The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	490914	528886	3923603	terminase,integrase,tRNA,plate,head,capsid,lysis,tail,portal	Salmonella_phage(82.05%)	46	491798:491853	522590:522645
WP_012847325.1|490914_491577_+	fructose-6-phosphate aldolase	NA	A0A0E3EPH4	Synechococcus_phage	31.8	8.2e-25
491798:491853	attL	GCTAAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_133176303.1|491980_493453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578110.1|493455_494469_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	59.6	4.1e-116
WP_071890235.1|494695_495310_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.1	6.0e-38
WP_068871156.1|495411_495648_+	regulator	NA	NA	NA	NA	NA
WP_069578112.1|495682_496192_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	88.8	8.1e-81
WP_071890237.1|496368_496710_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	83.2	6.0e-48
WP_069578116.1|496777_497011_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	72.7	1.2e-20
WP_133176304.1|497010_497229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071890240.1|497228_497456_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	2.1e-33
WP_071890243.1|497452_498313_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	79.0	9.7e-127
WP_069578121.1|498303_500685_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.2	0.0e+00
WP_069578123.1|500841_501030_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	79.0	2.0e-21
WP_071890246.1|501347_501893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578125.1|501937_502960_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	92.1	4.9e-178
WP_069578126.1|502959_504726_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.5	0.0e+00
WP_069578127.1|504867_505701_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.9	3.6e-110
WP_069578129.1|505716_506778_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	95.8	2.7e-187
WP_069578130.1|506781_507435_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	94.9	1.7e-107
WP_069578131.1|507528_507993_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.1e-71
WP_068871195.1|507992_508196_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	97.0	4.2e-33
WP_068871198.1|508199_508415_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	93.0	6.1e-30
WP_069578133.1|508395_508911_+	lysozyme	NA	E5G6N1	Salmonella_phage	74.3	2.2e-70
WP_069578134.1|508907_509336_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	80.3	9.2e-54
WP_068871205.1|509431_509863_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	93.0	2.9e-71
WP_069578135.1|509855_510302_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	82.9	4.8e-61
WP_069578137.1|510298_510964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578138.1|511052_511631_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	88.5	4.5e-96
WP_069578139.1|511627_511987_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.7	7.7e-54
WP_069578141.1|511973_512882_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	89.1	3.5e-143
WP_069578142.1|512874_513480_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	91.5	1.9e-108
WP_084822820.1|513476_514994_+	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	53.0	1.9e-154
WP_069578143.1|514996_515524_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	43.5	2.2e-28
WP_069578144.1|515636_516809_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	4.3e-210
WP_069578146.1|516818_517334_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	1.8e-88
WP_068871223.1|517387_517690_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	97.0	4.7e-44
WP_032680256.1|517704_517824_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	89.7	1.7e-13
WP_069578147.1|517816_520618_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	59.9	4.4e-269
WP_069578148.1|520614_521100_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	82.6	3.7e-67
WP_069578150.1|521096_522194_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.9	1.8e-173
WP_032681944.1|522262_522478_+	late control protein B	NA	Q53ZE7	Salmonella_virus	72.2	9.4e-23
WP_012847326.1|522809_523322_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
522590:522645	attR	GCTAAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_015460877.1|523424_525260_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_012847328.1|525495_527244_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	7.1e-76
WP_005295814.1|527431_527647_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069578151.1|527860_528886_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	2.9e-106
>prophage 2
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	866491	930143	3923603	integrase,tRNA,transposase	Streptococcus_phage(12.5%)	50	852832:852848	940250:940266
852832:852848	attL	AACGCCCGGCGTCGCGC	NA	NA	NA	NA
WP_012847627.1|866491_867811_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7IXR9	Paramecium_bursaria_Chlorella_virus	23.0	2.2e-05
WP_069578245.1|867843_868173_+	cytochrome c	NA	NA	NA	NA	NA
WP_012847629.1|868230_868491_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_012847630.1|868477_868678_-	YaeP family protein	NA	NA	NA	NA	NA
WP_012847632.1|868897_869446_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_012847633.1|869447_869864_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_012847634.1|869965_870643_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_012847635.1|870664_870925_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.9e-17
