The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017175	Burkholderia mallei strain Bahrain1 chromosome 1, complete sequence	3553991	116033	120958	3553991	transposase,portal,terminase,protease	Burkholderia_phage(33.33%)	6	NA	NA
WP_004539219.1|116033_116561_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	2.0e-21
WP_004199888.1|116782_117280_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|117276_118332_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|118375_118732_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_076835668.1|118734_119058_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	97.2	4.1e-54
WP_038802950.1|119838_120958_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 2
NZ_CP017175	Burkholderia mallei strain Bahrain1 chromosome 1, complete sequence	3553991	192952	239819	3553991	transposase,plate	Streptococcus_phage(28.57%)	44	NA	NA
WP_004191998.1|192952_194416_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196837.1|194522_194726_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_096325434.1|195045_196165_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011204166.1|196276_196408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196846.1|196391_196589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196848.1|196611_198018_+	amino acid permease	NA	NA	NA	NA	NA
WP_004551036.1|198331_198667_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004196853.1|198693_199494_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_004196857.1|199512_200091_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011204167.1|200213_200696_-	YraN family protein	NA	NA	NA	NA	NA
WP_004196861.1|200694_201582_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_004191998.1|201676_203140_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198058.1|203349_204612_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004198059.1|205209_205815_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|205776_206352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198061.1|206311_207595_-	MFS transporter	NA	NA	NA	NA	NA
WP_004198062.1|207753_208398_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011204168.1|208388_208739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198063.1|208735_209359_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004198067.1|210463_211600_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011204169.1|211596_211812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185303.1|211956_213075_-	acyltransferase	NA	NA	NA	NA	NA
WP_004199981.1|213073_213484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204170.1|213477_214020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009922408.1|214451_214547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069605483.1|214585_216751_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	27.1	2.5e-46
WP_071893038.1|217332_217731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205259.1|217773_218043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|218145_218376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012729786.1|218609_218966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|218991_220260_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004199993.1|220274_222536_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	4.2e-36
WP_004199995.1|222532_223981_+	TolC family protein	NA	NA	NA	NA	NA
WP_004199997.1|224190_225147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527832.1|225158_226124_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011204174.1|226141_226420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200001.1|226395_230289_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|230285_231275_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004185296.1|231279_232212_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004200005.1|232410_233532_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004202807.1|233621_236291_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	3.8e-89
WP_004200010.1|236324_237425_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_076839014.1|237388_239215_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011205263.1|239306_239819_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP017175	Burkholderia mallei strain Bahrain1 chromosome 1, complete sequence	3553991	1118735	1200055	3553991	transposase,protease,tRNA	Synechococcus_phage(13.64%)	59	NA	NA
WP_004191998.1|1118735_1120199_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004194336.1|1120486_1121560_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	47.3	7.2e-79
WP_009922080.1|1121670_1121838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194084.1|1121969_1123466_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004194407.1|1123545_1124373_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.0	7.3e-15
WP_004194295.1|1124424_1128618_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_004196324.1|1128784_1131562_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_004194023.1|1131960_1133610_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004200494.1|1133639_1134542_-	NAD kinase	NA	NA	NA	NA	NA
WP_004194248.1|1134675_1135698_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_004196493.1|1135870_1136974_+	ferrochelatase	NA	NA	NA	NA	NA
WP_004194347.1|1136979_1137387_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_004194243.1|1137883_1138441_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004194133.1|1138456_1138888_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004194034.1|1139033_1140986_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004194374.1|1141252_1142383_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1142416_1144423_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_069605506.1|1144598_1145414_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.7	6.7e-37
WP_004194274.1|1145478_1146162_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1146158_1146686_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|1146722_1148270_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194213.1|1148266_1148953_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004196484.1|1148974_1149700_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_004194386.1|1149998_1151054_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SEW4	Cyanophage	44.7	2.9e-72
WP_004194381.1|1151120_1152341_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	2.3e-238
WP_004194287.1|1152656_1153058_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_004194103.1|1153075_1154050_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_069605507.1|1154046_1156110_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.6	6.4e-76
WP_004194375.1|1156294_1156975_+	membrane protein	NA	NA	NA	NA	NA
