_virus	54.7	7.2e-73
WP_069707983.1|1579468_1580035_-	hypothetical protein	NA	A0A097EW19	Ruegeria_phage	41.3	8.5e-23
WP_069707984.1|1580034_1580655_-	hypothetical protein	NA	A0A0K2FI54	Achromobacter_phage	46.0	7.6e-33
WP_069707985.1|1580651_1581017_-	hypothetical protein	NA	A0A248XD53	Klebsiella_phage	36.5	6.5e-08
WP_069707986.1|1581024_1581330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707987.1|1581388_1582504_-	hypothetical protein	NA	M4QRI3	Loktanella_phage	44.9	4.8e-86
WP_069707988.1|1582539_1583022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707989.1|1583034_1584339_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	43.4	1.4e-81
WP_083274622.1|1584429_1586184_-|portal	phage portal protein	portal	A0A097EVZ4	Ruegeria_phage	49.3	3.8e-146
WP_069707991.1|1586141_1586369_-	hypothetical protein	NA	G8DCP3	Silicibacter_phage	52.2	1.9e-10
WP_083274623.1|1586418_1588614_-	hypothetical protein	NA	A0A248XD48	Klebsiella_phage	47.7	6.0e-189
WP_069707992.1|1588610_1588838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083274624.1|1588830_1589613_-	DUF1441 family protein	NA	A0A0K2FHW7	Achromobacter_phage	27.5	5.5e-12
WP_083274625.1|1589971_1590148_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_156799809.1|1590433_1590667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069707996.1|1590719_1590959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083274626.1|1590955_1591174_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069707997.1|1591198_1592422_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	44.6	2.9e-76
1599949:1599964	attR	CCGCGCGGCCGCATCG	NA	NA	NA	NA
>prophage 5
NZ_CP017075	Novosphingobium resinovorum strain SA1, complete genome	3778345	2327181	2343026	3778345	tail,terminase	Vibrio_phage(27.27%)	22	NA	NA
WP_069709223.1|2327181_2328696_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	51.3	2.1e-129
WP_156799836.1|2328682_2328865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799837.1|2329021_2329540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708281.1|2329577_2329841_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	48.9	3.0e-15
WP_069708282.1|2329840_2330047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708283.1|2330046_2330232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708284.1|2330231_2331893_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	33.5	1.8e-73
WP_069708285.1|2331894_2332311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708286.1|2332307_2332655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708287.1|2332632_2333475_+	hypothetical protein	NA	A0A2I7QLA2	Vibrio_phage	35.3	1.8e-16
WP_069708288.1|2333477_2334515_+	hypothetical protein	NA	A0A2I7QL96	Vibrio_phage	41.7	1.8e-63
WP_069708289.1|2334575_2335010_+	hypothetical protein	NA	A0A2I7QL94	Vibrio_phage	45.0	5.9e-16
WP_069708290.1|2335009_2335333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708291.1|2335379_2335922_+	hypothetical protein	NA	R4T8F0	Halovirus	37.1	1.5e-05
WP_156799838.1|2335909_2336428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799839.1|2336502_2336733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708294.1|2336833_2337469_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	29.3	6.7e-08
WP_069708295.1|2337468_2338131_+	hypothetical protein	NA	M1HLI2	Pelagibacter_phage	37.0	2.5e-21
WP_069708296.1|2338130_2339945_+	hypothetical protein	NA	W6MWW6	Pseudomonas_phage	30.6	1.8e-74
WP_069708297.1|2339937_2340399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708298.1|2340398_2340896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708299.1|2340896_2343026_+	efflux RND transporter permease subunit	NA	A0A076YQK7	Mesorhizobium_phage	45.4	5.5e-22
>prophage 6
NZ_CP017075	Novosphingobium resinovorum strain SA1, complete genome	3778345	2470127	2520658	3778345	integrase,transposase,protease	Gordonia_phage(16.67%)	44	2497196:2497212	2507177:2507193
WP_008827764.1|2470127_2471546_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_008827763.1|2471719_2472127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708366.1|2472312_2472510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708367.1|2472506_2472908_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_069708368.1|2472937_2474416_+	thiol-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_155986299.1|2474422_2474674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036526853.1|2474843_2475179_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069708369.1|2475171_2476419_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_036526850.1|2477449_2479009_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_069708370.1|2479653_2480739_-	acyltransferase family protein	NA	A0A142KBN9	Gordonia_phage	27.9	1.3e-11
WP_008827630.1|2481027_2483562_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	32.6	2.8e-105
WP_069708371.1|2483691_2484873_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X6WGT4	Pacmanvirus	25.1	4.0e-14
WP_156799845.1|2485353_2486430_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_008827633.1|2486801_2487062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708373.1|2487279_2487573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036526845.1|2487915_2489367_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_069708374.1|2489542_2490442_+	DMT family transporter	NA	NA	NA	NA	NA
