The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	104849	118690	4724316	integrase,transposase,capsid	Enterobacteria_phage(72.73%)	15	106946:106966	118851:118871
WP_085950818.1|104849_105970_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
106946:106966	attL	TTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
WP_069597620.1|107264_109598_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
WP_069597621.1|109612_109933_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_069597689.1|109929_110187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597622.1|110258_110708_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	69.9	8.2e-45
WP_017694617.1|110700_111000_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	71.1	1.1e-32
WP_048966537.1|110992_111544_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	65.8	3.2e-30
WP_071962263.1|111540_111807_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	75.0	8.9e-31
WP_069597624.1|112353_113097_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_023304273.1|113100_113319_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	66.2	1.5e-15
WP_069597625.1|113347_113911_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	3.5e-61
WP_069597626.1|114210_115896_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	53.8	9.6e-179
WP_071962265.1|116124_116562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597627.1|116561_117512_-	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	29.0	5.5e-14
WP_069597628.1|117499_118690_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	1.4e-208
118851:118871	attR	TTGGCGGAAGATCACAGGAGT	NA	NA	NA	NA
>prophage 2
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	1143686	1190941	4724316	transposase,terminase,head,tail,holin	Enterobacteria_phage(29.09%)	68	NA	NA
WP_032647494.1|1143686_1143866_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	57.5	3.9e-06
WP_047051378.1|1143875_1144115_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	1.1e-27
WP_071962274.1|1144092_1144650_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	46.6	2.3e-36
WP_053087062.1|1144661_1144883_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	1.6e-17
WP_023303576.1|1145149_1145497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023300422.1|1145493_1145712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048981809.1|1145714_1147937_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.8	1.1e-190
WP_006809793.1|1147933_1148086_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_047052767.1|1148082_1148511_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	97.2	3.1e-73
WP_063159727.1|1148519_1149002_-	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	96.2	3.9e-77
WP_047052771.1|1148998_1149913_-	recombinase RecT	NA	G8C7T0	Escherichia_phage	98.7	4.4e-170
WP_063159726.1|1149922_1150204_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	93.5	2.7e-46
WP_047052751.1|1150281_1150488_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	98.5	4.8e-32
WP_047052755.1|1150484_1150643_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	90.4	2.7e-19
WP_023303584.1|1150918_1151128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032652783.1|1151114_1151435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045621984.1|1151734_1151932_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	5.0e-23
WP_045265467.1|1151955_1152240_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_045265468.1|1152251_1152548_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_045622027.1|1152831_1153542_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	99.2	1.1e-133
WP_000608751.1|1153659_1153881_+	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
WP_059364194.1|1153911_1154454_+	regulator	NA	M9NZI6	Enterobacteria_phage	87.2	2.3e-81
WP_015571544.1|1154543_1154690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063159725.1|1154682_1155768_+	replication protein	NA	E5AGE9	Erwinia_phage	51.3	9.4e-87
WP_063159724.1|1155764_1157138_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.9	7.6e-166
WP_074133382.1|1157127_1157442_+	protein ren	NA	M1FPD5	Enterobacteria_phage	50.5	7.3e-16
WP_045332625.1|1157438_1157642_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	79.7	5.2e-23
WP_080398023.1|1157638_1158571_+	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	69.6	1.6e-34
WP_001201739.1|1158687_1159071_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|1159067_1159415_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_016239903.1|1159464_1161000_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.6e-260
WP_080480772.1|1160962_1161601_+	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	43.4	2.0e-28
WP_133147707.1|1161555_1161840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647155.1|1162091_1162547_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	72.8	2.2e-61
WP_063159645.1|1162546_1162717_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	92.5	4.5e-20
WP_032680713.1|1162996_1163359_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.2	1.5e-52
WP_058663664.1|1163468_1164158_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.7	1.9e-56
WP_001514183.1|1164645_1165047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|1165043_1165319_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_063159646.1|1165322_1165763_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	82.6	1.9e-62
WP_063159647.1|1165759_1166146_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032669769.1|1166442_1166961_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	99.4	6.5e-94
WP_058655832.1|1167116_1167335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063159649.1|1167500_1167920_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	88.3	5.5e-59