WP_004550025.1|1157295_1158168_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_004194053.1|1158233_1159070_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004194323.1|1159340_1160768_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	1.3e-54
WP_011204114.1|1161165_1163181_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004196472.1|1163181_1164333_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004194378.1|1164513_1165677_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_004196469.1|1165758_1167306_+	capsular polysaccharide export inner-membrane protein, BexC/CtrB/KpsE family	NA	NA	NA	NA	NA
WP_004194135.1|1167312_1168095_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004194035.1|1168091_1168748_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.1	8.7e-11
WP_004194357.1|1168780_1170304_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024900377.1|1170326_1171649_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_011204113.1|1171658_1172600_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004194348.1|1172596_1174393_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_073699037.1|1174407_1175346_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194206.1|1175342_1176185_+	sugar nucleotide-binding protein	NA	A0A222YYW2	Synechococcus_phage	35.0	1.7e-38
WP_004194087.1|1176194_1177208_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	52.6	7.2e-97
WP_004194045.1|1177223_1178264_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	40.5	1.7e-61
WP_004194315.1|1178245_1178839_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	37.2	2.5e-17
WP_004194086.1|1178840_1179533_+	D-glycero-D-manno-heptose 1-phosphate guanosyltransferase	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	28.8	7.5e-05
WP_004194255.1|1179529_1180099_+	D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_004194360.1|1180365_1181568_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194054.1|1181564_1182353_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004196462.1|1182366_1183887_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_004202217.1|1183889_1191530_+	type I polyketide synthase	NA	NA	NA	NA	NA
WP_004194036.1|1191526_1192444_+	UDP-3-O-acyl N-acetylglycosamine deacetylase	NA	NA	NA	NA	NA
WP_004194209.1|1192508_1193828_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004194345.1|1193836_1194529_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096325460.1|1195504_1196624_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196461.1|1197443_1199744_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|1199740_1200055_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
>prophage 4
NZ_CP017175	Burkholderia mallei strain Bahrain1 chromosome 1, complete sequence	3553991	2173094	2222494	3553991	transposase,tRNA	Leptospira_phage(22.22%)	44	NA	NA
WP_004187628.1|2173094_2174315_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_009942176.1|2174506_2174815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009973369.1|2174797_2174974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081244528.1|2177585_2177924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192661.1|2178002_2180375_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_004197788.1|2180499_2181675_-	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_038802950.1|2181762_2182882_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_155762420.1|2183174_2183498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069605571.1|2183388_2184942_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|2184991_2186257_+	lipoprotein	NA	NA	NA	NA	NA
WP_011203914.1|2186407_2188087_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_009920703.1|2188211_2188343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193599.1|2188330_2188792_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|2189028_2189439_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004526858.1|2189410_2189629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550551.1|2189633_2190731_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|2190837_2192268_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|2192367_2193642_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|2193769_2196634_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|2196972_2198799_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_009930591.1|2198795_2198951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|2199091_2199589_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|2199688_2201185_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|2201252_2202488_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|2202510_2204070_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004191998.1|2204183_2205647_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011203915.1|2205937_2206873_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|2206899_2207268_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|2207373_2210301_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|2210392_2211868_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|2211864_2212326_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|2212630_2214295_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|2214358_2215687_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|2216105_2217008_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004550556.1|2217201_2217399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199443.1|2217426_2217828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_009920735.1|2217847_2217949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521676.1|2218033_2218291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|2218449_2218767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2218967_2219690_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|2219928_2220207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2220355_2220613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|2220662_2220953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2221374_2222494_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP017175	Burkholderia mallei strain Bahrain1 chromosome 1, complete sequence	3553991	2427699	2478660	3553991	transposase,coat,tRNA	Burkholderia_phage(12.5%)	43	NA	NA
WP_004199459.1|2427699_2428719_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004187628.1|2429445_2430666_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004547020.1|2430675_2430810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192691.1|2430993_2431248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011205090.1|2431321_2431567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191306.1|2431648_2431864_-	transporter	NA	NA	NA	NA	NA
WP_004193270.1|2431952_2432960_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.0	7.8e-27
WP_004191980.1|2432956_2433778_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_004192866.1|2433795_2434953_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_004199465.1|2436208_2437351_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_004191709.1|2437380_2437719_-	multidrug efflux SMR transporter	NA	E5EPE2	Acinetobacter_phage	33.6	8.7e-07