WP_069708375.1|2490585_2493261_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_069708376.1|2493344_2493797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083274653.1|2493956_2494625_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_156799846.1|2494585_2494909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708379.1|2495076_2495547_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_069708380.1|2495534_2496152_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_156799847.1|2496162_2496360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069709229.1|2496630_2496891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799848.1|2496908_2497706_+	hypothetical protein	NA	NA	NA	NA	NA
2497196:2497212	attL	CGCGATCGCTGCGCGCC	NA	NA	NA	NA
WP_069708382.1|2497712_2499230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708383.1|2500014_2501256_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.9	2.0e-93
WP_069708384.1|2504703_2505036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708385.1|2505112_2505307_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083274654.1|2505293_2506187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799849.1|2506177_2506666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708387.1|2506505_2507432_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
2507177:2507193	attR	CGCGATCGCTGCGCGCC	NA	NA	NA	NA
WP_156799850.1|2508347_2509480_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069708390.1|2509615_2510074_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_069708391.1|2510162_2510720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708392.1|2510764_2511517_-	HAD-IIB family hydrolase	NA	L7RCU0	Acanthamoeba_polyphaga_moumouvirus	23.6	1.9e-06
WP_069708393.1|2511683_2512730_-	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_036526825.1|2512958_2513783_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_069708394.1|2513779_2515594_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_069708395.1|2515683_2517174_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_083274657.1|2518279_2518705_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_008827841.1|2518701_2519055_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069708397.1|2519104_2520658_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.7	4.4e-45
>prophage 8
NZ_CP017075	Novosphingobium resinovorum strain SA1, complete genome	3778345	3302638	3347026	3778345	capsid,tRNA,head,portal,protease,tail	Dinoroseobacter_phage(12.5%)	48	NA	NA
WP_069708827.1|3302638_3305029_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_008829610.1|3305048_3306185_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	31.2	9.7e-26
WP_036529909.1|3306193_3306526_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_008829612.1|3306748_3307114_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_008829613.1|3307127_3307331_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_069708828.1|3307533_3307980_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_008829615.1|3307983_3308784_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_069708829.1|3308963_3309866_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008829617.1|3310020_3310956_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	36.4	2.6e-45
WP_008829618.1|3311566_3312547_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_008829619.1|3312718_3313066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708830.1|3313155_3314463_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_069708831.1|3314536_3315382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008829622.1|3315749_3316412_+	TonB family protein	NA	NA	NA	NA	NA
WP_008829623.1|3316492_3317257_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
WP_036529916.1|3317428_3317920_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_008829625.1|3317945_3318380_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_069709294.1|3318453_3320910_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_069709295.1|3320989_3322387_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.9	7.4e-52
WP_008829628.1|3322561_3324097_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	27.5	2.9e-33
WP_036529918.1|3324186_3324891_+	endonuclease	NA	NA	NA	NA	NA
WP_008832047.1|3325053_3325392_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_008832048.1|3325406_3326717_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.1	8.0e-32
WP_069708832.1|3326895_3327234_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_008832050.1|3327282_3327708_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_069708833.1|3327993_3328788_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	51.8	8.3e-08
WP_036529922.1|3328976_3330167_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.9e-27
WP_069708834.1|3330163_3331090_+	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	27.4	4.8e-15
WP_051587186.1|3331086_3331992_+	molecular chaperone Hsp33	NA	NA	NA	NA	NA
WP_083274700.1|3332188_3332500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069708836.1|3332565_3333273_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.1	2.9e-28
WP_008829062.1|3333415_3334429_-	OmpA family protein	NA	NA	NA	NA	NA
WP_008829061.1|3334618_3335077_-	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	38.2	5.5e-12
WP_069708837.1|3335112_3337305_-	hypothetical protein	NA	A0A1W6DWX7	Sphingobium_phage	35.4	4.8e-29
WP_069708838.1|3337306_3337732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708839.1|3337728_3338550_-	DUF2163 domain-containing protein	NA	A0A1V0DY93	Dinoroseobacter_phage	31.9	6.4e-27
WP_069708840.1|3338546_3340889_-	DUF2460 domain-containing protein	NA	A0A0P1KKK5	Acinetobacter_phage	35.9	9.6e-52
WP_083274701.1|3340900_3341458_-|tail	tail tape measure protein	tail	NA	NA	NA	NA
