The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017186	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 chromosome, complete genome	4546962	1994564	2001595	4546962		Escherichia_phage(83.33%)	8	NA	NA
WP_023300000.1|1994564_1995224_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	8.3e-78
WP_058678032.1|1995280_1995595_-	YebG family protein	NA	NA	NA	NA	NA
WP_069596509.1|1995703_1996318_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.2	8.1e-27
WP_069596510.1|1996363_1997218_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.8	1.3e-22
WP_022647979.1|1997219_1997837_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
WP_069596511.1|1997847_2000286_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.0	6.8e-218
WP_003857424.1|2000416_2000722_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_045911697.1|2000839_2001595_-	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	23.2	7.9e-08
>prophage 2
NZ_CP017186	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 chromosome, complete genome	4546962	2007871	2019236	4546962		Morganella_phage(33.33%)	12	NA	NA
WP_069596515.1|2007871_2009335_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.5	6.4e-46
WP_003857405.1|2009379_2009583_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_023300013.1|2009870_2010302_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
WP_003857403.1|2010337_2011024_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038415990.1|2011114_2011861_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_069596516.1|2012004_2014038_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	1.4e-19
WP_071788017.1|2014651_2014879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647994.1|2015441_2015660_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
WP_023306122.1|2016027_2016717_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.7e-81
WP_006808847.1|2016980_2017220_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
WP_022647996.1|2017546_2017966_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_069596517.1|2017967_2019236_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	90.5	4.6e-226
>prophage 3
NZ_CP017186	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 chromosome, complete genome	4546962	2420493	2472113	4546962	protease,plate,terminase,lysis,head,tail,integrase,portal,capsid	Escherichia_phage(25.71%)	59	2419616:2419631	2473329:2473344
2419616:2419631	attL	TACGTTCATCCTTTTT	NA	NA	NA	NA
WP_045621558.1|2420493_2421540_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	3.6e-19
WP_022648324.1|2421792_2422554_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_023300262.1|2422550_2423141_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003856794.1|2423176_2424052_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|2424149_2424770_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_032622438.1|2424766_2425648_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_071524153.1|2425787_2425832_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_063849110.1|2425926_2427489_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_022648332.1|2427488_2429084_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	7.2e-51
WP_032624116.1|2429087_2430446_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
WP_022648334.1|2430456_2431650_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_022648335.1|2431649_2432459_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_069596643.1|2432633_2433845_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003856774.1|2433841_2434075_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_063150506.1|2434361_2434994_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_069596644.1|2435276_2435681_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_023300270.1|2435706_2436450_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_003856762.1|2436463_2437003_+	septation protein A	NA	NA	NA	NA	NA
WP_069596645.1|2437183_2439370_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_022648341.1|2439468_2439864_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_069596646.1|2439903_2440626_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_032624111.1|2440847_2441144_+	YciI family protein	NA	NA	NA	NA	NA
WP_069596647.1|2441510_2441771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892846.1|2441976_2442198_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.9	1.2e-25
WP_069596648.1|2442274_2443444_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	76.7	4.9e-166
WP_069596649.1|2443440_2443905_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	74.1	1.8e-58
WP_069596650.1|2443915_2446366_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	55.8	1.2e-209
WP_006175769.1|2446355_2446478_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	2.0e-14
WP_032658725.1|2446510_2446804_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	72.4	1.7e-27
WP_006175773.1|2446860_2447379_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	5.9e-79
WP_069596651.1|2447391_2448585_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	1.1e-184
WP_069596652.1|2448959_2449475_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	38.3	7.5e-18
WP_081330546.1|2449477_2451310_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.9	5.7e-92
WP_069596653.1|2451321_2451852_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	3.1e-91
WP_069596654.1|2451844_2452753_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.8	8.3e-137
WP_069596655.1|2452758_2453109_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	72.4	4.0e-39
WP_069596656.1|2453105_2453747_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	83.6	3.5e-97
WP_069596657.1|2453876_2455043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069596658.1|2455205_2455658_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	60.4	6.6e-42
WP_069596659.1|2455650_2456118_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	4.5e-62