WP_063159650.1|1167916_1169170_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.0	1.2e-213
WP_063159651.1|1169367_1170717_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	83.3	1.5e-219
WP_063159652.1|1170676_1171603_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.9	3.1e-163
WP_047052491.1|1171605_1172871_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.7	7.1e-219
WP_032104699.1|1172883_1173333_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	3.2e-65
WP_063159653.1|1173350_1174427_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	87.4	1.0e-178
WP_063159654.1|1174436_1174730_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	89.7	1.9e-42
WP_063159655.1|1174792_1175197_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	81.3	1.7e-57
WP_063159656.1|1175198_1175477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032669786.1|1175473_1175647_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	6.0e-12
WP_063159657.1|1175646_1176003_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	6.1e-27
WP_063159658.1|1176005_1176374_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	66.4	2.1e-38
WP_063159659.1|1176370_1176754_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	57.5	8.3e-38
WP_063159660.1|1176811_1177573_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	70.6	1.7e-74
WP_063159661.1|1177631_1178315_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	61.9	5.9e-79
WP_063159662.1|1178376_1181868_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	60.0	1.1e-248
WP_048981790.1|1181867_1182365_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.3	3.0e-88
WP_048981791.1|1182364_1182835_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
WP_048981793.1|1182848_1183214_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.9	2.7e-62
WP_063159375.1|1183200_1185678_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.2	0.0e+00
WP_063159663.1|1185736_1188181_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A1B1W279	Salmonella_phage	56.9	7.4e-55
WP_063159664.1|1188210_1189668_-	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_063159665.1|1189664_1190582_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.1	6.6e-158
WP_049019411.1|1190578_1190941_-	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	5.8e-49
>prophage 3
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	1839845	1847199	4724316		Shigella_phage(33.33%)	7	NA	NA
WP_047051520.1|1839845_1842227_+	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	32.4	1.4e-90
WP_047051518.1|1842266_1843712_-	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_047051516.1|1843708_1844626_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	7.8e-159
WP_023303502.1|1844622_1844985_-	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	5.8e-49
WP_047051515.1|1845097_1845337_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	67.9	2.9e-25
WP_023303504.1|1845336_1845657_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.4e-25
WP_023299884.1|1845915_1847199_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
>prophage 4
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	2019269	2075604	4724316	terminase,coat,tail,holin	Escherichia_phage(41.79%)	81	NA	NA
WP_069597641.1|2019269_2020550_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	2.5e-123
WP_022650951.1|2020582_2020831_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
WP_047051380.1|2020947_2021199_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	48.1	4.2e-06
WP_047051378.1|2021208_2021448_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	1.1e-27
WP_071962274.1|2021425_2021983_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	46.6	2.3e-36
WP_069597642.1|2021994_2022213_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	61.4	3.0e-16
WP_063845060.1|2022331_2023306_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	70.4	1.2e-146
WP_071962276.1|2023302_2023905_-	HNH endonuclease	NA	A0A142IF90	Pseudomonas_phage	43.7	1.1e-23
WP_063859029.1|2023888_2024530_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	90.4	2.1e-110
WP_047357022.1|2024526_2024679_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_063859030.1|2024675_2025104_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.1	9.8e-72
WP_069597643.1|2025112_2025595_-	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	97.5	2.7e-78
WP_047052771.1|2025591_2026506_-	recombinase RecT	NA	G8C7T0	Escherichia_phage	98.7	4.4e-170
WP_059347402.1|2026515_2026797_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	94.6	5.5e-47
WP_047052751.1|2026875_2027082_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	98.5	4.8e-32
WP_069597644.1|2027078_2027237_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	90.4	1.8e-18
WP_063946818.1|2027233_2027590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023330696.1|2027733_2027964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023306033.1|2028637_2028835_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	95.3	3.2e-25
WP_063946816.1|2028967_2029207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695767.1|2029208_2029688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704986.1|2029697_2030111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063946815.1|2030223_2030934_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	69.3	1.0e-89
WP_023306036.1|2031037_2031226_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	51.8	1.5e-08
WP_032668703.1|2031312_2031597_+	hypothetical protein	NA	Q5G8T2	Enterobacteria_phage	62.8	1.6e-22
WP_069597645.1|2031777_2032857_+	replication protein	NA	E5AGE9	Erwinia_phage	47.0	4.2e-87
WP_069597646.1|2032853_2034227_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.7	3.8e-165