WP_004199466.1|2437723_2438221_-	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
WP_011203956.1|2438694_2438943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193229.1|2438939_2439485_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024900429.1|2439493_2440261_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004192823.1|2440294_2441125_+	arginyltransferase	NA	NA	NA	NA	NA
WP_004193208.1|2441229_2442267_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_069605573.1|2442377_2443172_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004521640.1|2443301_2443961_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038802950.1|2444136_2445257_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011807697.1|2445287_2446004_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_004192193.1|2446150_2447116_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004204967.1|2447619_2450244_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_069605541.1|2450929_2452150_+	CoA transferase	NA	NA	NA	NA	NA
WP_011203892.1|2452279_2452744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|2452960_2454670_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_011203891.1|2455001_2455475_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	3.7e-19
WP_004193860.1|2455502_2455889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196725.1|2458190_2458370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192265.1|2458366_2459227_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011203890.1|2459270_2460395_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004521730.1|2460829_2462503_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004192836.1|2462699_2463893_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004196723.1|2463951_2464272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191546.1|2464511_2465699_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004192651.1|2465871_2467491_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192810.1|2469480_2470113_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552891.1|2470113_2472195_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|2472605_2473571_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191504.1|2476043_2476883_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|2476900_2477425_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|2477501_2478062_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004192149.1|2478114_2478660_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP017175	Burkholderia mallei strain Bahrain1 chromosome 1, complete sequence	3553991	2866877	2919543	3553991	transposase,coat,protease	Leptospira_phage(18.18%)	51	NA	NA
WP_038802950.1|2866877_2867998_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|2868106_2868583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009970291.1|2868681_2869023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|2869039_2869264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|2869536_2870673_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|2870770_2871310_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004192840.1|2871482_2871863_+	lipoprotein	NA	NA	NA	NA	NA
WP_153260185.1|2871828_2871975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204204.1|2872469_2872880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192184.1|2872896_2873277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935757.1|2873477_2873702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266384.1|2873851_2874364_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_004192472.1|2874487_2875861_+	MFS transporter	NA	NA	NA	NA	NA
WP_004191641.1|2876600_2877212_+	membrane protein	NA	NA	NA	NA	NA
WP_004191763.1|2877384_2877987_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	62.8	2.6e-25
WP_004192381.1|2877979_2879398_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_004200093.1|2879532_2879730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204202.1|2879832_2880036_-	lipoprotein	NA	NA	NA	NA	NA
WP_004193447.1|2880017_2880548_+	lipoprotein	NA	NA	NA	NA	NA
WP_038802950.1|2880447_2881567_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004192968.1|2882032_2883373_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.2e-32
WP_004192556.1|2883426_2885184_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004550756.1|2885278_2885554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198606.1|2885680_2885947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193003.1|2886019_2887333_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004191521.1|2887316_2888015_-	response regulator	NA	W8CYM9	Bacillus_phage	36.7	2.9e-28
WP_004192043.1|2888256_2888802_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004198602.1|2890229_2891006_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004191164.1|2891216_2891906_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004193161.1|2891902_2892616_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004192946.1|2892650_2893418_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.8e-26
WP_004194381.1|2894294_2895515_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	2.3e-238
WP_004534273.1|2895615_2896716_+	porin	NA	NA	NA	NA	NA
WP_004193987.1|2897184_2897523_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004198600.1|2897583_2899284_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_004192390.1|2899404_2900583_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011203872.1|2900563_2900824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069605551.1|2901582_2902623_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.4e-07
WP_004192356.1|2902681_2903209_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_004193515.1|2903369_2904809_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192728.1|2904897_2905656_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004192161.1|2905694_2907002_+	MFS transporter	NA	NA	NA	NA	NA
WP_004193604.1|2907182_2908373_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004193146.1|2908377_2910357_-	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193185.1|2910356_2911346_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004199404.1|2911380_2911560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191560.1|2911672_2914657_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004191998.1|2914802_2916266_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192680.1|2916627_2917383_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004192784.1|2917565_2918381_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011203870.1|2918553_2919543_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 7