WP_069708842.1|3341450_3341639_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_069708843.1|3341635_3341944_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_008829053.1|3341940_3342348_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_069708844.1|3342535_3342925_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_156799880.1|3342928_3343102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708845.1|3343098_3343656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708846.1|3343884_3345024_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	47.3	1.1e-80
WP_069709296.1|3345168_3345573_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	39.2	5.2e-14
WP_008829048.1|3345572_3345881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069708847.1|3345877_3347026_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	34.2	1.0e-43
>prophage 1
NZ_CP017076	Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence	1756808	833023	948168	1756808	coat,integrase,transposase	Bacillus_phage(12.5%)	90	889068:889086	957701:957716
WP_008828678.1|833023_833581_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_069709436.1|833612_834140_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_083274788.1|834158_834944_+	molecular chaperone	NA	NA	NA	NA	NA
WP_083274789.1|835055_837347_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_069709439.1|837337_838372_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_083274790.1|838380_839238_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_069709440.1|839234_840242_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_069709582.1|840385_842896_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_069709441.1|842895_843864_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_069709442.1|843860_845561_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_008831515.1|845608_846925_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_008831514.1|846969_848232_-	TolC family protein	NA	NA	NA	NA	NA
WP_069709443.1|848228_851318_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.1	6.4e-72
WP_008831512.1|851326_852415_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_008831511.1|852516_853188_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.4	3.8e-22
WP_081799263.1|853180_854569_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	1.3e-19
WP_081799262.1|854693_855527_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	27.6	2.3e-08
WP_069709444.1|855546_856884_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_036530941.1|856991_857660_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008831849.1|857873_858260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008831848.1|858453_859707_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_008831847.1|859703_861149_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_036530940.1|861145_861742_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_036530939.1|861934_863407_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	4.3e-18
WP_036530938.1|863504_864005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008831843.1|864027_865689_+	amidohydrolase	NA	NA	NA	NA	NA
WP_036530935.1|865955_868172_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_008833401.1|868242_868494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036530932.1|868680_868899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069709445.1|869366_870362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069709583.1|871093_872053_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_008831620.1|872415_875151_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_083274805.1|875424_877197_+	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_008831622.1|877196_878066_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_008831623.1|878202_879342_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_069709446.1|879355_880504_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_008831626.1|881113_882148_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_008831627.1|882144_882780_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_036530969.1|882776_883646_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_008831629.1|883642_885229_-	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	38.7	5.4e-83
WP_008831630.1|885443_886520_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_036530980.1|886711_887428_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036530970.1|887515_888442_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
889068:889086	attL	ACGAACCCGCTGCGCGGGA	NA	NA	NA	NA
WP_051587245.1|889194_890055_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	30.4	5.1e-27
887738:887753	attL	CAGCAGGCGCTCGCCG	NA	NA	NA	NA
WP_051587245.1|889194_890055_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	30.4	5.1e-27
WP_036530972.1|890142_891678_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_156799947.1|893465_893609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069709447.1|893807_894839_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069709448.1|895119_895380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036531096.1|895913_897107_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036531095.1|897110_898022_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.8	1.2e-31
WP_036531082.1|898216_900994_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
898131:898149	attR	TCCCGCGCAGCGGGTTCGT	NA	NA	NA	NA
WP_051587252.1|900994_902851_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
898131:898149	attR	TCCCGCGCAGCGGGTTCGT	NA	NA	NA	NA
WP_155986507.1|902880_903291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036531077.1|903515_903887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036531074.1|903883_904891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036531071.1|904871_905363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155986506.1|905717_906320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036531068.1|906451_906736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036531066.1|906732_907620_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.9	1.3e-49