WP_015461014.1|871050_871902_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012847637.1|872078_872702_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_012847638.1|872733_873885_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_012847639.1|874155_874494_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_015461015.1|874690_875203_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_012847641.1|875219_876644_-	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	34.5	3.4e-12
WP_109729052.1|876924_880815_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	61.3	2.6e-134
WP_015461017.1|881300_882716_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.2	3.9e-16
WP_109729053.1|882730_883450_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_012847645.1|883453_884794_+	two-component system response regulator GlrR	NA	NA	NA	NA	NA
WP_015461019.1|884944_886567_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.6	6.1e-90
WP_005283058.1|886580_886919_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_012847647.1|887166_887748_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	28.2	3.1e-12
WP_012847648.1|887792_888560_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_012847649.1|888530_889253_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012847650.1|889560_890607_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_069578248.1|890672_892127_-	amino acid permease	NA	NA	NA	NA	NA
WP_012847652.1|892178_893630_-	amino acid permease	NA	NA	NA	NA	NA
WP_012847653.1|893799_895512_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_069578249.1|896235_897294_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_012847656.1|897393_898647_+	peptidase T	NA	NA	NA	NA	NA
WP_012847657.1|898643_900005_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_015461025.1|900138_900672_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	8.5e-49
WP_015461026.1|900760_902221_-	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
WP_012847660.1|902636_903095_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_069578251.1|903278_904544_+	esterase FrsA	NA	NA	NA	NA	NA
WP_069578253.1|904605_905007_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_012847663.1|905201_906308_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.6	1.1e-58
WP_012847664.1|906317_907571_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.3e-91
WP_012847665.1|907641_908673_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069578255.1|909128_910325_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	7.6e-130
WP_069578256.1|910599_910842_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	76.3	3.4e-21
WP_071890249.1|910897_914149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109729013.1|914284_915128_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	48.7	2.8e-22
WP_069578257.1|915267_915888_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.9e-36
WP_045341144.1|916516_917395_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_084822824.1|917761_919570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578261.1|921767_922991_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_069578262.1|923107_925309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015683265.1|925308_927015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109729054.1|927833_928998_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	48.5	1.7e-73
WP_156776830.1|929031_930143_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	3.8e-06
940250:940266	attR	AACGCCCGGCGTCGCGC	NA	NA	NA	NA
>prophage 3
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	1719275	1771186	3923603	terminase,holin,integrase,capsid,transposase,portal	Escherichia_phage(30.56%)	60	1710770:1710785	1788272:1788287
1710770:1710785	attL	GCCAGCGCGGCGCTGC	NA	NA	NA	NA
WP_069579640.1|1719275_1719632_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	43.0	9.8e-17
WP_069578521.1|1720024_1721119_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	42.3	6.2e-62
WP_015871361.1|1721105_1721354_-	excisionase	NA	NA	NA	NA	NA
WP_069578523.1|1721453_1721732_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	58.7	1.8e-26
WP_069578525.1|1721731_1722019_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	5.3e-21
WP_071890273.1|1722101_1722761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578527.1|1723270_1724029_-	hypothetical protein	NA	A0A0N6WET9	Escherichia_phage	73.4	5.8e-43
WP_069578529.1|1724778_1726164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578531.1|1726357_1726858_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_069578534.1|1727121_1727589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578536.1|1727618_1727768_-	potassium transporter 7	NA	NA	NA	NA	NA
WP_069578538.1|1727831_1728134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578539.1|1728152_1729223_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	55.7	4.5e-81
WP_069578540.1|1731884_1732187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578542.1|1732352_1732826_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	3.6e-67
WP_069578543.1|1733479_1734154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578544.1|1734155_1734986_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_069578545.1|1735188_1735485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109729013.1|1735936_1736781_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	48.7	2.8e-22
WP_071890277.1|1736826_1737828_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	35.8	1.7e-50
WP_078057774.1|1738001_1738631_-	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	57.9	3.1e-66
WP_071890280.1|1738772_1738982_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	52.3	7.2e-12