WP_069596660.1|2456213_2456639_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.7	9.5e-43
WP_069596661.1|2456635_2457145_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	85.1	1.9e-77
WP_014170137.1|2457128_2457350_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.1e-25
WP_017382979.1|2457340_2457544_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_032609900.1|2457543_2458050_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_023323597.1|2458149_2458905_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.9	7.5e-75
WP_069596662.1|2458908_2459976_-|capsid	phage major capsid protein, P2 family	capsid	A0A218M4L4	Erwinia_phage	82.3	8.2e-168
WP_069596663.1|2460031_2460886_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	72.5	1.9e-114
WP_069596664.1|2461052_2462822_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.4	1.4e-302
WP_069596665.1|2462823_2463849_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.8	4.2e-169
WP_069596666.1|2464339_2465077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069596667.1|2465073_2465844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892849.1|2465882_2466941_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_062934567.1|2469068_2469332_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	58.1	6.7e-23
WP_069596669.1|2469354_2469573_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	60.3	1.9e-10
WP_032658815.1|2469639_2470140_-	hypothetical protein	NA	M1SV55	Escherichia_phage	75.3	3.7e-70
WP_059354248.1|2470306_2470582_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	8.9e-42
WP_069596670.1|2470706_2471006_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	6.5e-38
WP_069596671.1|2471102_2472113_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.1	2.3e-148
2473329:2473344	attR	TACGTTCATCCTTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP017186	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 chromosome, complete genome	4546962	2846569	2854317	4546962		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_023306558.1|2846569_2847181_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_063147739.1|2847220_2848201_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_069596749.1|2848393_2849398_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	29.0	1.9e-33
WP_069596750.1|2849447_2850614_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	2.4e-112
WP_069596751.1|2850853_2851735_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.0	5.8e-103
WP_069596752.1|2851735_2852821_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.8	6.3e-99
WP_069596753.1|2852910_2854317_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	27.8	5.2e-37
>prophage 5
NZ_CP017186	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 chromosome, complete genome	4546962	3301555	3417994	4546962	protease,plate,tRNA,terminase,lysis,head,integrase,tail,portal,capsid	Salmonella_phage(15.85%)	128	3334790:3334812	3365039:3365061
WP_022649046.1|3301555_3302293_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_022649047.1|3302425_3303754_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_022649048.1|3303805_3304189_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	70.9	1.4e-32
WP_003860729.1|3304503_3305193_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_023300740.1|3305232_3306318_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|3306522_3306942_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_023306729.1|3307012_3307711_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_048966850.1|3307746_3310410_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_069596829.1|3310519_3311875_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_046618949.1|3311921_3312245_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_069596830.1|3312241_3313549_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.8	2.7e-43
WP_032622345.1|3313700_3314153_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_045308384.1|3319685_3322259_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_023298396.1|3322388_3323120_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_022649057.1|3323116_3324097_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3324228_3324966_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_006811628.1|3325233_3325575_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3325679_3325727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023306733.1|3325834_3326995_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_022649059.1|3326991_3327864_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_006811631.1|3327924_3329046_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_006811632.1|3329056_3330127_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_069597111.1|3330605_3331142_+	YfiR family protein	NA	NA	NA	NA	NA
WP_045308387.1|3331134_3332355_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_023298405.1|3332367_3332850_+	OmpA family protein	NA	NA	NA	NA	NA
WP_069596831.1|3332852_3334223_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_022649065.1|3334261_3334666_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
3334790:3334812	attL	AAGCGAATCTTAGTTCAGACGCT	NA	NA	NA	NA
WP_047738488.1|3334910_3335942_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	80.7	2.0e-166
WP_052951382.1|3335944_3336811_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	44.6	1.4e-69
WP_162197024.1|3337032_3337164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017382962.1|3337195_3337705_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	86.4	4.9e-78
WP_000920169.1|3337712_3337913_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	100.0	1.2e-32
WP_020316748.1|3337876_3338215_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_047738486.1|3338282_3338510_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	96.0	1.9e-29
WP_047738484.1|3338509_3338731_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	95.8	1.0e-32
