The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	177246	192691	4209935	protease,transposase	Corynebacterium_phage(100.0%)	16	NA	NA
WP_101547469.1|177246_178159_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_101556112.1|178231_179167_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_114355012.1|179175_179622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599196.1|180020_181598_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_069599197.1|181651_182152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599198.1|182148_182355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009882371.1|182869_184144_-|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
WP_125240290.1|184273_185098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599200.1|185206_185677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125240291.1|185858_186506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599202.1|186771_187308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085974909.1|187512_188896_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069599203.1|189037_189682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162619298.1|189666_190269_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_009883781.1|190397_191144_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_009884100.1|191140_192691_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	541423	645273	4209935	protease,transposase	Shigella_phage(14.29%)	92	NA	NA
WP_113717709.1|541423_542335_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_083248635.1|542462_543887_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_147271736.1|543874_546010_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_069599383.1|547100_548678_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_009883781.1|548904_549651_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_009884100.1|549647_551198_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_069599384.1|551254_552457_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_083248636.1|553212_553401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599388.1|554085_555171_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_113717711.1|555167_556307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113717803.1|557077_558235_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_113717805.1|558389_559581_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.1	6.4e-28
WP_069599392.1|560400_561489_-	YbdK family carboxylate-amine ligase	NA	NA	NA	NA	NA
WP_069599393.1|561888_562068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599394.1|562564_563617_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_069599395.1|563660_564014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599396.1|564148_565591_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_069599397.1|565693_565891_-	CsbD family protein	NA	NA	NA	NA	NA
WP_069599398.1|565952_566225_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_069599399.1|566273_566585_-	general stress protein	NA	NA	NA	NA	NA
WP_069599400.1|566847_567513_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069599401.1|567556_568645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083248913.1|568876_569170_-	DUF3263 domain-containing protein	NA	NA	NA	NA	NA
WP_069599402.1|569331_569805_+	DUF2505 domain-containing protein	NA	NA	NA	NA	NA
WP_069601250.1|570769_570985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599404.1|571012_571531_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_083248639.1|572599_573073_+	DUF4383 domain-containing protein	NA	NA	NA	NA	NA
WP_069599234.1|573257_573818_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069599233.1|573906_574368_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_069599406.1|574452_575454_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_069599407.1|575644_576631_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_069599408.1|576876_577458_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	26.7	4.2e-09
WP_009883781.1|577981_578728_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_009884100.1|578724_580275_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_069601251.1|580443_582018_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_083248641.1|583145_584213_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069599409.1|584699_584882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035279844.1|586367_586595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599412.1|587208_587817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125178126.1|588622_588925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599413.1|589269_590112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083248642.1|590650_591397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599415.1|591438_592620_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_113717713.1|592857_594450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599416.1|595110_596478_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_069601254.1|596647_597079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599417.1|597119_598835_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_069599418.1|598824_599532_+	response regulator	NA	NA	NA	NA	NA
WP_069599419.1|599647_600187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601255.1|600258_601113_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_069599420.1|601164_602700_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	1.5e-34
WP_069599421.1|602795_603590_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_069599422.1|603663_605061_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_069599423.1|605120_606080_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_069599424.1|606224_606704_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_069601256.1|606715_607498_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_069599425.1|607527_608529_+	NADPH:quinone oxidoreductase family protein	NA	NA	NA	NA	NA