WP_069578549.1|1739046_1739403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578550.1|1739399_1739630_+	porin	NA	NA	NA	NA	NA
WP_069578552.1|1739661_1739922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578554.1|1740123_1741062_+	helix-turn-helix domain-containing protein	NA	A0A1R3Y5R9	Salmonella_virus	66.0	3.2e-30
WP_069578555.1|1741058_1742441_+	AAA family ATPase	NA	A0A1V0E5J4	Salmonella_phage	64.8	1.0e-162
WP_069578556.1|1742470_1742818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578557.1|1742927_1743572_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	33.0	4.0e-16
WP_069578558.1|1743574_1743877_+	DUF1364 domain-containing protein	NA	A0A2I7R6Q3	Vibrio_phage	52.9	3.5e-15
WP_069578559.1|1744168_1744414_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_015871333.1|1744550_1744859_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	90.2	9.0e-43
WP_015871332.1|1744848_1745178_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	88.5	1.3e-39
WP_071890285.1|1746585_1747347_+	hypothetical protein	NA	A0A0P0ZDY7	Stx2-converting_phage	74.3	1.2e-40
WP_071890287.1|1747580_1748561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133176305.1|1748557_1749079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069578561.1|1749401_1750220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133176306.1|1750453_1750852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578562.1|1750969_1751200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578563.1|1751174_1751504_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012848472.1|1751589_1751928_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	52.9	3.5e-24
WP_084822832.1|1751930_1752482_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	70.6	1.3e-71
WP_069579643.1|1752662_1753445_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	60.2	5.0e-29
WP_069578564.1|1753547_1754093_+	DUF2514 family protein	NA	A0A291AXG6	Shigella_phage	33.5	4.2e-11
WP_069578566.1|1754449_1755226_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	49.3	9.0e-07
WP_084822833.1|1755203_1756880_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	70.1	1.2e-229
WP_069578567.1|1756876_1758991_+|portal	portal protein	portal	A0A088CE71	Shigella_phage	63.2	1.8e-222
WP_069578568.1|1759063_1759345_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	7.0e-18
WP_069578569.1|1759334_1759586_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_069578570.1|1759863_1760865_+	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	34.0	8.0e-32
WP_069578572.1|1760882_1762121_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	72.0	3.0e-169
WP_069578573.1|1762179_1762575_+	hypothetical protein	NA	V5UT93	Shigella_phage	38.5	4.6e-15
WP_069578574.1|1762616_1763060_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	46.5	2.7e-24
WP_069578575.1|1763059_1763641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578577.1|1763640_1764303_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	55.5	8.1e-65
WP_069578579.1|1766610_1768239_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	53.2	9.6e-160
WP_069578580.1|1768282_1769824_+	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	41.7	5.3e-75
WP_069578582.1|1769820_1770192_+	hypothetical protein	NA	A0A1I9KFI0	Aeromonas_phage	33.3	8.1e-06
WP_069578583.1|1770202_1770778_+	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	51.3	4.7e-45
WP_069578585.1|1770805_1771186_+	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	47.6	2.3e-24
1788272:1788287	attR	GCAGCGCCGCGCTGGC	NA	NA	NA	NA
>prophage 4
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	1959372	1969316	3923603	tRNA	Bacillus_phage(14.29%)	11	NA	NA
WP_045474762.1|1959372_1959861_-	endopeptidase	NA	S5MM68	Bacillus_phage	38.5	2.2e-11
WP_012848646.1|1960004_1960772_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	3.4e-06
WP_012848648.1|1961775_1961979_-	protein DsrB	NA	NA	NA	NA	NA
WP_005285818.1|1962068_1962365_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	2.4e-13
WP_069578659.1|1962369_1964757_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	2.1e-06
WP_012848650.1|1964771_1965755_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_106120997.1|1965940_1965985_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_015461533.1|1966147_1966504_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005293643.1|1966547_1966745_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_034163363.1|1966841_1967384_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	7.4e-16
WP_015461535.1|1967387_1969316_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	2.0e-127
>prophage 5
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	2067718	2075350	3923603		Escherichia_phage(66.67%)	8	NA	NA
WP_012848758.1|2067718_2068498_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	58.2	2.2e-69
WP_015461589.1|2068701_2069622_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	70.4	5.0e-105
WP_012848760.1|2069618_2070878_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	57.3	7.5e-120
WP_069578692.1|2070874_2071513_+	aldolase	NA	A0A077SK32	Escherichia_phage	64.0	3.1e-69
WP_069578693.1|2071515_2072292_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_012848763.1|2072366_2073737_+	GntP family transporter	NA	NA	NA	NA	NA
WP_012848764.1|2073830_2074190_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	49.0	2.0e-17
WP_012848765.1|2074384_2075350_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	32.5	9.1e-41
>prophage 6
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	2376014	2383840	3923603	tRNA	Escherichia_phage(66.67%)	6	NA	NA
WP_012849023.1|2376014_2376629_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.1	4.7e-27