WP_080480773.1|2034216_2034531_+	protein ren	NA	M1FPD5	Enterobacteria_phage	48.4	4.7e-15
WP_169819049.1|2035455_2035632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080480778.1|2036068_2036653_+	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	45.8	2.3e-10
WP_058663667.1|2036656_2037238_+	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	43.5	4.3e-30
WP_126680751.1|2037234_2037477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063858768.1|2037728_2038178_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	1.5e-33
WP_069597648.1|2038170_2038341_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	90.6	1.0e-19
WP_022650992.1|2038337_2038805_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.3	7.3e-36
WP_069597649.1|2038798_2039440_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	78.1	1.0e-80
WP_071524127.1|2039436_2039634_+	Lar family restriction alleviation protein	NA	M9NZE6	Enterobacteria_phage	89.2	3.3e-30
WP_137984231.1|2039630_2039747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032671042.1|2039746_2040511_+	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	74.8	1.4e-108
WP_058671431.1|2040808_2041090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514183.1|2041456_2041858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|2041854_2042130_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_063159646.1|2042133_2042574_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	82.6	1.9e-62
WP_063159647.1|2042570_2042957_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032669769.1|2043253_2043772_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	99.4	6.5e-94
WP_058655832.1|2043927_2044146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069597651.1|2044311_2044962_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.2	1.3e-104
WP_069597652.1|2044958_2046530_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	99.4	0.0e+00
WP_048218134.1|2046534_2047938_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.5	4.0e-255
WP_069597653.1|2047939_2049046_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	88.6	3.8e-184
WP_022651635.1|2049049_2049259_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	1.0e-13
WP_058674857.1|2049366_2050119_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	93.6	4.9e-127
WP_044704670.1|2050135_2051272_+|coat	coat protein	coat	G8C7P7	Escherichia_phage	92.3	1.1e-194
WP_069597654.1|2051311_2051569_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	54.1	1.9e-14
WP_069597655.1|2051571_2052054_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	95.0	3.7e-83
WP_069597656.1|2052055_2052409_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	91.4	2.2e-53
WP_069597657.1|2052411_2053011_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	89.9	7.0e-100
WP_069597658.1|2053000_2053447_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	89.9	4.3e-70
WP_069597659.1|2053493_2054426_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	98.4	1.5e-165
WP_080480779.1|2054698_2055361_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	58.5	4.6e-36
WP_069597661.1|2055425_2055764_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	93.8	1.9e-54
WP_045626282.1|2055781_2056069_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	63.1	4.2e-18
WP_048218114.1|2056068_2059143_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	88.5	0.0e+00
WP_126508917.1|2059199_2059586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047359780.1|2060260_2060434_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	83.9	1.6e-17
WP_048218106.1|2060423_2061137_+	BRO family, N-terminal domain protein	NA	H6WRU8	Salmonella_phage	53.6	1.8e-38
WP_048218103.1|2061205_2061955_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	57.9	9.1e-65
WP_069597662.1|2062009_2062360_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	92.2	1.5e-54
WP_069597663.1|2062359_2063130_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	94.5	6.6e-143
WP_069597664.1|2063142_2063874_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	98.4	1.3e-151
WP_045346858.1|2063861_2064455_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	90.0	1.8e-92
WP_069597665.1|2064510_2068374_+|tail	phage tail protein	tail	G8C7R4	Escherichia_phage	78.0	0.0e+00
WP_069597666.1|2068416_2068731_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.1e-32
WP_049019481.1|2068731_2069403_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.6e-87
WP_017382566.1|2069510_2069744_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_069597667.1|2069802_2071077_+|tail	phage tail protein	tail	K7PKG5	Enterobacteria_phage	70.4	1.5e-163
WP_063946829.1|2071159_2071399_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	1.2e-26
WP_047050338.1|2071398_2071722_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.4	7.5e-24
WP_047050336.1|2071904_2073710_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	8.5e-24
WP_047050334.1|2073725_2074700_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003860711.1|2074923_2075604_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
>prophage 5
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	2512567	2521454	4724316		Tupanvirus(28.57%)	8	NA	NA
WP_023303974.1|2512567_2513581_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.3	3.0e-87
WP_047053487.1|2513707_2515114_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
WP_047053489.1|2515203_2516289_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.3	1.1e-98
WP_017693099.1|2516289_2517171_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_003859477.1|2517410_2518577_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_047053492.1|2518626_2519631_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	1.9e-33