WP_069599426.1|608610_609834_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_069599427.1|609830_610856_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_009881665.1|610905_611595_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009881664.1|611604_612564_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069601257.1|612618_613215_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069599428.1|613325_614288_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069599429.1|614398_615364_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069601258.1|615435_616236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009881659.1|616341_617115_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_162619308.1|617129_617480_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_069599431.1|617516_618293_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069601259.1|618416_618830_+	DUF2000 family protein	NA	NA	NA	NA	NA
WP_009881655.1|618908_619775_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_069599432.1|619750_620368_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_069599433.1|620430_621132_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069599434.1|621138_622074_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_069599435.1|622073_623294_-	CoA transferase	NA	NA	NA	NA	NA
WP_069599436.1|623494_624802_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_069599437.1|624809_625463_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_069601260.1|625705_626620_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_069599438.1|626616_627429_+	3-oxoadipate--succinyl-CoA transferase subunit B	NA	NA	NA	NA	NA
WP_069599439.1|627416_628085_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069599440.1|628072_628615_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162619309.1|628820_629183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009884204.1|629371_630769_-|transposase	IS1380-like element ISBli5 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.7	6.6e-125
WP_009885417.1|631427_632174_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	29.2	2.1e-05
WP_069599442.1|632170_633736_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_096147176.1|634935_635394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125187709.1|635390_636248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601261.1|636291_637467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081448687.1|637478_638153_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	4.4e-26
WP_069599443.1|638145_639342_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_069599133.1|639573_640689_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_009882371.1|641989_643264_-|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
WP_167352468.1|643854_645273_-|transposase	IS1380-like element ISBli4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	1043510	1109609	4209935	tRNA,protease,transposase,integrase	Mycobacterium_phage(30.77%)	53	1036260:1036276	1079193:1079209
1036260:1036276	attL	TCGTCCTTCGTCGCCTC	NA	NA	NA	NA
WP_069599652.1|1043510_1044611_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083248670.1|1044613_1044805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069599654.1|1045061_1045565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599655.1|1045561_1045936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162619315.1|1045925_1047038_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	35.3	1.3e-22
WP_069599657.1|1047695_1047884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599659.1|1048717_1050028_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.5	1.3e-167
WP_162619316.1|1049996_1050239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599661.1|1050544_1052185_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_069599659.1|1052449_1053760_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.5	1.3e-167
WP_069599662.1|1053842_1054715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162619317.1|1054755_1055955_-	lysine biosynthesis protein LysW	NA	NA	NA	NA	NA
WP_146001504.1|1056656_1057769_-	protein rep	NA	NA	NA	NA	NA
WP_069599664.1|1058332_1059838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599665.1|1060171_1061380_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_069599666.1|1063734_1064655_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069601284.1|1064674_1065289_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069599667.1|1065445_1067059_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	63.9	2.8e-18
WP_069599668.1|1067067_1069128_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_069601285.1|1069189_1070362_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_069599669.1|1070506_1071985_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_009883381.1|1072030_1072852_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_009883382.1|1072979_1073291_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069601286.1|1073314_1073800_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_009883384.1|1073959_1074463_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_069601287.1|1074471_1075275_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_069601288.1|1075297_1075963_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.9	1.9e-13
WP_069599670.1|1076030_1077221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009883388.1|1077213_1077744_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_029417075.1|1078026_1078563_+	nitroreductase	NA	NA	NA	NA	NA
WP_009883390.1|1078559_1079855_+	MFS transporter	NA	NA	NA	NA	NA
1079193:1079209	attR	GAGGCGACGAAGGACGA	NA	NA	NA	NA
WP_069601289.1|1083803_1084565_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069599672.1|1084695_1087236_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_009883394.1|1087519_1088164_-	VOC family protein	NA	NA	NA	NA	NA
WP_009883395.1|1088342_1088828_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	43.4	6.8e-29