WP_034168058.1|2376684_2377545_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.2	1.5e-23
WP_012849025.1|2377546_2378164_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	62.1	4.1e-79
WP_015461824.1|2378174_2380622_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	2.5e-220
WP_012849028.1|2381083_2382376_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.2	6.8e-92
WP_069578834.1|2382496_2383840_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.1	1.8e-74
>prophage 7
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	2612264	2755140	3923603	terminase,holin,integrase,tRNA,portal,protease,head,capsid,lysis,tail,transposase,plate	Enterobacteria_phage(29.07%)	150	2706667:2706692	2752761:2752786
WP_015461939.1|2612264_2613077_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_069578959.1|2613091_2614102_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012849246.1|2614210_2615338_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.6	1.8e-19
WP_078057746.1|2615564_2615924_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_069578964.1|2616072_2616570_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_012849249.1|2616641_2617388_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015461944.1|2617514_2618726_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_069578966.1|2618898_2620923_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_012849252.1|2621059_2621341_-	YfcL family protein	NA	NA	NA	NA	NA
WP_069578968.1|2621379_2621928_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_012849254.1|2622028_2622829_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_071890320.1|2623132_2624587_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_041692883.1|2625169_2625472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051065053.1|2625721_2626237_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012849259.1|2626233_2627721_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012849260.1|2627790_2628282_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_069578972.1|2628381_2629602_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_015461951.1|2629610_2630087_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012849263.1|2630090_2631932_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069578974.1|2631928_2632954_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_081604803.1|2633072_2635685_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.4	5.1e-86
WP_015461955.1|2635684_2637670_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.3	1.0e-46
WP_012849267.1|2637764_2638067_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_069578976.1|2639133_2639775_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_069578978.1|2639873_2641262_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069578980.1|2641258_2641909_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_069578982.1|2641905_2645688_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_109615053.1|2645819_2646650_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_012849275.1|2647840_2648773_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015461963.1|2648983_2649529_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_012849277.1|2649579_2650056_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_015461965.1|2650447_2650744_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_012849280.1|2651141_2652458_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_015461477.1|2652778_2653237_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.9e-14
WP_012849281.1|2653421_2654189_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_084822839.1|2654259_2655474_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_012849283.1|2655470_2655974_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012849284.1|2655970_2656525_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_069578984.1|2656521_2658492_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_015461968.1|2658488_2658977_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_012849287.1|2658976_2659210_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_015461969.1|2659206_2659959_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_069578986.1|2660134_2660794_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_015461970.1|2660790_2661414_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.2	4.7e-06
WP_034168305.1|2662175_2662385_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_069578987.1|2662396_2663386_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_069578988.1|2663394_2665059_+	FUSC family protein	NA	NA	NA	NA	NA
WP_012849295.1|2665615_2666197_-|tail	tail protein	tail	A0A218M4J2	Erwinia_phage	48.4	1.3e-42
WP_015461973.1|2666199_2668356_-|tail	tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	49.2	2.6e-27
WP_071881868.1|2668416_2669289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014526501.1|2669468_2670131_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	28.3	2.1e-12
WP_071840979.1|2670184_2671186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015461975.1|2671182_2674278_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	52.6	0.0e+00
WP_034168787.1|2674337_2674985_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	50.0	2.1e-49
WP_015461977.1|2674879_2675614_-|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	65.3	1.8e-97
WP_015461978.1|2675649_2676348_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	60.3	4.2e-80
WP_015461979.1|2676357_2676687_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	47.7	1.1e-22