WP_023303969.1|2519823_2520804_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_047053494.1|2520842_2521454_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.8	5.4e-15
>prophage 6
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	2953574	2989052	4724316	plate,transposase,integrase,tRNA	Escherichia_phage(33.33%)	30	2943687:2943703	2992479:2992495
2943687:2943703	attL	TGACGGTCGATCAGCAC	NA	NA	NA	NA
WP_047051012.1|2953574_2954915_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_047051013.1|2954911_2955565_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_047051015.1|2955568_2957275_+	OmpA family protein	NA	NA	NA	NA	NA
WP_022651331.1|2957280_2957772_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_047051016.1|2957945_2960585_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.1	2.4e-96
WP_047051017.1|2960586_2961192_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_047051018.1|2961188_2961416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048983017.1|2961496_2964133_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_047051021.1|2964125_2964665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574636.1|2965791_2967081_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_004863699.1|2967102_2967615_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004574643.1|2967618_2968515_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|2968610_2969018_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_047051030.1|2969954_2970623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886797.1|2971383_2971650_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_047051031.1|2971653_2972814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047051032.1|2972800_2976217_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_047051033.1|2976216_2977794_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_047051034.1|2977826_2979590_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_072203498.1|2979544_2980639_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_047051036.1|2980613_2981144_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032103561.1|2981143_2981587_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_047051037.1|2981610_2982927_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_032648431.1|2982955_2983444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080344064.1|2983760_2984891_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_006810774.1|2984981_2985965_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_163270243.1|2986239_2986392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047051039.1|2986449_2987823_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.1e-50
WP_047051040.1|2987866_2988802_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.9	2.2e-140
WP_071785691.1|2988851_2989052_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
2992479:2992495	attR	GTGCTGATCGACCGTCA	NA	NA	NA	NA
>prophage 7
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	3274414	3283723	4724316	transposase	Enterobacterial_phage(16.67%)	9	NA	NA
WP_003857390.1|3274414_3274654_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	5.0e-33
WP_085950818.1|3275191_3276312_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_047052654.1|3276772_3277264_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_047052655.1|3277556_3279590_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	7.6e-21
WP_047052656.1|3279733_3280480_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_047052657.1|3280570_3281257_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047052658.1|3281292_3281724_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.2	2.0e-16
WP_003857405.1|3282011_3282215_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_047052659.1|3282259_3283723_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.7	2.2e-46
>prophage 8
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	3313720	3419017	4724316	transposase,terminase,integrase,tail,holin,coat,protease	Escherichia_phage(38.89%)	125	3327386:3327403	3421028:3421045
WP_003857461.1|3313720_3314542_+|protease	serine protease	protease	NA	NA	NA	NA
WP_003857463.1|3314547_3314877_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_015570633.1|3314863_3315226_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_003857467.1|3315646_3316687_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_047051853.1|3316683_3317631_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_017384559.1|3317623_3318658_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006808895.1|3318865_3319213_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_048982621.1|3319472_3320738_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.3	4.5e-205
WP_047051855.1|3320842_3321862_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_002905689.1|3322000_3322072_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_003857504.1|3322127_3323045_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_047051856.1|3323047_3323803_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_003857508.1|3323805_3324084_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_023296519.1|3324070_3325213_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_047051857.1|3325218_3327495_+	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A2P1EIE5	Megavirus	26.6	2.9e-05
3327386:3327403	attL	CGGTGTTAACGCCGCAGG	NA	NA	NA	NA
WP_048982624.1|3327581_3330011_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_063159814.1|3330467_3330902_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.3	9.1e-33
WP_003857516.1|3331227_3331428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047051859.1|3331474_3332341_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_047051860.1|3332486_3334148_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.9	6.4e-10