WP_069709449.1|908452_908929_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.9	9.1e-26
WP_036531062.1|909027_909282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036530815.1|909518_909938_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	37.4	1.7e-20
WP_037520338.1|910709_912194_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_156799948.1|912247_913561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069709450.1|913553_914069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036528180.1|914065_915961_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036528181.1|916188_916977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036528183.1|921813_922056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036528184.1|922188_923082_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.0	9.2e-64
WP_036528209.1|923522_923969_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_036528186.1|924154_925606_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_156799959.1|925667_926333_-	transcriptional initiation protein Tat	NA	NA	NA	NA	NA
WP_036528187.1|927051_927360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051587028.1|927540_928161_-	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_036528216.1|929534_930092_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_051587029.1|930249_930780_+	hemerythrin	NA	NA	NA	NA	NA
WP_036528191.1|930820_931360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051587030.1|931403_932981_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_036528192.1|932980_933349_-	response regulator	NA	NA	NA	NA	NA
WP_036528221.1|933386_934796_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036528194.1|935126_936062_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	32.4	1.4e-30
WP_036528196.1|936273_938784_-	DNA ligase D	NA	A0A291AUP8	Sinorhizobium_phage	40.7	8.1e-57
WP_036528198.1|938878_939289_-	low affinity iron permease family protein	NA	NA	NA	NA	NA
WP_036528199.1|939351_940008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036528201.1|940078_940684_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_081799133.1|940732_940921_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_036528202.1|941039_941954_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	26.2	2.6e-13
WP_081799134.1|942030_944616_-	PAS domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	26.4	2.7e-07
WP_036528223.1|945057_946632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069709452.1|946848_948168_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
957701:957716	attR	CGGCGAGCGCCTGCTG	NA	NA	NA	NA
>prophage 2
NZ_CP017076	Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence	1756808	1533856	1575053	1756808	integrase,protease,transposase	Lactococcus_phage(20.0%)	33	1523502:1523518	1568577:1568593
1523502:1523518	attL	CAGCTTCAACCTGCGCG	NA	NA	NA	NA
WP_069709531.1|1533856_1535938_+|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_069709532.1|1536062_1538609_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_069709533.1|1538605_1541812_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_069709534.1|1541811_1543026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036531279.1|1543515_1544283_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.7	1.0e-42
WP_081799279.1|1544279_1545773_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_069709536.1|1547334_1549875_+	helicase	NA	NA	NA	NA	NA
WP_069709537.1|1550281_1551601_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069709538.1|1552124_1552499_-	nuclease	NA	A0A0R6PHV6	Moraxella_phage	29.7	4.8e-06
WP_036526662.1|1553595_1554069_+	Hsp20 family protein	NA	A0A0C5AE28	Cyanophage	44.7	6.5e-24
WP_156799952.1|1554631_1554817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036526658.1|1555190_1555478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008831856.1|1555991_1556186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081799054.1|1556874_1557186_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	36.0	1.5e-08
WP_036526656.1|1557188_1557371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081799052.1|1557369_1558047_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_051586903.1|1558029_1558353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051586902.1|1558344_1558659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155986287.1|1558957_1559776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081799051.1|1559779_1561699_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081799050.1|1561893_1563141_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.2	3.8e-39
WP_081799049.1|1563481_1563697_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036526652.1|1564213_1564858_+	membrane protein	NA	NA	NA	NA	NA
WP_156799953.1|1564934_1565108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036526650.1|1565748_1566018_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_036526648.1|1566049_1566241_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069709540.1|1566738_1569375_+	TonB-dependent receptor	NA	NA	NA	NA	NA
1568577:1568593	attR	CAGCTTCAACCTGCGCG	NA	NA	NA	NA
WP_051586911.1|1569404_1570505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069709541.1|1570506_1571691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036526643.1|1571769_1572186_-	VOC family protein	NA	NA	NA	NA	NA