WP_047738505.1|3339013_3339205_+	hypothetical protein	NA	A5X9G6	Aeromonas_virus	56.6	7.1e-14
WP_047738482.1|3339207_3341421_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.4	0.0e+00
WP_017382969.1|3341543_3341726_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	74.1	5.0e-17
WP_047727381.1|3341729_3341960_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_047727393.1|3342044_3342776_+	hypothetical protein	NA	Q37850	Escherichia_phage	88.5	3.6e-122
WP_032618971.1|3343492_3344518_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	4.6e-168
WP_045339905.1|3344519_3346289_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.6	9.4e-302
WP_047738479.1|3346454_3347309_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	74.6	1.3e-115
WP_032671891.1|3347364_3348432_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.3	1.7e-168
WP_023323597.1|3348435_3349191_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.9	7.5e-75
WP_032609900.1|3349290_3349797_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_017382979.1|3349796_3350000_+|tail	tail protein X	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_014170137.1|3349990_3350212_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.1e-25
WP_023295248.1|3350195_3350708_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_047738475.1|3350704_3351136_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	76.2	5.3e-57
WP_017382983.1|3351135_3351552_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	68.0	9.3e-43
WP_045911509.1|3351647_3352115_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	70.3	6.1e-59
WP_047738472.1|3352107_3352557_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.1	4.2e-49
WP_045339915.1|3352625_3353261_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	87.2	9.7e-100
WP_047738471.1|3353257_3353608_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	71.6	6.9e-39
WP_069596832.1|3353613_3354522_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.4	3.2e-136
WP_047738468.1|3354514_3355045_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	6.2e-92
WP_047738466.1|3355056_3357450_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.3	7.1e-103
WP_047738464.1|3357451_3357883_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.4	1.5e-16
WP_047727360.1|3358257_3359451_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.9	4.1e-184
WP_023295232.1|3359463_3359982_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_047738462.1|3360039_3360363_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	64.0	4.4e-24
WP_017382998.1|3360395_3360518_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_047738460.1|3360507_3362958_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	76.3	1.6e-307
WP_047727357.1|3362968_3363433_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	5.5e-60
WP_047738457.1|3363429_3364593_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.0	5.4e-173
WP_017383002.1|3364669_3364888_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	76.4	1.5e-28
WP_002914145.1|3365047_3365395_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
3365039:3365061	attR	AAGCGAATCTTAGTTCAGACGCT	NA	NA	NA	NA
WP_003863138.1|3365438_3366206_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|3366237_3366777_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_022649067.1|3366792_3367041_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3367157_3368519_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014832951.1|3368685_3369477_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3369496_3370783_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|3370835_3371429_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_022649070.1|3371551_3372430_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_069596833.1|3372515_3374177_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3374151_3374334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|3374315_3374654_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|3374715_3375003_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3374992_3375469_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3375586_3376069_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_045347940.1|3376811_3378017_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_069596834.1|3378279_3378951_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	3.7e-81
WP_069596835.1|3380020_3381289_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.5	9.9e-229
WP_069597112.1|3381291_3381711_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	5.5e-35
WP_157886693.1|3382045_3382189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886694.1|3382289_3382817_-|tail	tail fiber assembly protein	tail	A0A2P0PA01	Pectobacterium_phage	26.7	5.2e-06
WP_069596836.1|3382819_3384820_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	41.1	8.8e-30
WP_069596837.1|3384822_3385374_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	42.1	1.1e-27
WP_069596838.1|3385366_3386281_-|plate	baseplate J/gp47 family protein	plate	A0A193GYM8	Enterobacter_phage	48.5	3.6e-63
WP_069596839.1|3386264_3386618_-	GPW/gp25 family protein	NA	E5FFH4	Burkholderia_phage	50.0	3.8e-21
WP_069596840.1|3386655_3387774_-	late control protein D	NA	R9TNM7	Vibrio_phage	34.0	7.6e-39
WP_069596841.1|3387775_3387991_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	41.8	8.5e-08
WP_069596842.1|3387965_3388436_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.1	1.4e-15
WP_069596843.1|3388432_3390430_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	32.4	1.4e-27
WP_069596844.1|3390544_3390832_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_063435351.1|3390882_3391389_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069596845.1|3391385_3392855_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	44.5	2.7e-76
WP_069596846.1|3392893_3393517_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	5.0e-08