WP_047051861.1|3334180_3334744_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_003857524.1|3335094_3336000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047051862.1|3336175_3337486_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_047051863.1|3337485_3338931_+	amidohydrolase	NA	NA	NA	NA	NA
WP_032104209.1|3338975_3340502_+	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_015570643.1|3340511_3341027_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	56.9	3.2e-24
WP_000611906.1|3341210_3341963_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_003857535.1|3342100_3343051_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_047051864.1|3343089_3344202_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_102780163.1|3344314_3345672_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.1	1.4e-74
WP_003857541.1|3345754_3347143_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_017384575.1|3347153_3348683_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769339.1|3349218_3350163_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003857548.1|3350348_3351731_+	amino acid permease	NA	NA	NA	NA	NA
WP_047051865.1|3351770_3352493_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_047051866.1|3352489_3352825_-	GlpM family protein	NA	NA	NA	NA	NA
WP_047051867.1|3352952_3353669_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_047051878.1|3354107_3354479_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	38.9	2.5e-15
WP_045339713.1|3354866_3355091_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	68.7	1.6e-20
WP_006808923.1|3355517_3355745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047051869.1|3356026_3357325_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.8	1.6e-16
WP_047051870.1|3357399_3358329_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_017693543.1|3358329_3359724_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_047051871.1|3359906_3361553_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_047051872.1|3361752_3362928_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_047051873.1|3363027_3364554_+	YdgA family protein	NA	NA	NA	NA	NA
WP_017384586.1|3364656_3365685_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_047051874.1|3366198_3366522_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.2	3.0e-25
WP_156177486.1|3366524_3366749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048218093.1|3366843_3368118_-	hypothetical protein	NA	K7PKG5	Enterobacteria_phage	69.7	3.6e-162
WP_039268850.1|3368176_3368410_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	77.6	8.6e-30
WP_006809145.1|3368517_3369189_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.0e-87
WP_017694302.1|3369189_3369504_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	3.0e-33
WP_069597675.1|3369546_3373410_-|tail	phage tail protein	tail	G8C7R4	Escherichia_phage	79.1	0.0e+00
WP_047642171.1|3373465_3374059_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	88.4	3.8e-90
WP_048218100.1|3374046_3374778_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	96.7	4.0e-150
WP_047642173.1|3374790_3375561_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	96.5	5.4e-145
WP_048218102.1|3375560_3375911_-|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	92.2	4.0e-55
WP_131619226.1|3376074_3376305_+	hypothetical protein	NA	Q9MCR8	Enterobacteria_phage	94.7	3.1e-32
WP_032621522.1|3376318_3376576_-	hypothetical protein	NA	Q9MCR9	Enterobacteria_phage	92.9	2.3e-36
WP_069597676.1|3377147_3377372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597677.1|3377371_3380506_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	39.5	1.7e-157
WP_016247126.1|3380505_3380793_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_069597678.1|3380810_3381149_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	96.4	3.0e-55
WP_048218118.1|3381214_3382006_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	49.1	2.2e-53
WP_039270149.1|3382149_3383082_-|tail	major tail protein	tail	G8C7Q3	Escherichia_phage	99.0	1.4e-166
WP_069597658.1|3383128_3383575_-	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	89.9	4.3e-70
WP_069597657.1|3383564_3384164_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	89.9	7.0e-100
WP_069597656.1|3384166_3384520_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	91.4	2.2e-53
WP_069597655.1|3384521_3385004_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	95.0	3.7e-83
WP_069597654.1|3385006_3385264_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	54.1	1.9e-14
WP_044704670.1|3385303_3386440_-|coat	coat protein	coat	G8C7P7	Escherichia_phage	92.3	1.1e-194
WP_058674857.1|3386456_3387209_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	93.6	4.9e-127
WP_022651635.1|3387316_3387526_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	1.0e-13
WP_069597653.1|3387529_3388636_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	88.6	3.8e-184
WP_048218134.1|3388637_3390041_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.5	4.0e-255
WP_069597652.1|3390045_3391617_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	99.4	0.0e+00
WP_069597651.1|3391613_3392264_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.2	1.3e-104
WP_058655832.1|3392429_3392648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032669769.1|3392803_3393322_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	99.4	6.5e-94
WP_063159647.1|3393618_3394005_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_063159646.1|3394001_3394442_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	82.6	1.9e-62