WP_069599673.1|1088940_1090407_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_069601290.1|1090403_1091420_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_029417078.1|1091406_1092438_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_069601291.1|1092481_1093714_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009883400.1|1093879_1095163_+	MFS transporter	NA	NA	NA	NA	NA
WP_009883401.1|1095210_1095762_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	31.7	1.8e-09
WP_069599674.1|1095929_1098104_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	45.7	2.9e-111
WP_101598234.1|1098130_1098727_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	53.7	3.0e-42
WP_069599675.1|1098736_1099621_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.5	1.1e-16
WP_009884264.1|1099617_1100544_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_069599676.1|1100572_1101034_+	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_069599677.1|1101030_1101531_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_069599678.1|1101533_1103387_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_069601292.1|1103398_1104289_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_069599679.1|1104389_1105949_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	34.4	4.1e-75
WP_101557271.1|1105953_1106199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029417415.1|1106164_1106503_+	Lsr2 family protein	NA	S5W0B7	Mycobacterium_phage	37.4	1.7e-10
WP_009884271.1|1107056_1109609_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1S6UBG5	Serratia_phage	41.9	1.1e-133
>prophage 4
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	1194019	1267375	4209935	transposase,integrase	Gordonia_phage(20.0%)	67	1216657:1216672	1267920:1267933
WP_069599718.1|1194019_1195330_-|transposase	ISL3-like element ISBli1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.8	3.5e-168
WP_009882371.1|1196036_1197311_+|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
WP_069599719.1|1197464_1198031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599720.1|1198285_1198687_-	heme-binding protein	NA	NA	NA	NA	NA
WP_069599721.1|1198716_1199493_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_069599722.1|1199593_1200208_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_133066549.1|1200337_1200598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127361976.1|1201073_1202243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599725.1|1202433_1203015_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	27.7	6.5e-10
WP_125178027.1|1205091_1205409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083248683.1|1205659_1206214_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_069599727.1|1206269_1206857_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_069599728.1|1206853_1208074_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_069599729.1|1208096_1209530_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_113717727.1|1210035_1210200_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096158425.1|1210214_1211036_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.7	1.2e-06
WP_162619319.1|1211172_1211532_+|transposase	transposase	transposase	A0A1B3AZE5	Gordonia_phage	57.7	2.2e-16
WP_069601299.1|1211605_1213018_-	hypothetical protein	NA	A0A1V0SK38	Klosneuvirus	30.6	1.0e-48
WP_069599731.1|1213222_1213795_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083248685.1|1213838_1214864_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	66.6	4.7e-120
WP_069599732.1|1214894_1217051_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.5	8.7e-201
1216657:1216672	attL	TCTTCGAACCCTTCGA	NA	NA	NA	NA
WP_069599733.1|1217047_1217530_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.5	5.0e-16
1216657:1216672	attL	TCTTCGAACCCTTCGA	NA	NA	NA	NA
WP_035278435.1|1218071_1219001_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009882356.1|1218997_1219738_+	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	32.4	1.8e-17
WP_009882354.1|1219734_1220628_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_069599735.1|1220624_1221275_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_029416765.1|1221293_1221980_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_009882351.1|1222054_1223596_-	peptidoglycan recognition protein	NA	NA	NA	NA	NA
WP_069599736.1|1224270_1225407_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_029416759.1|1226242_1226821_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	45.1	1.3e-31
WP_009882337.1|1226892_1227519_+	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_069599737.1|1227617_1227935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009882371.1|1228263_1229538_+|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
WP_009885260.1|1229759_1230050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009885490.1|1230046_1232020_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P7R5	Enterobacteria_phage	27.5	5.5e-08
WP_035278301.1|1231982_1233071_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009882863.1|1233834_1234161_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069599738.1|1234416_1235028_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.2	1.3e-21
WP_162619320.1|1235404_1236202_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_083248688.1|1236186_1237023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009885516.1|1237000_1237543_+	hypothetical protein	NA	NA	NA	NA	NA
1237134:1237149	attR	TCGAAGGGTTCGAAGA	NA	NA	NA	NA
WP_069599741.1|1237997_1239089_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1237134:1237149	attR	TCGAAGGGTTCGAAGA	NA	NA	NA	NA
WP_162619321.1|1239106_1239283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083248689.1|1240315_1240522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069599742.1|1240799_1242002_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069599743.1|1241998_1242955_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069599744.1|1242951_1243977_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_113717729.1|1244023_1244758_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	48.5	5.7e-43