WP_051586899.1|1572276_1573011_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_155986285.1|1573347_1574349_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036526716.1|1574231_1575053_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP017077	Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence	960805	205633	247276	960805	integrase,transposase	Acidithiobacillus_phage(22.22%)	37	193376:193391	253934:253949
193376:193391	attL	CTCGACCGCGCGGCCG	NA	NA	NA	NA
WP_037520338.1|205633_207118_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_156799978.1|207718_209818_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_069709746.1|210186_211080_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.2	2.8e-60
WP_083274829.1|211835_212276_+	DUF3597 domain-containing protein	NA	NA	NA	NA	NA
WP_069709749.1|212713_214384_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036530018.1|214380_214893_+	DUF1543 domain-containing protein	NA	A0A2I2L4Z6	Orpheovirus	36.7	2.1e-20
WP_155986472.1|214946_215198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036530020.1|215443_216262_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069709750.1|216529_217288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036530022.1|217327_218716_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_036530023.1|218724_219819_+	alkene reductase	NA	NA	NA	NA	NA
WP_069709751.1|219917_220211_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_036530026.1|220232_220814_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_069709752.1|221247_222357_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083274830.1|222737_223433_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_156799979.1|223440_223902_-	response regulator	NA	NA	NA	NA	NA
WP_156799980.1|223828_224122_-	response regulator	NA	NA	NA	NA	NA
WP_069709754.1|225095_225971_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_156799981.1|226389_226704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799982.1|226779_227373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069709757.1|227379_227727_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_156799983.1|227723_228122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083274833.1|228427_228673_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069709759.1|228849_229146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069709760.1|229386_229692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083274834.1|229723_230977_-	chloride channel protein	NA	NA	NA	NA	NA
WP_069710188.1|231006_232554_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	9.9e-122
WP_069709762.1|232563_233304_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.6	3.3e-59
WP_069709763.1|233456_233912_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_069709764.1|234002_234449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156799984.1|234572_237374_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	26.9	8.0e-13
WP_083274923.1|238097_238835_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.7	2.9e-23
WP_069709767.1|239202_241230_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	1.3e-36
WP_069709768.1|242882_244154_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	40.4	6.4e-10
WP_069709769.1|244536_246609_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	23.1	2.1e-10
WP_069709770.1|246598_246793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083274838.1|247135_247276_+|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
253934:253949	attR	CTCGACCGCGCGGCCG	NA	NA	NA	NA
>prophage 2
NZ_CP017077	Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence	960805	775246	870598	960805	integrase,protease,transposase	Acidithiobacillus_phage(14.29%)	93	779495:779510	875393:875408
WP_069710076.1|775246_776794_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.9	4.0e-123
WP_069710077.1|776804_777545_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.0	1.9e-59
WP_008829143.1|777940_778435_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_156800036.1|779131_779389_-	hypothetical protein	NA	NA	NA	NA	NA
779495:779510	attL	GCGCCGATCTGATCGC	NA	NA	NA	NA
WP_008833389.1|779970_780726_-	hypothetical protein	NA	NA	NA	NA	NA
779495:779510	attL	GCGCCGATCTGATCGC	NA	NA	NA	NA
WP_008833390.1|780886_781144_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_008833391.1|781140_781437_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069710079.1|782186_782768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156800037.1|782980_783424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083274899.1|783563_783824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710080.1|784143_784572_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_069710081.1|784573_784912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069710082.1|784949_786338_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_037522013.1|786589_787039_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_069710083.1|787090_787837_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.6	1.7e-18
WP_069710084.1|787964_788873_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037517261.1|789036_789594_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_037517263.1|789714_790263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710085.1|790367_790979_-	lytic transglycosylase	NA	NA	NA	NA	NA
WP_069710086.1|790968_793926_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_008827966.1|793922_795932_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008827967.1|795928_796228_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_083274900.1|796796_798047_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	26.1	7.9e-21
WP_083274901.1|798003_799230_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	30.0	7.3e-27