WP_001514184.1|3394445_3394721_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|3394717_3395119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058671431.1|3395485_3395767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032671042.1|3396064_3396829_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	74.8	1.4e-108
WP_137984231.1|3396828_3396945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524127.1|3396941_3397139_-	Lar family restriction alleviation protein	NA	M9NZE6	Enterobacteria_phage	89.2	3.3e-30
WP_069597649.1|3397135_3397777_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	78.1	1.0e-80
WP_022650992.1|3397770_3398238_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.3	7.3e-36
WP_069597648.1|3398234_3398405_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	90.6	1.0e-19
WP_063858768.1|3398397_3398847_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	1.5e-33
WP_126680751.1|3399098_3399341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058663667.1|3399337_3399919_-	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	43.5	4.3e-30
WP_080480778.1|3399922_3400507_-	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	45.8	2.3e-10
WP_169819049.1|3400943_3401120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080480773.1|3402044_3402359_-	protein ren	NA	M1FPD5	Enterobacteria_phage	48.4	4.7e-15
WP_069597646.1|3402348_3403722_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.7	3.8e-165
WP_063134394.1|3403718_3404804_-	replication protein	NA	E5AGE9	Erwinia_phage	45.6	1.8e-85
WP_013095956.1|3404790_3404958_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	78.2	2.1e-14
WP_069597679.1|3405043_3405589_-	hypothetical protein	NA	G8C7U3	Escherichia_phage	91.2	4.0e-86
WP_069597680.1|3405606_3405870_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	1.2e-16
WP_069597681.1|3405997_3406690_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.3	1.1e-59
WP_048248330.1|3406703_3407078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137984233.1|3407516_3407891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063946818.1|3408034_3408391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069597644.1|3408387_3408546_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	90.4	1.8e-18
WP_047052751.1|3408542_3408749_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	98.5	4.8e-32
WP_059347402.1|3408827_3409109_+	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	94.6	5.5e-47
WP_047052771.1|3409118_3410033_+	recombinase RecT	NA	G8C7T0	Escherichia_phage	98.7	4.4e-170
WP_069597643.1|3410029_3410512_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	97.5	2.7e-78
WP_063859030.1|3410520_3410949_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.1	9.8e-72
WP_047357022.1|3410945_3411098_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_063859029.1|3411094_3411736_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	90.4	2.1e-110
WP_071962276.1|3411719_3412322_+	HNH endonuclease	NA	A0A142IF90	Pseudomonas_phage	43.7	1.1e-23
WP_063845060.1|3412318_3413293_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	70.4	1.2e-146
WP_063851363.1|3413411_3413630_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.9	1.7e-16
WP_069597682.1|3413825_3414065_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	71.8	4.1e-27
WP_045288376.1|3414073_3414304_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	96.1	2.5e-34
WP_047052472.1|3414410_3414695_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	77.7	6.8e-37
WP_048981735.1|3414672_3415902_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	99.8	6.8e-243
WP_006811609.1|3416333_3416810_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_003860717.1|3416806_3417760_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_003860719.1|3417759_3418410_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3418441_3419017_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
3421028:3421045	attR	CGGTGTTAACGCCGCAGG	NA	NA	NA	NA
>prophage 9
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	3466350	3475557	4724316	integrase	Enterobacteria_phage(83.33%)	10	3459093:3459107	3479463:3479477
3459093:3459107	attL	GCCGCTTCATACAGC	NA	NA	NA	NA
WP_063159498.1|3466350_3467568_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	1.2e-106
WP_059443634.1|3467564_3469508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059443632.1|3469752_3470316_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.2	7.9e-61
WP_023323621.1|3470344_3470563_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_059443631.1|3470565_3471309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045344418.1|3471847_3472114_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	73.9	2.3e-31
WP_059443638.1|3472110_3472668_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.7	2.7e-29
WP_048206594.1|3472664_3472892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048206595.1|3472888_3473209_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_059443637.1|3473223_3475557_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
3479463:3479477	attR	GCTGTATGAAGCGGC	NA	NA	NA	NA
>prophage 10
NZ_CP017180	Enterobacter hormaechei subsp. oharae strain DSM 16687 chromosome, complete genome	4724316	4116448	4193111	4724316	capsid,terminase,integrase,head,tail,protease,tRNA,portal	uncultured_Caudovirales_phage(59.09%)	72	4165585:4165601	4194416:4194432
WP_017382726.1|4116448_4119304_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	1.6e-141
WP_047051243.1|4119427_4119931_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047051244.1|4120014_4121034_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	7.1e-44
WP_047051245.1|4121126_4122773_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_032618933.1|4122910_4124413_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	3.3e-82