NZ_CP017175	Burkholderia mallei strain Bahrain1 chromosome 1, complete sequence	3553991	3491742	3548112	3553991	transposase,portal,protease,tRNA	Vibrio_phage(17.65%)	53	NA	NA
WP_004191998.1|3491742_3493206_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3493373_3494144_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3494175_3495015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3495141_3496614_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3496616_3498107_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3498219_3498519_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|3498884_3499928_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3500047_3501121_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3501117_3501630_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3501813_3504222_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3504233_3505382_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3505802_3506579_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3506575_3507361_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_009962395.1|3507353_3507686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189793.1|3507782_3508235_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3508254_3508887_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3508980_3509715_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_009918037.1|3509711_3510002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189647.1|3510182_3510866_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3510866_3513275_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3513276_3513867_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3513863_3515273_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3515650_3516508_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3516617_3517253_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3517373_3518357_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3518388_3518892_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3519120_3520311_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3520370_3520742_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3520952_3523562_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3523783_3524839_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3525288_3526305_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3526425_3527295_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3527332_3527737_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3528127_3529348_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_155762413.1|3529443_3530563_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	6.2e-49
WP_004200731.1|3530615_3531098_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3531094_3531379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188948.1|3531451_3532465_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	99.4	1.3e-194
WP_011203781.1|3533117_3533282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3533488_3534364_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3534374_3535487_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|3535515_3536610_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|3536752_3537721_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|3537823_3538393_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|3538979_3539528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011203779.1|3539543_3539795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3539791_3541240_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004204797.1|3541258_3542860_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|3543031_3543973_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|3543969_3545064_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3545465_3545882_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3546060_3546615_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3546992_3548112_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP017176	Burkholderia mallei strain Bahrain1 chromosome 2, complete sequence	2226175	342391	389052	2226175	plate,transposase	Leptospira_phage(33.33%)	35	NA	NA
WP_004190585.1|342391_343795_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|343810_345127_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190681.1|345129_348759_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190273.1|349655_349883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190797.1|349881_352479_+	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004190988.1|352531_353611_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190671.1|353673_354252_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|354244_355753_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|355812_356304_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|356322_356883_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190509.1|356887_358759_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190820.1|358755_360234_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190714.1|360212_362867_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	2.3e-78
WP_004203275.1|362863_365068_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004196151.1|365142_365796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204338.1|365755_366784_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038802950.1|366811_367932_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204352.1|368227_368500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205668.1|368496_370188_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	22.5	1.9e-17
WP_004187717.1|370288_373006_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004187807.1|373252_375970_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004188028.1|376017_377469_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004188791.1|377545_378055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188261.1|378211_379231_-	lyase	NA	NA	NA	NA	NA
WP_004187735.1|379428_380412_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004188685.1|380710_381511_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004536542.1|381710_382127_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004187439.1|382131_382500_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004188402.1|382504_384280_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004187935.1|384301_385003_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004188825.1|385004_385277_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_004188362.1|385329_386631_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004187842.1|386727_387702_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004200651.1|387777_387921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|387931_389052_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 2
NZ_CP017176	Burkholderia mallei strain Bahrain1 chromosome 2, complete sequence	2226175	1132564	1191019	2226175	integrase,transposase,protease	Leptospira_phage(33.33%)	55	1171608:1171627	1196919:1196938