WP_069710089.1|799226_799484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069710090.1|799547_800477_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_156800038.1|800519_801227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156800039.1|801223_802090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156800040.1|802412_803641_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	62.0	6.0e-98
WP_083274902.1|804013_805237_+|protease	26S protease regulatory subunit	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	40.1	4.2e-35
WP_156800041.1|805208_806621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008827974.1|806817_807177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069710093.1|807173_807521_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.8	1.7e-29
WP_069710094.1|807609_809256_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	40.3	2.6e-96
808298:808313	attR	GCGATCAGATCGGCGC	NA	NA	NA	NA
WP_069710095.1|810465_810690_-	hypothetical protein	NA	NA	NA	NA	NA
808298:808313	attR	GCGATCAGATCGGCGC	NA	NA	NA	NA
WP_069710096.1|811091_811517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008832418.1|811702_812023_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_069710097.1|812484_812772_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_069710098.1|812768_813098_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	56.8	6.5e-23
WP_008831236.1|813342_815172_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	29.2	2.8e-06
WP_008831237.1|815263_815674_-	DUF2958 domain-containing protein	NA	NA	NA	NA	NA
WP_008831238.1|815670_816690_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.5	2.8e-56
WP_069710099.1|817189_817585_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_069710242.1|817960_818209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156800042.1|818232_818451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710101.1|818842_820081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156800043.1|820452_820806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156800044.1|820907_821081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710102.1|821168_822650_-	alginate export family protein	NA	NA	NA	NA	NA
WP_008833632.1|822736_824044_-	MFS transporter	NA	NA	NA	NA	NA
WP_008833631.1|824155_825421_-	gallate dioxygenase	NA	NA	NA	NA	NA
WP_008833630.1|825489_826608_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_008833629.1|826628_827600_-	oxidoreductase	NA	NA	NA	NA	NA
WP_008833628.1|827744_828950_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008833627.1|829013_830033_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_083274904.1|830049_831186_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_008833625.1|831215_832406_-	lactonase family protein	NA	NA	NA	NA	NA
WP_008833624.1|832402_833521_-	xylose isomerase	NA	NA	NA	NA	NA
WP_069710103.1|833522_833990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008833622.1|834023_835283_-	nucleoside:proton symporter	NA	NA	NA	NA	NA
WP_008833621.1|835310_836975_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_008833620.1|837040_839191_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_083274905.1|839381_840743_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_008833618.1|840739_841483_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156800045.1|841536_842850_-	MFS transporter	NA	NA	NA	NA	NA
WP_069710104.1|843045_845190_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069710105.1|845310_847296_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_008833614.1|847310_848345_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_008833613.1|848424_849099_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_037522464.1|849197_850361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008833610.1|850428_851286_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008833609.1|851289_852315_+	amidohydrolase	NA	NA	NA	NA	NA
WP_156800046.1|854016_854349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008828813.1|854411_854651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008828812.1|854869_855829_-	DUF2493 domain-containing protein	NA	G1DB78	Mycobacterium_phage	33.3	4.7e-05
WP_156800004.1|856057_857116_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_008828811.1|857684_857900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008828810.1|857899_858898_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_008828809.1|858966_859428_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_008828807.1|859886_860309_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_008828806.1|860308_860572_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_008828805.1|860821_861217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008828804.1|861277_861835_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2D1GQP4	Pseudomonas_phage	41.1	7.6e-24
WP_008828803.1|861831_862146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156800047.1|862229_862379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037518161.1|862371_862620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156800048.1|862716_863220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083274934.1|863413_863872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037518151.1|863855_865664_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_069710107.1|865668_867489_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069710108.1|867481_868624_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069710109.1|869028_869466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156800049.1|869538_870598_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
875393:875408	attR	CCCTTGCGGACATGCC	NA	NA	NA	NA
>prophage 1