WP_071840980.1|2676738_2677092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015461980.1|2677145_2680079_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	27.9	3.3e-33
WP_015461981.1|2680316_2680655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015461982.1|2680664_2681144_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	41.1	1.6e-25
WP_015461983.1|2681189_2681600_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	64.8	2.2e-36
WP_015461984.1|2681603_2681984_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	49.2	6.1e-33
WP_015461985.1|2681964_2682309_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	57.8	2.7e-24
WP_015461986.1|2682305_2682635_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	55.0	1.8e-25
WP_084822840.1|2682666_2682972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578991.1|2682968_2684192_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.7	2.1e-196
WP_069578993.1|2684204_2685062_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	72.6	2.1e-113
WP_069578994.1|2685069_2686398_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	75.9	1.9e-185
WP_041692784.1|2686397_2688140_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.4	3.1e-140
WP_015461993.1|2688093_2688561_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.0	2.2e-45
WP_069578997.1|2689255_2689720_-|lysis	lysis protein	lysis	G9L6J7	Escherichia_phage	64.3	6.5e-45
WP_084822842.1|2689787_2690639_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	58.4	2.7e-28
WP_069578998.1|2690762_2691308_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	71.2	1.5e-72
WP_015462001.1|2691304_2691586_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	49.5	9.4e-15
WP_014526530.1|2691582_2691954_-	membrane protein	NA	S4TRS4	Salmonella_phage	40.9	1.9e-15
WP_014526529.1|2692153_2692432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069578999.1|2692666_2693437_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	51.2	2.2e-69
WP_069579001.1|2693456_2694500_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	38.7	1.2e-62
WP_109579762.1|2694499_2694718_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	45.6	3.5e-09
WP_034168925.1|2694714_2695530_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	58.7	2.3e-85
WP_069579002.1|2695685_2696081_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	57.6	8.9e-35
WP_069579004.1|2696080_2698249_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.1	4.5e-181
WP_069579006.1|2698490_2699636_-	replication protein O	NA	A0A1P8DTG2	Proteus_phage	53.8	2.3e-35
WP_015462010.1|2699635_2699815_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_015462011.1|2700009_2700549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015462012.1|2700626_2700842_-	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	76.1	3.8e-24
WP_015462013.1|2700967_2701669_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	69.8	2.0e-93
WP_015462014.1|2701948_2702464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015462015.1|2702746_2703070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069579007.1|2703702_2704641_+	exonuclease	NA	A0A1Y0SUG1	Pseudomonas_phage	33.9	9.4e-43
WP_069579008.1|2704637_2704985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069579011.1|2705586_2705859_+	hypothetical protein	NA	A0A077K9V8	Edwardsiella_phage	57.5	2.7e-22
WP_069579012.1|2705855_2706521_+	morphogenetic protein	NA	A0A077KCB2	Edwardsiella_phage	45.5	1.6e-44
2706667:2706692	attL	TAACCCATGACCACTATTACCAAAGA	NA	NA	NA	NA
WP_052219252.1|2706672_2707104_+	hypothetical protein	NA	A0A077K9V6	Edwardsiella_phage	53.2	1.1e-27
WP_015462020.1|2707096_2707702_+	exodeoxyribonuclease VIII	NA	A0A2D1GMH0	Marinobacter_phage	27.8	8.0e-11
WP_015462021.1|2707701_2708517_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	59.1	1.6e-75
WP_015462022.1|2708522_2708723_+	excisionase	NA	A0A2R2Z2X2	Escherichia_phage	58.3	2.5e-14
WP_015462023.1|2708706_2709876_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	75.1	4.7e-185
WP_069579014.1|2710305_2711463_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P7E1	Enterobacteria_phage	78.5	6.8e-176
WP_012849295.1|2711562_2712144_-|tail	tail protein	tail	A0A218M4J2	Erwinia_phage	48.4	1.3e-42
WP_071890324.1|2712146_2714303_-|tail	phage tail protein	tail	A0A2D1UII2	Escherichia_phage	50.0	4.0e-28
WP_069579016.1|2714376_2715039_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	28.9	1.9e-13
WP_071890327.1|2715092_2716094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069579018.1|2716090_2719210_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	57.8	0.0e+00
WP_071881870.1|2719250_2719904_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	64.2	1.0e-72
WP_034162699.1|2719801_2720539_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	70.2	1.8e-105
WP_034162700.1|2720627_2721164_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	56.4	7.1e-27
WP_034162701.1|2721242_2721941_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	70.3	1.3e-92
WP_014526494.1|2721956_2722286_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	56.9	6.9e-33
WP_034162702.1|2722285_2725192_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	39.2	1.2e-120
WP_034168887.1|2725181_2725508_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	43.2	7.1e-14
WP_069579019.1|2725516_2725915_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	38.0	3.8e-09
WP_069579020.1|2725967_2726738_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	43.4	1.4e-39
WP_014526489.1|2726739_2727153_-|tail	minor tail component of prophage	tail	A5LH34	Enterobacteria_phage	40.5	2.2e-20