WP_004199327.1|1132564_1133437_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004199325.1|1133648_1134353_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004202608.1|1134534_1135563_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199295.1|1136235_1136394_+	lipoprotein	NA	NA	NA	NA	NA
WP_004199294.1|1136409_1136931_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	5.1e-06
WP_004266248.1|1136927_1137752_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_004202605.1|1137820_1138807_+	YceI family protein	NA	NA	NA	NA	NA
WP_004198481.1|1138846_1139206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198480.1|1139202_1139430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516843.1|1139426_1139645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198478.1|1139703_1140213_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011204513.1|1140267_1141212_+	iron dicitrate transporter FecR	NA	NA	NA	NA	NA
WP_111947103.1|1141530_1143984_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004202602.1|1144195_1145176_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004206342.1|1145168_1145900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202600.1|1145896_1147714_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	9.2e-10
WP_004551656.1|1147710_1148760_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011832007.1|1148848_1149184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011205512.1|1149380_1150121_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_009968316.1|1150443_1150695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202590.1|1150857_1152117_-	monooxygenase	NA	NA	NA	NA	NA
WP_004202588.1|1152336_1153806_-	MFS transporter	NA	NA	NA	NA	NA
WP_011204511.1|1153848_1154163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081335194.1|1154202_1154853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1154894_1156014_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004539130.1|1156210_1156411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197866.1|1156403_1156676_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004184766.1|1156788_1158183_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.9	1.2e-20
WP_004197868.1|1158179_1158869_-	heavy metal response regulator transcription factor IrlR	NA	W8CYM9	Bacillus_phage	36.8	1.7e-36
WP_004202583.1|1158875_1162109_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_004197872.1|1162154_1163624_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_133307164.1|1163634_1164993_-	TolC family protein	NA	NA	NA	NA	NA
WP_004197874.1|1165053_1165239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197875.1|1165255_1165540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524134.1|1165937_1166078_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_004205924.1|1166547_1166778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197879.1|1166765_1167254_-	membrane protein	NA	NA	NA	NA	NA
WP_004197880.1|1167580_1168066_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004184790.1|1168333_1169689_+	amino acid permease	NA	NA	NA	NA	NA
WP_004197883.1|1169988_1170597_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004199606.1|1170735_1172736_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.2	1.1e-104
1171608:1171627	attL	CGCCGACGAAGCCGGGCGTG	NA	NA	NA	NA
WP_011204479.1|1173351_1173984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204480.1|1174108_1175875_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004199157.1|1176005_1176677_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004184876.1|1176827_1177925_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004199160.1|1177921_1181023_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.0	3.6e-46
WP_004266238.1|1181157_1182696_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_073699266.1|1182692_1183007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539149.1|1183025_1183670_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	44.6	7.2e-34
WP_004197695.1|1183666_1185364_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004197696.1|1185360_1186041_+	1,6-didemethyltoxoflavin N1-methyltransferase	NA	NA	NA	NA	NA
WP_004197697.1|1186114_1187812_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011204482.1|1187902_1188358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199610.1|1188719_1189877_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1189898_1191019_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1196919:1196938	attR	CGCCGACGAAGCCGGGCGTG	NA	NA	NA	NA
>prophage 3
NZ_CP017176	Burkholderia mallei strain Bahrain1 chromosome 2, complete sequence	2226175	1333457	1365297	2226175	transposase	Leptospira_phage(42.86%)	27	NA	NA
WP_038802950.1|1333457_1334577_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_038802950.1|1335446_1336567_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199588.1|1336712_1337123_-	heme-binding protein	NA	NA	NA	NA	NA
WP_004198129.1|1337182_1338583_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004198128.1|1338579_1339422_-	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198127.1|1339481_1339811_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004266710.1|1339870_1340422_-	membrane protein	NA	NA	NA	NA	NA
WP_004199587.1|1340645_1342736_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004198124.1|1343023_1344223_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_069605617.1|1344365_1345829_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_011204445.1|1345873_1346008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204588.1|1346033_1346822_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004198121.1|1347009_1347981_+	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004198120.1|1348129_1348975_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_081335195.1|1348987_1349314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191998.1|1349475_1350939_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198117.1|1351063_1351210_-	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1351359_1352480_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009941318.1|1355938_1356088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073699529.1|1358096_1358213_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_011204046.1|1358291_1358426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194622.1|1358652_1359204_-	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	34.1	2.3e-20
WP_004194628.1|1359208_1360663_-	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004199121.1|1360659_1361931_-	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194685.1|1361974_1362835_-	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_069605619.1|1362824_1363772_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004191998.1|1363833_1365297_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
