The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017260	Formosa sp. Hel1_33_131, complete genome	2735158	209471	217822	2735158		Only_Syngen_Nebraska_virus(16.67%)	8	NA	NA
WP_069675682.1|209471_211091_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	1.5e-149
WP_069675683.1|211238_212171_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	43.2	5.7e-24
WP_069677849.1|212259_214443_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.8	6.3e-82
WP_069675684.1|214602_215568_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A1Z1LYZ3	Serratia_phage	33.7	6.1e-21
WP_069677850.1|215588_216386_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	26.9	2.3e-18
WP_069675685.1|216375_216717_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_157498050.1|216725_216902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069675686.1|217081_217822_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	2.5e-22
>prophage 2
NZ_CP017260	Formosa sp. Hel1_33_131, complete genome	2735158	716670	725655	2735158		Catovirus(14.29%)	8	NA	NA
WP_069676074.1|716670_717792_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.8	8.4e-30
WP_069676075.1|717834_718935_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_069676076.1|719031_719898_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.8	5.6e-98
WP_069676077.1|719899_720946_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.5	2.8e-80
WP_069677878.1|720942_721968_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	31.6	2.2e-40
WP_069676078.1|721969_723361_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	33.7	6.0e-62
WP_069676079.1|723367_724360_-	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	51.7	1.6e-88
WP_069676080.1|724359_725655_-	nucleotide sugar dehydrogenase	NA	A0A218MKK1	uncultured_virus	23.5	2.8e-05
>prophage 3
NZ_CP017260	Formosa sp. Hel1_33_131, complete genome	2735158	1246366	1254978	2735158		Bacillus_phage(16.67%)	7	NA	NA
WP_069676524.1|1246366_1249498_-	AAA family ATPase	NA	A0A068EQC7	Bacillus_phage	24.5	2.0e-12
WP_069676525.1|1249606_1250215_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.0	7.9e-59
WP_069676526.1|1250389_1252288_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	25.4	7.8e-12
WP_069676527.1|1252353_1253283_-	sugar kinase	NA	NA	NA	NA	NA
WP_069676528.1|1253364_1254006_-	ribonuclease H	NA	R4TF97	Phaeocystis_globosa_virus	28.1	3.3e-07
WP_069676529.1|1253998_1254565_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	30.8	1.1e-17
WP_013869581.1|1254744_1254978_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.1	1.7e-06
>prophage 4
NZ_CP017260	Formosa sp. Hel1_33_131, complete genome	2735158	1798779	1811608	2735158		Riemerella_phage(12.5%)	13	NA	NA
WP_083243938.1|1798779_1799259_-	hypothetical protein	NA	F5A3D2	Riemerella_phage	40.0	9.8e-20
WP_069676992.1|1799623_1800487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069676993.1|1800475_1801255_-	hypothetical protein	NA	A0A1Y0T2N3	Pseudomonas_phage	47.0	4.3e-57
WP_083243939.1|1801257_1803858_-	hypothetical protein	NA	A0A0A0YNQ8	Flavobacterium_phage	64.7	0.0e+00
WP_069676996.1|1804032_1805811_-	toprim domain-containing protein	NA	R9ZZD6	Cellulophaga_phage	45.4	2.2e-149
WP_069676997.1|1805807_1806455_-	hypothetical protein	NA	A0A1B1INU7	uncultured_Mediterranean_phage	55.9	5.4e-13
WP_083243940.1|1806456_1808106_-	DEAD/DEAH box helicase	NA	A0A1W6DX52	Sphingobium_phage	27.9	4.0e-36
WP_069676998.1|1808121_1808673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069676999.1|1808676_1809063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677000.1|1809059_1809314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677001.1|1809520_1809886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677002.1|1809905_1810319_-	DUF1367 family protein	NA	A0A2I7QK77	Vibrio_phage	33.6	4.3e-16
WP_069677003.1|1810315_1811608_-	hypothetical protein	NA	A0A2D0W930	Bordetella_phage	28.9	4.6e-40
>prophage 5
NZ_CP017260	Formosa sp. Hel1_33_131, complete genome	2735158	2240375	2302515	2735158	tRNA,transposase,integrase,tail,protease	Lactobacillus_phage(12.5%)	53	2277004:2277063	2285591:2285657
WP_069677382.1|2240375_2241290_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_069677383.1|2241282_2242119_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	37.3	8.2e-06
WP_069677384.1|2242141_2243509_-	exonuclease	NA	NA	NA	NA	NA