WP_014526488.1|2727149_2727728_-|tail	tail component of prophage protein	tail	NA	NA	NA	NA
WP_014526487.1|2727739_2728021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014526486.1|2728013_2728337_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	66.0	1.1e-30
WP_109729117.1|2728429_2730490_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	72.8	2.2e-278
WP_014526543.1|2730401_2731928_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	65.2	1.5e-183
WP_014526542.1|2731927_2732131_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	45.7	7.5e-06
WP_014526541.1|2732127_2734221_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	70.7	1.0e-294
WP_014526540.1|2734220_2734757_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	59.8	7.8e-50
WP_069579021.1|2735494_2735767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156776834.1|2735747_2735897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034168038.1|2735998_2736286_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	59.8	9.9e-28
WP_069579022.1|2736482_2736881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084822842.1|2736880_2737732_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	58.4	2.7e-28
WP_069578998.1|2737855_2738401_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	71.2	1.5e-72
WP_015462001.1|2738397_2738679_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	49.5	9.4e-15
WP_014526529.1|2739245_2739524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034168911.1|2739758_2740529_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	51.6	1.3e-69
WP_069579024.1|2740548_2741592_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	39.0	5.4e-63
WP_109579762.1|2741591_2741810_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	45.6	3.5e-09
WP_034168925.1|2741806_2742622_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	58.7	2.3e-85
WP_069579002.1|2742777_2743173_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	57.6	8.9e-35
WP_069579004.1|2743172_2745341_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.1	4.5e-181
WP_069579006.1|2745582_2746728_-	replication protein O	NA	A0A1P8DTG2	Proteus_phage	53.8	2.3e-35
WP_015462010.1|2746727_2746907_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_015462011.1|2747101_2747641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069579025.1|2747694_2747901_-	transcriptional regulator	NA	U5P445	Shigella_phage	60.9	4.8e-16
WP_071890393.1|2747988_2748657_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	74.3	1.5e-95
WP_069579026.1|2748795_2749119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069579007.1|2749751_2750690_+	exonuclease	NA	A0A1Y0SUG1	Pseudomonas_phage	33.9	9.4e-43
WP_069579008.1|2750686_2751034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069579011.1|2751635_2751908_+	hypothetical protein	NA	A0A077K9V8	Edwardsiella_phage	57.5	2.7e-22
WP_069579028.1|2751904_2752570_+	morphogenetic protein	NA	A0A077KCB2	Edwardsiella_phage	45.5	1.2e-44
WP_069579031.1|2753448_2754054_+	3'-5' exoribonuclease	NA	A0A067ZJ28	Vibrio_phage	30.0	9.5e-12
2752761:2752786	attR	TAACCCATGACCACTATTACCAAAGA	NA	NA	NA	NA
WP_069579033.1|2754053_2754854_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	59.1	1.3e-77
WP_034165921.1|2754939_2755140_+	excisionase	NA	K7P7V0	Enterobacteria_phage	74.2	3.0e-23
>prophage 8
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	2991074	2997696	3923603	integrase	Morganella_phage(33.33%)	8	2988913:2988926	2998127:2998140
2988913:2988926	attL	TCCTCCAGCACGAT	NA	NA	NA	NA
WP_109729112.1|2991074_2991668_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.7	6.3e-61
WP_069579184.1|2991681_2992116_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.9	4.7e-29
WP_069579185.1|2992115_2992313_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.2	2.3e-07
WP_069579187.1|2992544_2993276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078000323.1|2993289_2993631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069579669.1|2993765_2994902_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	92.7	4.0e-205
WP_069579189.1|2995184_2996399_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.6	3.7e-124
WP_069579670.1|2996838_2997696_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.9	1.3e-30
2998127:2998140	attR	TCCTCCAGCACGAT	NA	NA	NA	NA
>prophage 9
NZ_CP016044	Edwardsiella piscicida strain S11-285 chromosome, complete genome	3923603	3193788	3208417	3923603	tRNA	uncultured_Mediterranean_phage(28.57%)	13	NA	NA
WP_069579272.1|3193788_3195369_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.4e-09
WP_015462241.1|3195866_3196184_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_012849694.1|3196307_3196976_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_069579274.1|3197138_3199697_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.7	5.8e-26
WP_012849696.1|3199749_3200736_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.0e-31
WP_071818536.1|3200787_3201744_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.9e-07
WP_069579275.1|3202054_3202693_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.0	1.8e-37
WP_012849699.1|3202686_3203451_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.8	1.5e-67
WP_012849700.1|3203431_3204478_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_012849701.1|3204481_3204955_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_012849702.1|3204958_3205690_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012849703.1|3205743_3206088_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_034167940.1|3206170_3208417_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	9.3e-12