WP_009883477.1|1244682_1244994_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	46.1	2.1e-15
WP_009883781.1|1245547_1246294_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_009884100.1|1246290_1247841_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_083248691.1|1247897_1248653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009882346.1|1249535_1249964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125178024.1|1249992_1250622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009882371.1|1251538_1252813_+|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
WP_069599747.1|1253010_1253217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009881631.1|1253665_1254757_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162619322.1|1254929_1255577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162619323.1|1255758_1256163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009885260.1|1256427_1256718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009885490.1|1256714_1258688_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P7R5	Enterobacteria_phage	27.5	5.5e-08
WP_035278301.1|1258650_1259739_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069599744.1|1260049_1261075_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069599743.1|1261071_1262028_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069599742.1|1262024_1263227_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009883329.1|1263655_1265089_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.7	4.0e-61
WP_069599752.1|1266475_1267375_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	39.7	6.9e-35
1267920:1267933	attR	GTTGATGATCGTGA	NA	NA	NA	NA
>prophage 5
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	2005531	2027074	4209935	holin,transposase	Enterobacteria_phage(33.33%)	19	NA	NA
WP_055082838.1|2005531_2006518_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_069600089.1|2006487_2006958_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_069600090.1|2007064_2007874_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.8	4.8e-35
WP_069600091.1|2007875_2009546_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_069600092.1|2009579_2009909_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069600093.1|2009923_2010415_-	VOC family protein	NA	NA	NA	NA	NA
WP_009883781.1|2010880_2011627_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_009884100.1|2011623_2013174_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_167352471.1|2014595_2016017_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_009884202.1|2016369_2016951_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	27.7	6.5e-10
WP_009884203.1|2017501_2018695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009882371.1|2019550_2020825_+|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
WP_162619328.1|2021328_2022078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069600094.1|2022061_2022700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125178134.1|2023366_2023594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600095.1|2024444_2025344_+	universal stress protein	NA	NA	NA	NA	NA
WP_101584360.1|2025439_2026210_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009882457.1|2026316_2026550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009882456.1|2026660_2027074_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 6
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	2070545	2121298	4209935	capsid,portal,transposase,integrase	Mycobacterium_phage(20.0%)	43	2094633:2094671	2096108:2096146
WP_009881614.1|2070545_2071826_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	50.5	3.3e-107
WP_009882379.1|2073416_2074418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081448531.1|2074414_2075128_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	1.8e-25
WP_147271746.1|2075129_2076392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009882376.1|2076519_2076867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009882375.1|2077469_2077994_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	45.7	2.0e-13
WP_009882373.1|2078012_2078600_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_009884204.1|2078734_2080132_+|transposase	IS1380-like element ISBli5 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.7	6.6e-125
WP_081448653.1|2081379_2081766_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_167352468.1|2083331_2084750_+|transposase	IS1380-like element ISBli4 family transposase	transposase	NA	NA	NA	NA
WP_069600115.1|2084957_2085395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029417735.1|2086964_2088428_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_009885189.1|2088914_2089340_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_069600116.1|2089465_2091466_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.0	2.1e-108
WP_029417737.1|2091559_2091793_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_029417739.1|2091959_2092643_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_009885193.1|2092850_2093315_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_069600117.1|2093610_2094519_-	universal stress protein	NA	NA	NA	NA	NA
2094633:2094671	attL	CGACGAGACTCATAGATAGTCCCCGCGTAGCCAAGGGTC	NA	NA	NA	NA
WP_096145777.1|2094737_2096030_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_029417741.1|2096399_2096732_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
2096108:2096146	attR	CGACGAGACTCATAGATAGTCCCCGCGTAGCCAAGGGTC	NA	NA	NA	NA
WP_009885196.1|2096777_2097149_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_069600118.1|2097533_2098079_+	YceI family protein	NA	NA	NA	NA	NA
WP_069600119.1|2098206_2098947_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_081448654.1|2098943_2100356_-	nitrate reductase	NA	Q9KX94	Enterobacteria_phage	44.7	3.7e-83