NZ_CP017078	Novosphingobium resinovorum strain SA1 plasmid pSA3, complete sequence	354886	91137	98371	354886		uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_069710282.1|91137_92322_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	61.3	2.4e-104
WP_069710283.1|92492_93407_+	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_069710284.1|93556_94951_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	33.3	6.1e-38
WP_069710285.1|94950_95334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083274940.1|95378_95702_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	60.0	5.2e-25
WP_069710286.1|95798_96128_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083274941.1|96030_96660_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	41.9	4.1e-26
WP_069710288.1|96656_97085_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	51.1	8.4e-31
WP_069710289.1|97084_98371_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.8	5.1e-172
>prophage 3
NZ_CP017078	Novosphingobium resinovorum strain SA1 plasmid pSA3, complete sequence	354886	241848	301784	354886	transposase,integrase	Escherichia_phage(16.67%)	53	241764:241790	247660:247686
241764:241790	attL	CATTATGCCGTAAGTCGGATTATGCCG	NA	NA	NA	NA
WP_037094399.1|241848_242841_-|integrase	site-specific integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	32.9	3.1e-12
WP_037094402.1|242837_243782_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037094406.1|245249_246071_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_037094409.1|246070_247438_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	72.9	7.6e-33
WP_083274958.1|247644_248316_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	48.2	4.1e-48
247660:247686	attR	CGGCATAATCCGACTTACGGCATAATG	NA	NA	NA	NA
WP_069710354.1|248559_248745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710355.1|249270_249858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155276029.1|250487_252212_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_069710356.1|252997_253981_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_069710357.1|254742_256002_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_069710358.1|255998_256640_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_156800082.1|257423_257690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710403.1|257821_258733_-	glutaminase	NA	NA	NA	NA	NA
WP_083274970.1|259241_259565_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_069710360.1|259561_260782_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069710361.1|261597_262629_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069710362.1|264026_264368_-	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
WP_069710363.1|264499_265939_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_069710364.1|265963_267322_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_083274960.1|268167_269016_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	1.3e-38
WP_083274961.1|269331_270390_-	maleylacetate reductase	NA	NA	NA	NA	NA
WP_083274962.1|270889_271642_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083274963.1|271709_272105_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069710366.1|272101_272449_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	54.9	2.0e-27
WP_069709383.1|273979_275203_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.1	1.4e-41
WP_156800083.1|275389_275575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069710404.1|275766_276597_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	25.7	2.2e-11
WP_083274964.1|276659_277409_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155276029.1|277532_279257_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_051796732.1|279332_279818_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_035228575.1|279826_280264_-	EamA family transporter	NA	NA	NA	NA	NA
WP_080723360.1|280273_280651_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	34.1	8.0e-09
WP_035228572.1|280913_281654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710368.1|281662_285088_-	Ti-type conjugative transfer relaxase TraA	NA	NA	NA	NA	NA
WP_035228567.1|285352_285646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127601168.1|286176_286581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080723359.1|286934_287255_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	44.9	2.3e-17
WP_035228560.1|287251_287527_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	50.6	1.2e-14
WP_035228558.1|287973_288633_-	ParA family protein	NA	B0ZSI1	Halomonas_phage	32.7	1.0e-14
WP_156800087.1|289063_289528_-	replication protein RepA	NA	NA	NA	NA	NA
WP_001389365.1|289648_290413_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_083274965.1|290384_290852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710372.1|291099_292110_-	ParB/RepB/Spo0J family partition protein	NA	A0A240F4U0	Ochrobactrum_phage	36.3	5.6e-09
WP_069710373.1|292106_292847_-	ParA family protein	NA	B0ZSI1	Halomonas_phage	26.1	1.1e-06
WP_069710374.1|292850_293042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069710406.1|293337_293658_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_069710375.1|294192_295029_-	RNA replicase	NA	NA	NA	NA	NA
WP_069710376.1|295465_296326_-	RepB family plasmid replication initiator protein	NA	A0A0K1Y6J9	Rhodobacter_phage	30.9	9.3e-29
WP_069710377.1|296625_297216_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	57.4	8.0e-48
WP_069710378.1|297212_297401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006961816.1|297618_298485_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	40.0	4.8e-25
WP_036531279.1|299526_300294_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	39.7	1.0e-42
WP_081799279.1|300290_301784_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