WP_069596847.1|3393509_3394064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069596848.1|3394072_3394735_-	hypothetical protein	NA	R9TR34	Vibrio_phage	37.1	8.5e-22
WP_069596849.1|3394736_3395093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069596850.1|3395092_3395428_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	43.6	2.6e-11
WP_069596851.1|3395496_3397575_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	57.6	3.9e-198
WP_069596852.1|3397564_3399085_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	2.5e-154
WP_069596853.1|3399093_3399309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069596854.1|3399305_3401423_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	6.0e-303
WP_069596855.1|3401426_3401930_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	63.4	1.2e-47
WP_069596856.1|3402226_3402409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069596857.1|3402471_3402768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069596858.1|3403002_3403686_-	DUF4145 domain-containing protein	NA	A0A1S5S8Y9	Streptococcus_phage	43.4	6.9e-35
WP_069597114.1|3403750_3404212_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	63.4	2.5e-41
WP_069596859.1|3404208_3404745_-	lysozyme	NA	H6WRZ4	Salmonella_phage	87.6	1.3e-89
WP_052953277.1|3404744_3405047_-	hypothetical protein	NA	O64361	Escherichia_phage	69.3	1.1e-32
WP_069596860.1|3406332_3406998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069596861.1|3407148_3407841_-	antitermination protein	NA	NA	NA	NA	NA
WP_069596862.1|3407862_3408924_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.1	1.7e-109
WP_069596863.1|3408920_3409613_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	54.2	2.0e-58
WP_069596864.1|3409627_3411565_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	1.1e-199
WP_069596865.1|3411557_3412445_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	77.6	3.8e-134
WP_069596866.1|3412441_3413296_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.5e-58
WP_069596867.1|3413285_3413465_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_069596868.1|3413637_3414186_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.6	8.4e-68
WP_069596869.1|3414232_3414430_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	84.6	3.5e-24
WP_069596870.1|3414518_3415178_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.8	7.2e-114
WP_069596871.1|3415652_3416615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069596872.1|3416818_3417994_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.4	1.0e-142
>prophage 1
NZ_CP017187	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence	131604	0	5700	131604	integrase	Macacine_betaherpesvirus(66.67%)	5	3345:3357	9059:9071
WP_008502210.1|1276_2032_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.0	7.9e-133
WP_047716059.1|2331_3690_-	hypothetical protein	NA	NA	NA	NA	NA
3345:3357	attL	GGCTGGTTTTTCC	NA	NA	NA	NA
WP_008502208.1|3922_4549_+	ParA family plasmid-partitioning AAA ATPase	NA	Q2A085	Sodalis_phage	34.8	2.9e-24
WP_071530977.1|4545_4851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047716061.1|4923_5700_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	7.8e-51
9059:9071	attR	GGAAAAACCAGCC	NA	NA	NA	NA
>prophage 2
NZ_CP017187	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence	131604	59311	67910	131604		uncultured_Caudovirales_phage(100.0%)	11	NA	NA
WP_047716078.1|59311_60034_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.0	2.2e-95
WP_047716080.1|60042_60366_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069597124.1|60477_61491_-	permease	NA	NA	NA	NA	NA
WP_165764077.1|61766_62279_-	phosphatase	NA	NA	NA	NA	NA
WP_047716084.1|62442_62952_-	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	39.1	1.0e-14
WP_047716085.1|63024_63453_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	5.2e-49
WP_047716086.1|63510_64800_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.3	8.1e-170
WP_025714556.1|64840_66607_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_047716088.1|66603_66996_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_025714554.1|67020_67500_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	52.6	1.1e-36
WP_025714553.1|67556_67910_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	2.6e-22
>prophage 3
NZ_CP017187	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence	131604	71051	72273	131604		Stx2-converting_phage(33.33%)	3	NA	NA
WP_047716093.1|71051_71354_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	44.0	2.0e-18
WP_029403836.1|71359_71719_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	84.7	5.5e-52
WP_047716094.1|71778_72273_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	39.5	2.2e-19
>prophage 4
NZ_CP017187	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence	131604	99717	100041	131604		Yersinia_phage(100.0%)	1	NA	NA
WP_047353134.1|99717_100041_-	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	46.5	4.5e-21
>prophage 5
NZ_CP017187	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence	131604	113098	113920	131604		Yersinia_phage(100.0%)	1	NA	NA
WP_047716230.1|113098_113920_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	42.5	1.8e-50
>prophage 6
NZ_CP017187	Enterobacter hormaechei subsp. hoffmannii strain DSM 14563 plasmid pDSMZ14563, complete sequence	131604	126594	131167	131604		Vibrio_phage(33.33%)	7	NA	NA
WP_045325837.1|126594_127287_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.0	3.4e-29
WP_045325839.1|127692_128073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045325841.1|128367_128571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045325844.1|128599_128863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597129.1|128866_129529_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_080348833.1|129531_130503_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_045337362.1|130735_131167_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	6.1e-29