WP_069677385.1|2243518_2244181_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_069677386.1|2244183_2245419_-	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_069677387.1|2245460_2246348_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_069677388.1|2246358_2247321_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_083243952.1|2247564_2248188_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_069677390.1|2248197_2248836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157498144.1|2248924_2249425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677392.1|2249452_2250046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677393.1|2250091_2250352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677394.1|2250501_2251053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677395.1|2251235_2256698_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_069677396.1|2256912_2257179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157498146.1|2257249_2257555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677398.1|2257641_2258283_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.1	1.4e-29
WP_069677399.1|2258279_2260736_-	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_069677400.1|2260836_2261295_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.3	4.3e-25
WP_083243953.1|2261320_2261905_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_069677402.1|2262112_2262493_+	bacillithiol system redox-active protein YtxJ	NA	NA	NA	NA	NA
WP_069677403.1|2262497_2263532_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_069677404.1|2263673_2265173_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.0	5.1e-91
WP_069677405.1|2265345_2267892_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	34.4	9.5e-130
WP_069677406.1|2268142_2270689_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.1	8.9e-112
WP_069677407.1|2270721_2271978_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_069677408.1|2272026_2272779_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_069677409.1|2272782_2273964_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_069677410.1|2274183_2276232_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
2277004:2277063	attL	AGCTGGATAGAGCACCTCCCTTCTAAGGAGGCGGTCCTAGGTTCGAATCCTAGTGCGATC	NA	NA	NA	NA
WP_069677411.1|2277766_2279932_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_069677412.1|2280612_2281395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677413.1|2281554_2281941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157498148.1|2281945_2282164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677414.1|2282638_2283667_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	29.4	3.7e-24
WP_069677415.1|2283680_2284370_+	ion transporter	NA	NA	NA	NA	NA
WP_069677416.1|2284418_2285528_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069677417.1|2285769_2287827_-	acylase	NA	NA	NA	NA	NA
2285591:2285657	attR	AGCTGGATAGAGCACCTCCCTTCTAAGGAGGCGGTCCTAGGTTCGAATCCTAGTGCGATCACTTAAA	NA	NA	NA	NA
WP_157498150.1|2288085_2288430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677419.1|2288736_2290269_+	Fic family protein	NA	NA	NA	NA	NA
WP_069677420.1|2290281_2290749_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_069677421.1|2290791_2291166_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_069677422.1|2291184_2292129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677423.1|2292128_2293022_-	RibD family protein	NA	A0A1V0SE20	Indivirus	26.4	6.1e-07
WP_069677424.1|2293018_2294419_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_069677425.1|2294424_2296095_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_069677426.1|2296424_2297078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069677427.1|2297074_2298028_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_069677428.1|2298254_2298821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157498152.1|2299032_2299647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677428.1|2299785_2300352_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069677430.1|2300436_2301111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677431.1|2301146_2301959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069677432.1|2301948_2302515_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP017260	Formosa sp. Hel1_33_131, complete genome	2735158	2708949	2719149	2735158		Acidithiobacillus_phage(20.0%)	9	NA	NA
WP_069677809.1|2708949_2711163_-	DNA cytosine methyltransferase	NA	K4HZD0	Acidithiobacillus_phage	24.2	1.3e-05
WP_069677810.1|2711456_2712401_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_069677811.1|2712495_2713371_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_069677812.1|2713367_2714687_-	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	34.9	9.5e-41
WP_069677813.1|2714692_2716024_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	32.2	1.2e-43
WP_069677814.1|2716142_2716592_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_069677815.1|2716770_2716962_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	53.8	5.2e-09
WP_157498204.1|2717062_2717566_-	CIA30 family protein	NA	NA	NA	NA	NA
WP_069677816.1|2717607_2719149_-	DEAD/DEAH box helicase	NA	R9ZZ72	Cellulophaga_phage	40.2	1.2e-55