WP_100245277.1|4124392_4125334_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.2e-16
WP_047051247.1|4126021_4130482_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_017382721.1|4130491_4131910_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_047051248.1|4131966_4132638_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_047051249.1|4132863_4133430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047051250.1|4133426_4135844_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_047051251.1|4135858_4136563_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_047051252.1|4136674_4137355_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_047051271.1|4137726_4138224_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	53.7	1.9e-26
WP_003860438.1|4138229_4138868_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003860436.1|4139175_4139568_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003860434.1|4139583_4140012_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_047051253.1|4140361_4141486_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003860432.1|4141675_4142074_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_047051254.1|4142244_4143612_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	5.1e-21
WP_003860430.1|4143704_4144772_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_047051255.1|4144823_4145762_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003860428.1|4146159_4146630_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_006812160.1|4147008_4147272_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_047051256.1|4147331_4147604_-	barstar family protein	NA	NA	NA	NA	NA
WP_047051257.1|4147649_4149104_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_047051258.1|4149190_4151158_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003860417.1|4151163_4152096_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003860416.1|4152103_4152307_-	AaeX family protein	NA	NA	NA	NA	NA
WP_003860415.1|4152486_4153413_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_047051259.1|4153632_4154247_+	YagU family protein	NA	NA	NA	NA	NA
WP_045340029.1|4154292_4155738_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_047051260.1|4155822_4159629_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003860405.1|4159671_4161141_-	ribonuclease G	NA	NA	NA	NA	NA
WP_040118162.1|4161130_4161724_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003860402.1|4161733_4162222_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003860400.1|4162221_4163238_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4163300_4164344_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
4165585:4165601	attL	AGCTGGCTGGCGATACT	NA	NA	NA	NA
WP_047051262.1|4166751_4167726_+	oxidoreductase	NA	NA	NA	NA	NA
WP_032626457.1|4167803_4168805_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_047051263.1|4168805_4169405_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_003860391.1|4169639_4170092_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_003860389.1|4170113_4170578_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003860388.1|4170588_4171938_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003860385.1|4172046_4172289_+	YhdT family protein	NA	NA	NA	NA	NA
WP_023323805.1|4172278_4173730_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_017382703.1|4173741_4174623_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_048981772.1|4174760_4175501_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_006812176.1|4175830_4176796_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4176819_4177116_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001547818.1|4177273_4177582_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_063159746.1|4177732_4179394_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4179377_4179734_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_162268555.1|4179864_4180017_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	72.0	1.8e-12
WP_063159732.1|4180009_4180453_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	95.2	1.4e-81
WP_042348057.1|4180452_4180746_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	97.9	4.7e-49
WP_032673047.1|4180742_4181081_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	98.2	2.4e-57
WP_063159733.1|4181077_4182313_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.6	3.3e-237
WP_063159734.1|4182314_4182875_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	94.6	6.1e-98
WP_063159735.1|4182926_4184093_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.6	3.7e-206
WP_058820232.1|4184355_4184868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063159736.1|4184916_4185252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063159737.1|4185594_4187730_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.1	3.4e-205
WP_063159738.1|4187729_4188095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063159739.1|4188091_4188460_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.3e-52
WP_063159740.1|4188456_4188771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063159741.1|4188763_4188949_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	78.9	2.1e-15
WP_063159742.1|4188941_4189154_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	40.4	4.5e-09
WP_063159743.1|4189653_4190433_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	52.0	3.6e-40
WP_001547839.1|4190441_4190726_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063159744.1|4190886_4191792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063159745.1|4191884_4193111_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.4	1.2e-151
4194416:4194432	attR	AGCTGGCTGGCGATACT	NA	NA	NA	NA