WP_009885200.1|2100534_2101590_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_009885201.1|2101634_2103176_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	23.5	6.3e-20
WP_009885202.1|2103364_2104198_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_069600120.1|2104243_2104972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083248728.1|2105038_2105836_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_009885205.1|2106350_2107016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600121.1|2107017_2107851_-	ROK family protein	NA	NA	NA	NA	NA
WP_069600122.1|2107861_2108770_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_009885208.1|2108908_2109634_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009885209.1|2109802_2110921_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_009885210.1|2111249_2111453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009885211.1|2111456_2112815_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_069600123.1|2112819_2115861_+	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_069600124.1|2115870_2117340_-	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.3	4.2e-29
WP_069600125.1|2117805_2118129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600126.1|2118128_2118467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600127.1|2118468_2119308_-|capsid	phage major capsid protein	capsid	I3ULZ9	Rhodobacter_phage	23.6	3.7e-06
WP_069600128.1|2119425_2119908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600129.1|2119909_2121298_-|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	35.4	8.2e-51
>prophage 7
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	2142653	2212622	4209935	tRNA,transposase	Streptomyces_phage(13.33%)	65	NA	NA
WP_009884649.1|2142653_2143358_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_009884648.1|2143466_2144339_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_069600143.1|2144335_2146033_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_069600144.1|2146029_2146431_+	cytochrome c oxidase subunit 4	NA	NA	NA	NA	NA
WP_069600146.1|2147766_2149392_-	ubiquinol-cytochrome c reductase cytochrome b subunit	NA	NA	NA	NA	NA
WP_069600147.1|2149388_2150432_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_029417563.1|2150481_2151267_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_009884639.1|2151324_2151894_-	heme-copper oxidase subunit III	NA	NA	NA	NA	NA
WP_069600148.1|2152179_2153301_+	anthranilate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_069600149.1|2153268_2155014_-	DEDD exonuclease domain-containing protein	NA	G3MAD3	Bacillus_virus	28.8	4.7e-11
WP_009884636.1|2155073_2155496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009884635.1|2155525_2156317_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_035279411.1|2156402_2157182_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_009884633.1|2157422_2158004_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029417561.1|2158298_2159111_-	ParA family protein	NA	NA	NA	NA	NA
WP_009884631.1|2159285_2162687_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_009884630.1|2162679_2163186_+	peptide deformylase	NA	A0A142EZU8	Stenotrophomonas_phage	30.5	1.2e-07
WP_009884629.1|2163227_2164082_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_069600150.1|2164177_2165437_-	aminotransferase	NA	NA	NA	NA	NA
WP_069600151.1|2165530_2166292_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_069600152.1|2166426_2166891_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_069600153.1|2166974_2167910_+	AEC family transporter	NA	NA	NA	NA	NA
WP_029417556.1|2168068_2168584_-	ferritin	NA	NA	NA	NA	NA
WP_009884623.1|2168782_2169064_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_069600154.1|2169039_2170488_-	amidase	NA	NA	NA	NA	NA
WP_069600155.1|2170492_2171725_-	amidohydrolase	NA	NA	NA	NA	NA
WP_069600156.1|2171793_2172528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600157.1|2172538_2173285_-	DUF5058 family protein	NA	NA	NA	NA	NA
WP_069600158.1|2173507_2174068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162619332.1|2174134_2174287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162619333.1|2174243_2174459_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_069601348.1|2174553_2175060_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_009884902.1|2175417_2175891_-	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	57.1	5.3e-26
WP_009884901.1|2176071_2178453_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.6	4.7e-123
WP_069600159.1|2178458_2178878_-	VOC family protein	NA	NA	NA	NA	NA
WP_069600160.1|2178889_2179324_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009884898.1|2179320_2180865_-	APC family permease	NA	NA	NA	NA	NA
WP_069600161.1|2180889_2182242_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069601349.1|2182344_2183316_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069600162.1|2183374_2184319_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_069600163.1|2184344_2184656_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	57.9	2.7e-18
WP_069600164.1|2184618_2185929_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	66.4	7.7e-168
WP_096146982.1|2186053_2186284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600166.1|2187558_2188164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600167.1|2188312_2188708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069600168.1|2188795_2189422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069600169.1|2190416_2190977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009885521.1|2191034_2191379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083248732.1|2191628_2192696_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069600171.1|2193914_2194289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600172.1|2194325_2195477_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_083248733.1|2197469_2198105_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_113717818.1|2198160_2199311_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.3	7.8e-39
WP_069601355.1|2199878_2200583_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	42.9	7.1e-35
WP_009882371.1|2201005_2202280_-|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
WP_069600174.1|2202340_2202718_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_147271743.1|2202852_2203164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029603710.1|2203213_2203531_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	63.8	5.6e-32
WP_162619334.1|2203533_2204238_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	62.7	3.3e-72
WP_069600176.1|2205932_2206385_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	39.8	1.2e-11
WP_069600177.1|2206381_2209009_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.9	1.2e-124
WP_069600178.1|2208999_2209311_-	HspR protein	NA	NA	NA	NA	NA
WP_069600179.1|2209307_2210195_-	DnaJ domain-containing protein	NA	A0A167RAM8	Powai_lake_megavirus	51.3	8.7e-14
WP_069600180.1|2210198_2210738_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_069600181.1|2210756_2212622_-	molecular chaperone DnaK	NA	M4R062	Micromonas_pusilla_virus	47.4	3.0e-149
>prophage 8
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	2627728	2661741	4209935	tRNA,holin,transposase,integrase	Gordonia_phage(30.0%)	21	2647982:2647998	2665256:2665272
WP_009883061.1|2627728_2629291_+|holin	choline oxidase	holin	A0A1V0SI18	Klosneuvirus	44.9	8.7e-118
WP_069600349.1|2629546_2631343_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.3	1.6e-19
WP_029417909.1|2631445_2631757_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	48.0	1.5e-16
WP_083248757.1|2631753_2632665_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	44.7	5.0e-41
WP_162619336.1|2632873_2633212_+|transposase	transposase	transposase	A0A160DCU2	Gordonia_phage	54.4	9.6e-22
WP_009885325.1|2639365_2639767_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_069600350.1|2640017_2641304_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	38.0	2.2e-66
WP_069600351.1|2641930_2643352_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_069600352.1|2643428_2643944_-	arginine repressor	NA	NA	NA	NA	NA
WP_069600353.1|2643940_2644864_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_069600354.1|2644957_2646175_-	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	26.3	1.2e-13
WP_167352473.1|2646167_2647151_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_069600356.1|2647165_2648344_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
2647982:2647998	attL	GCCGCCGACGCCGATGA	NA	NA	NA	NA
WP_069600357.1|2648340_2649450_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_069600358.1|2649494_2650472_+	quinone oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	3.9e-07
WP_083248759.1|2652022_2653090_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_113717825.1|2653883_2654999_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_069600360.1|2655066_2657058_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_069600361.1|2657054_2659772_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	36.4	4.0e-142
WP_069600362.1|2660086_2660551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162619337.1|2660994_2661741_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	40.2	1.6e-13
2665256:2665272	attR	TCATCGGCGTCGGCGGC	NA	NA	NA	NA
>prophage 9
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	2928114	3002089	4209935	tRNA,transposase,integrase	Mycobacterium_phage(33.33%)	60	2997213:2997240	3000604:3000631
WP_009882663.1|2928114_2929617_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_009882665.1|2929616_2929922_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_147271706.1|2930068_2930635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600505.1|2930752_2932942_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	35.5	4.7e-101
WP_069600506.1|2932938_2934093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600507.1|2934085_2936098_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_069600508.1|2936182_2937376_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_009882677.1|2938704_2939055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069600510.1|2941347_2942292_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_035278552.1|2942482_2944075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085974892.1|2944316_2944925_+	oligoribonuclease	NA	A0A0K0N5G5	Tsukamurella_phage	36.2	9.8e-17
WP_035278538.1|2945002_2945428_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069600511.1|2945424_2947119_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_069601392.1|2947174_2948095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600512.1|2948111_2948954_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009882688.1|2949176_2950172_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_069601393.1|2950183_2951698_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_081448542.1|2951895_2952456_+	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_101557325.1|2952511_2953234_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_162619340.1|2953301_2953451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069600513.1|2953564_2954854_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	37.9	2.4e-49
WP_069600514.1|2954919_2956200_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_009882695.1|2956245_2956605_+	antitoxin	NA	NA	NA	NA	NA
WP_069600515.1|2956611_2957340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600516.1|2957342_2958197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009882698.1|2958402_2959722_+	glutaminase	NA	NA	NA	NA	NA
WP_009882699.1|2959901_2960720_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_069600517.1|2960769_2963043_-	LPXTG cell wall anchor domain-containing protein	NA	M4SLV1	Cyanophage	24.8	2.2e-08
WP_009882701.1|2963191_2964115_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_069600518.1|2964111_2964975_-	ribokinase	NA	NA	NA	NA	NA
WP_009882705.1|2965065_2965494_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_101557318.1|2966033_2966372_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069600520.1|2966678_2968130_-	allantoin permease	NA	NA	NA	NA	NA
WP_083248941.1|2968155_2969031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600522.1|2969199_2970123_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069600523.1|2970372_2971845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600524.1|2971945_2972437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600525.1|2972474_2974835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600526.1|2974831_2976571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600527.1|2976605_2977868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600528.1|2978011_2981413_-	hypothetical protein	NA	A0A068F1K4	Mycobacterium_phage	26.2	1.2e-18
WP_069600529.1|2981439_2982582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600530.1|2982585_2982885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600531.1|2982891_2983509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600532.1|2983625_2984141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162619341.1|2984191_2985910_-	DUF2800 domain-containing protein	NA	NA	NA	NA	NA
WP_069600534.1|2986020_2987892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600535.1|2987810_2989001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600536.1|2988987_2989698_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_083248778.1|2989976_2990375_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013350322.1|2990432_2991743_+|transposase	ISL3-like element ISAar39 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	64.8	7.2e-166
WP_013350323.1|2991766_2992543_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.0	4.8e-16
WP_069600538.1|2992539_2993604_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_069600539.1|2993593_2994625_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013350326.1|2994639_2995482_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_101557321.1|2995670_2996835_+|transposase	IS3-like element ISAar24 family transposase	transposase	U5P429	Shigella_phage	37.2	5.5e-40
2997213:2997240	attL	GATTATGCCGAGGTTTTCGTTAACCCGA	NA	NA	NA	NA
WP_069600541.1|2997306_2998332_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069599743.1|2998328_2999285_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069599742.1|2999281_3000484_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069600542.1|3000787_3002089_+|transposase	ISL3-like element ISAar42 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.7	4.9e-183
3000604:3000631	attR	TCGGGTTAACGAAAACCTCGGCATAATC	NA	NA	NA	NA
>prophage 10
NZ_CP017150	Brevibacterium aurantiacum strain SMQ-1335 chromosome, complete genome	4209935	3131259	3166441	4209935	capsid,integrase,portal,transposase,terminase	Gordonia_phage(16.67%)	32	3118817:3118831	3171292:3171306
3118817:3118831	attL	CTGCCCGACATCACC	NA	NA	NA	NA
WP_083248787.1|3131259_3131997_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	40.4	2.8e-42
WP_009883781.1|3132108_3132855_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_009884100.1|3132851_3134402_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_069600621.1|3134577_3134943_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3XBN7	Gordonia_phage	65.5	7.4e-12
WP_069600622.1|3135001_3135982_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	80.1	7.3e-147
WP_069600623.1|3136128_3138291_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.8	5.3e-214
WP_009881978.1|3138260_3138674_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A0K2FM04	Brevibacillus_phage	40.8	2.2e-12
WP_009881976.1|3138675_3138924_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	53.3	1.8e-17
WP_009881973.1|3139512_3140508_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_069600624.1|3140520_3141405_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_069600625.1|3141391_3141844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069600626.1|3141834_3142809_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_069600627.1|3142805_3143882_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_069600628.1|3143878_3144673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009881963.1|3144696_3145806_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_069600629.1|3145818_3147300_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009881961.1|3147435_3148446_+	agmatinase	NA	NA	NA	NA	NA
WP_069600630.1|3148448_3150137_+	acetolactate synthase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	23.3	2.7e-16
WP_069600631.1|3150186_3151710_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_069600632.1|3151946_3153599_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_009881955.1|3154209_3154680_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.8	8.4e-32
WP_009881954.1|3154868_3156098_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1D6X855	Bacillus_phage	39.1	1.2e-21
WP_009881953.1|3156099_3157014_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009881952.1|3157010_3157700_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.5	1.1e-29
WP_069600633.1|3157867_3158986_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_069600634.1|3159122_3160349_-	hemin transporter	NA	NA	NA	NA	NA
WP_069600636.1|3161473_3161797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147271731.1|3161796_3162126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600638.1|3162136_3162973_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_069600639.1|3163091_3163574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069600640.1|3163575_3164964_-|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	35.7	1.4e-50
WP_069600641.1|3164968_3166441_-|terminase	terminase	terminase	A0A2K9VGS4	Pontimonas_phage	32.9	1.2e-47
3171292:3171306	attR	CTGCCCGACATCACC	NA	NA	NA	NA
